GP73 blockade alleviates abnormal glucose homeostasis in diabetic mice

in Journal of Molecular Endocrinology
Authors:
Xiaopan YangBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China

Search for other papers by Xiaopan Yang in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0003-1442-6179
,
Xiaojing FanDepartment of Endocrinology, Fifth Medical Center of Chinese PLA General Hospital, Beijing, China

Search for other papers by Xiaojing Fan in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0001-8686-8254
,
Jiangyue FengBeijing Sungen Biomedical Technology Co. Ltd., Beijing, China

Search for other papers by Jiangyue Feng in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0002-7215-8881
,
Tinghui FanBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China

Search for other papers by Tinghui Fan in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0003-1507-2958
,
Jingfei LiBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China
Institute of Physical Science and Information Technology, Anhui University, Hefei, China

Search for other papers by Jingfei Li in
Current site
Google Scholar
PubMed
Close
,
Linfei HuangBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China

Search for other papers by Linfei Huang in
Current site
Google Scholar
PubMed
Close
,
Luming WanBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China

Search for other papers by Luming Wan in
Current site
Google Scholar
PubMed
Close
,
Huan YangBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China

Search for other papers by Huan Yang in
Current site
Google Scholar
PubMed
Close
,
Huilong LiBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China

Search for other papers by Huilong Li in
Current site
Google Scholar
PubMed
Close
,
Jing GongBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China

Search for other papers by Jing Gong in
Current site
Google Scholar
PubMed
Close
,
Yanhong ZhangBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China

Search for other papers by Yanhong Zhang in
Current site
Google Scholar
PubMed
Close
,
Qi GaoBeijing Sungen Biomedical Technology Co. Ltd., Beijing, China

Search for other papers by Qi Gao in
Current site
Google Scholar
PubMed
Close
,
Fei ZhengBeijing Sungen Biomedical Technology Co. Ltd., Beijing, China

Search for other papers by Fei Zheng in
Current site
Google Scholar
PubMed
Close
,
Lei XuBeijing Sungen Biomedical Technology Co. Ltd., Beijing, China

Search for other papers by Lei Xu in
Current site
Google Scholar
PubMed
Close
,
Haotian LinBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China

Search for other papers by Haotian Lin in
Current site
Google Scholar
PubMed
Close
,
Dandan ZhangDepartment of Laboratory, the Third Medical Center of Chinese PLA General Hospital, Beijing, China
Department of Laboratory, General Hospital of Armed Police Forces, Anhui Medical University, Hefei, China

Search for other papers by Dandan Zhang in
Current site
Google Scholar
PubMed
Close
,
Hongbin SongDepartment of Laboratory, the Third Medical Center of Chinese PLA General Hospital, Beijing, China
Department of Laboratory, General Hospital of Armed Police Forces, Anhui Medical University, Hefei, China

Search for other papers by Hongbin Song in
Current site
Google Scholar
PubMed
Close
,
Yufei WangDepartment of Laboratory, the Third Medical Center of Chinese PLA General Hospital, Beijing, China
Department of Laboratory, General Hospital of Armed Police Forces, Anhui Medical University, Hefei, China

Search for other papers by Yufei Wang in
Current site
Google Scholar
PubMed
Close
,
Xueping MaDepartment of Laboratory, the Third Medical Center of Chinese PLA General Hospital, Beijing, China
Department of Laboratory, General Hospital of Armed Police Forces, Anhui Medical University, Hefei, China

Search for other papers by Xueping Ma in
Current site
Google Scholar
PubMed
Close
,
Zhiwei SunBeijing Sungen Biomedical Technology Co. Ltd., Beijing, China

Search for other papers by Zhiwei Sun in
Current site
Google Scholar
PubMed
Close
,
Cheng CaoBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China

Search for other papers by Cheng Cao in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0002-0279-7135
,
Xiaoli YangDepartment of Laboratory, the Third Medical Center of Chinese PLA General Hospital, Beijing, China
Department of Laboratory, General Hospital of Armed Police Forces, Anhui Medical University, Hefei, China

Search for other papers by Xiaoli Yang in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0002-8619-8489
,
Hui ZhongBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China

Search for other papers by Hui Zhong in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0003-2128-9686
,
Yi FangBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China
Department of Endocrinology, Fifth Medical Center of Chinese PLA General Hospital, Beijing, China

Search for other papers by Yi Fang in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0002-6058-1375
, and
Congwen WeiBeijing Institute of Biotechnology, Academy of Military Medical Sciences, Beijing, China

Search for other papers by Congwen Wei in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0002-3966-5507

Correspondence should be addressed to C Wei: weicongwen@aliyun.com

*(X Yang, X Fan, J Feng, and T Fan contributed equally to this work)

(C Cao, X Yang, H Zhong, Y Fang, and C Wei contributed equally as joint supervisors of the work)

Free access

Golgi protein 73 (GP73), also called Golgi membrane protein 1 (GOLM1), is a resident Golgi type II transmembrane protein and is considered as a serum marker for the detection of a variety of cancers. A recent work revealed the role of the secreted GP73 in stimulating liver glucose production and systemic glucose homeostasis. Since exaggerated hepatic glucose production plays a key role in the pathogenesis of type 1 diabetes mellitus (T1DM) and type 2 diabetes mellitus (T2DM), GP73 may thus represent a potential therapeutic target for treating diabetic patients with pathologically elevated levels. Here, in this study, we found that the circulating GP73 levels were significantly elevated in T2DM and positively correlated with hemoglobin A1c. Notably, the aberrantly upregulated GP73 levels were indispensable for the enhanced protein kinase A signaling pathway associated with diabetes. In diet-induced obese mouse model, GP73 siRNA primarily targeting liver tissue was potently effective in alleviating abnormal glucose metabolism. Ablation of GP73 from whole animals also exerted a profound glucose-lowering effect. Importantly, neutralizing circulating GP73 improved glucose metabolism in streptozotocin (STZ) and high-fat diet/STZ-induced diabetic mice. We thus concluded that GP73 was a feasible therapeutic target for the treatment of diabetes.

Abstract

Golgi protein 73 (GP73), also called Golgi membrane protein 1 (GOLM1), is a resident Golgi type II transmembrane protein and is considered as a serum marker for the detection of a variety of cancers. A recent work revealed the role of the secreted GP73 in stimulating liver glucose production and systemic glucose homeostasis. Since exaggerated hepatic glucose production plays a key role in the pathogenesis of type 1 diabetes mellitus (T1DM) and type 2 diabetes mellitus (T2DM), GP73 may thus represent a potential therapeutic target for treating diabetic patients with pathologically elevated levels. Here, in this study, we found that the circulating GP73 levels were significantly elevated in T2DM and positively correlated with hemoglobin A1c. Notably, the aberrantly upregulated GP73 levels were indispensable for the enhanced protein kinase A signaling pathway associated with diabetes. In diet-induced obese mouse model, GP73 siRNA primarily targeting liver tissue was potently effective in alleviating abnormal glucose metabolism. Ablation of GP73 from whole animals also exerted a profound glucose-lowering effect. Importantly, neutralizing circulating GP73 improved glucose metabolism in streptozotocin (STZ) and high-fat diet/STZ-induced diabetic mice. We thus concluded that GP73 was a feasible therapeutic target for the treatment of diabetes.

Introduction

Diabetes mellitus is a syndrome of metabolic disorder with abnormally high blood glucose levels. The two most common categories of diabetes are type 1 diabetes mellitus (T1DM) and type 2 diabetes mellitus (T2DM) (Magliano et al. 2020). T1DM is an autoimmune disease resulting from the immune cell-mediated destruction of pancreatic β-cells, comprising less than 10% of diabetic population. T2DM is characterized by relative insulin deficiency caused by impaired response to insulin and β-cell dysfunction, and about 20% of the elderly (65 years of age or older) have T2DM (Laiteerapong et al. 2018). Both T1DM and T2DM lead to hyperglycemia and are associated with a number of complications, including renal failure, blindness, slow healing wounds, and cardiovascular diseases (Forbes & Cooper 2013). Excessive hepatic glucose production contributes to exaggerated fasting and postprandial hyperglycemia in T2DM. Like T2DM, hepatic and peripheral glucose uptake are also altered in T1DM, accompanied by excessive hepatic glucose production (Kacerovsky et al. 2011). Due to insulin deficiency, glucagon stimulation of the key glucogenic enzymes is not restrained, and inhibition of glucagon action can prevent hyperglycemia in insulin-deficient rodent models of diabetes (Okamoto et al. 2017).

Cyclic adenosine monophosphate (cAMP) exerts many of its physiological effects by activating cAMP-dependent protein kinase A (PKA), which in turn phosphorylates and regulates the functions of downstream protein targets, including ion channels, enzymes, and transcription factors. cAMP/PKA signaling pathway regulates glucose homeostasis at multiple levels, including insulin and glucagon secretion, glucose uptake, glycogen synthesis and breakdown, and gluconeogenesis (Yang & Yang 2016).

Golgi protein 73 (GP73), also called Golgi membrane protein 1 (GOLM1), is a resident Golgi type II transmembrane protein located at the luminal surface of the Golgi apparatus and mainly expressed in epithelial cells (Yang et al. 2017). Under steady-state conditions, GP73 undergoes cleavage at a pro-protein convertase cleavage site for trafficking to distal compartments and returning to the Golgi via a late endosomal bypass pathway (Bachert et al. 2007). However, overexpression of GP73 results in saturation of the retrieval system and the subsequent release of its ectodomain. A markedly elevated GP73 expression is associated with a variety of acute and chronic liver diseases and is considered as a serum marker for the early detection of hepatocellular carcinoma in patients with cirrhosis (Gatselis et al. 2020). In the past two decades, the biological functions of GP73 have primarily been attributed to its role as an intracellular protein in carcinogenesis by activating matrix metalloproteinase-13, suppressing autophagy-mediated anti-tumor immunity (Sui et al. 2021), and regulating the kinetics of epidermal growth factor receptor/growth factor-responsive receptor tyrosine kinases complex recycling (Jin et al. 2015, Ye et al. 2016). In addition to its intracellular function, we recently demonstrated that circulating GP73 is actively secreted into the extracellular space as a signaling molecule in response to endoplasmic reticulum stress and induces macrophages to release factors involved in the tumor-associated macrophage phenotype (Wei et al. 2019). The secreted GP73 also acts as a glucogenic hormone that regulates hepatic glucose production and systemic glucose homeostasis. Our previous research showed that GP73 secretion was promoted by SARS-CoV-2 infection and contributes to SARS-CoV-2-induced glucose abnormalities by stimulating gluconeogenesis through the cAMP/PKA pathway (Wan et al. 2022).

In this study, we found that serum GP73 levels were significantly elevated in diabetic mice and humans and that blocking GP73 with a monoclonal antibody (mAb), siRNA knockdown, or genetic deficiency improved glucose homeostasis in streptozotocin (STZ)- and high-fat diet (HFD)/STZ-induced diabetic mice. Taken together, these findings suggested that secreted GP73 might represent a promising target for the development of a new therapeutic strategy against diabetes.

Materials and methods

Clinical samples

Study population

This was a retrospective cohort study. The study was approved by the Committee for Ethics in Human Studies from the Third Medical Center of the Chinese PLA General Hospital (KY2021-009). Basic information, serum biochemical test results, and serum GP73 levels were collected from electronic medical files in patients from endocrinology departments of the Third Medical Center of the Chinese PLA General Hospital from December 2019 to February 2021 at admission. Only those following each of the inclusion criteria and none of the exclusion criteria were recruited as original samples:

The inclusion criteria were as follows:

  1. Men or women with T2DM.

  2. Fasting blood glucose (FBG) levels ≥ 7.0 mmol/L.

  3. Duration of diabetes < 10 years.

  4. No history of severe hypoglycemic in the preceding 3 months.

Participants with the following situation would be excluded:

  1. Eye diseases or history of eye surgery.

  2. Cancer, infectious disease, hypertension (systolic blood pressure (SBP) ≥ 140 mm Hg or diastolic blood pressure (DBP) ≥ 90 mm Hg), and any other severe chronic systemic diseases.

After screening electronic files based on the above standards, 190 T2DM patients were chosen as the original samples. In addition, 100 healthy volunteers of the same period in the Physical Examination Center of Third Medical Center of the Chinese PLA General Hospital were recruited as controls. Propensity score matching was then applied to achieve balanced covariates among age, sex, and body mass index (BMI). T2DM cases were matched in a 1:1 ratio to healthy controls based on the propensity score with a standard caliper width of 0.1. Eventually, 40 healthy controls and 40 T2DM patients were included in the analysis. The characteristics of participants are presented in Supplementary Table 1 (see section on supplementary materials given at the end of this article).

T2DM diagnosis

Outpatients were diagnosed as T2DM according to 1999 World Health Organization criteria: the classic symptoms of hyperglycemia include polyuria, polydipsia, and unexplained weight loss and a random plasma glucose ≥ 11.1 mmol/L, FBG levels ≥ 7.0 mmol/L, or 2 h blood glucose levels ≥ 11.1 mmol/L during oral glucose tolerance test. For inpatients, a diagnosis of diabetes was also recognized according to ICD-10 diagnosis codes (E11.901). Patients were excluded if diagnosed with T1DM, gestational diabetes mellitus, or other specific types of diabetes.

Data analysis

We collected the data of weight, height, BMI, SBP, DBP, the level of haemoglobin A1c (HbA1c), FBG, lipid concentrations, alanine transaminase (ALT), aspartate transaminase (AST), and GP73 levels from the enrolled participants at admission and GP73 levels between groups.

Reagents and antibodies

STZ (S0103), aprotinin (A6106), and anti-α-tubulin (T6074, 1:5000 dilution) were purchased from Sigma-Aldrich. Insulin (2018283062) was purchased from Novo Nordisk. Chow (HD1001) and HFD (HD001) were purchased from BiotechHD Co., Ltd. (Beijing, China). Anti-GP73 antibody (F-12, sc-393372, 1:200 dilution) was purchased from Santa Cruz. Anti-phospho-PKA substrate (RRXpS/T, 9624, 1:1000 dilution) and anti-PKA-C-α (5842, 1:1000 dilution) antibodies were purchased from Cell Signaling Technology. Anti-rabbit HRP-IgG (ZB-2301, 1:5000 dilution) and anti-mouse HRP-IgG (ZB-2305, 1:5000 dilution) secondary antibodies were purchased from ZSGB-BIO Co., Ltd. (Beijing, China). Anti-GP73 mAb for the blocking experiment was custom made by Beijing Hotgen Biotech Co., Ltd (Beijing, China). The process of anti-GP73 mAb production included immunization of laboratory mice, cell fusion, animal immunity, cell fusion, hybridoma cell screening and mAb detection, hybridoma cell cloning, mAb identification, and purification. We have validated the anti-GP73 antibody from Santa Cruz using GP73 whole-body knockout (KO) mice, and successful knockdown of GP73 on protein levels was identified in multiple tissues from KO mice (Supplementary Figure 1). Isotype-matched IgG (A7028) was purchased from Beyotime Biotech Co., Ltd. (Shanghai, China).

Animals

All animal experiments were approved by the IACUC of Academy of Military Medical Sciences (AMMS) and performed at the AMMS Animal Center. All mice were group-housed conventionally and maintained on a 12-h light/darkness cycle for 7 days before any experiments. Body weight was measured at the indicated times in the fed state.

GP73-KO mice (T20200316-18[D25]) were generated at Southern Model Biotechnology Co., Ltd. (Shanghai, China) using Clustered Regularly Interspacred Short Palindromic Repeats (CRISPR)–Cas9 system, as described previously (Wang et al. 2021). In brief, Cas9 mRNA was in vitro transcribed with mMESSAGE mMACHINE T7 Ultra Kit (Ambion), and sgRNAs were generated using the MEGA shortscript Kit (ThermoFisher), both according to the manufacturer’s instructions. The following sequences were used for sgRNA synthesis: left sgRNA, CTGGACAAGCCTTCATCCCTTGG; right sgRNA, TGCCTTCTGACCTTGGCCTGAGG. In vitro-transcribed Cas9 mRNA and sgRNAs were injected into zygotes of C57BL/6J mouse and transferred to pseudopregnant recipients. Homozygous KO mice were born from a heterozygous (HE) intercross and used for phenotypic analyses in parallel with chow-fed wild-type (WT) littermates (8–10 weeks old) on the C57BL/6N genetic background. All mice were genotyped using PCR with specific primers (forward, 5’-GTCACAACGAAGCCGACTGACCTACAT-3’ and reverse, 5’-GCGAGTTTCAGGACAGTTAAGGCTGC-3’). Male C57BLKS/J db/db mice and BKS control mice (8-week-old, weighing 36–40 g) were purchased from GemPharma Tech Co., Ltd. (Jiangsu, China). The male WT C57BL/6N mice were used to establish STZ- and HFD/STZ-induced mice models and diet-induced obesity (DIO) in this study.

For primary mouse hepatocyte (PMHs) gluconeogenesis production assays, PMHs were isolated and purified with a modified two-step collagenase perfusion method. Cells were resuspended in low-glucose DMEM medium containing 5% FBS and seeded on six-well plates at 80% confluence. Five hours later, cells were washed and cultured in serum-free medium overnight. Thereafter, the medium was replaced with glucose- and phenol-free DMEM the next day, supplemented with 10 mM pyruvate sodium and 10 mM sodium lactate, and the cells were incubated for 4 h with vehicle or recombinant mGP73 (64 nM). Then, the glucose amounts of collected supernatants were measured by AmplexTM Red Glucose Assay Kit (ThermoFisher Scientific) as manufacturer’s instruction and normalized by cell protein concentration determined by bicinchoninic acid (BCA) assay.

For HFD/STZ-induced mouse model, mice were fed a HFD (60% kcal fat, HD001, BiotechHD Co., Ltd., Beijing, China) for 4 weeks followed by intraperitoneal injection of low-dose STZ (40 mg/kg body weight; S0103, MO, USA). For 24 h after the injection, the mice were administered 40 mg/kg STZ for a second time and maintained on an HFD for additional 4 weeks to establish HFD/STZ-induced mouse model (Wang et al. 2018). Regular chow diet-fed mice with injecting citrate buffer were used as controls. FBG levels over 16.7 mmol/L were considered diagnostic of diabetes.

For STZ-induced mouse model, mice were intraperitoneally injected with a single high-dose STZ (110 mg/kg body weight) or citrate buffer as control (Glastras et al. 2016). Three weeks after STZ injection, model mice with FBG over 16.7 mmol/L were matched by random blood glucose level, body weight, and body composition and randomly divided into two groups (n  = 6 mice/group) receiving s.c. injections of either IgG (10 mg/kg) or anti-GP73 mAb (10 mg/kg) twice a week for 4 weeks.

For DIO mouse model, mice were maintained on HFD (60% kcal fat, D12492i, Research Diets, Inc., New Brunswick, NJ, USA) starting at 5 weeks of age for 12 weeks. DIO mice were injected with siGP73 or control siRNA oligos via tail vein twice a week for 4 weeks. Before and after the treatment, blood samples were collected from the tail after 6 h of daytime food withdrawal. Insulin and glucose tolerance tests were performed in DIO mice after 3 or 4 weeks of treatment, respectively. Mice were then sacrificed for the collection of serum and liver tissues after 4 weeks of treatment.

GTT, ITT, and PTT

Glucose tolerance tests (GTT), pyruvate tolerance tests (PTT), and insulin tolerance tests (ITT) were performed after overnight fasting. Glucose was measured in blood collected from the tail vein before and 15, 30, 60, 90, or 120 min after intraperitoneal injection of glucose (1.5 g/kg body weight), sodium pyruvate (2 g/kg body weight), or insulin (1.5 U/kg body weight) by using the glucometer (06656919032, Roche).

Biochemical analysis

The blood was allowed to clot at room temperature for 30 min, and the serum was obtained by centrifugation (1500 g, 15 min, 4°C). Blood biochemical results were measured by the mouse AST (200218), ALT (191230), triglyceride (TG, 200224), and cholesterol (CHO, 200224) biochemical test kits (Ruierda Biological Technology Co., Ltd., Beijing, China) in accordance with the manufacturer’s protocol.

Chemical modifications siRNA for in vivo study

In the sense strand of siRNA, the 3' terminus was modified by cholesterol and four thiols, the 5’ terminus was modified by two thiols, and the whole strand was modified by 2'-O-methyl (2'OMe-modified). All siRNAs were obtained from GenePharma Co., Ltd. (Shanghai, China). The siRNAs targeting GP73 are listed as Supplementary Table 2.

In vivo imaging system

GP73 was labeled with Cy7 via the addition of the dye according to the manufacturer’s instructions at pH 8.0 and incubation of the mixture for 4 h on ice. Labeled GP73 was returned to pH 7.0, and the free dye was removed via overnight dialysis in PBS. The labeled GP73 was added to a Sephadex G50 size-exclusion column equilibrated with PBS. Fractions of 500 µL were collected, the protein concentration was analyzed using a standard BCA protein assay kit, and fluorescence corresponding to excitation/emission of 745/800 nm was assessed. We administrated mice with a mixture of GP73 antigen and anti-GP73 mAb via a tail vein, and mice injected with a mixture of GP73 antigen and IgG were used as controls. After 24 h, mice were i.v. injected with free Cy7 and GP73-Cy7 and scanned using an IVIS Spectrum In Vivo Imaging System (PerkinElmer) to assess the fluorescence. After whole-body imaging, the mice were sacrificed, and the livers were imaged to assess fluorescence under the same settings as the in vivo imaging. The data were analyzed and exported using built-in Living Image Software (v.4.5.5, PerkinElmer).

Western blot and PKA activity analysis

The Huh-7 cells lysates were prepared in buffer containing 150 mM NaCl, 50 mM Tris–HCl pH 7.5, 0.1% w/v SDS, 0.5% w/v Na-deoxycholate, 1% v/v Nonidet P-40, 1 mM ethylene diamine tetraacetic acid, 1 mM ethylene glycol-bis (β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA), 2.5 mM Na-pyrophosphate, 1 mM NaVO4, 10 mM NaF, and protease inhibitors (Sigma). The lysates were centrifuged at 13,000 g for 15 min at 4°C, and the proteins in the supernatants were separated by SDS-PAGE. The separated proteins were transferred to polyvinylidene fluoride membranes for immunoblot analyses using the indicated primary antibodies. The relative expression showed by blots was quantitatively analyzed by Image J software (NIH). PKA enzymatic activity was analyzed in Huh-7 cells cultured with serum from healthy controls and patients with T2DM. The clinical data of these participants were listed in Supplementary Tables 3 and 4. The relative expression levels of PKA-C-α-p or PKA-C-α were calculated by PKA-C-α-p over total tubulin or PKA-C-α over total tubulin. PKA phosphorylation was analyzed by the relative expression ratio of PKA-α-p to PKA-C-α, and PKA activity was represented by phospho-PKA substrate RRXpS/T over total tubulin.

Quantitative real-time PCR

Tissue RNA was extracted using TRIzol (Invitrogen) according to the manufacturer's protocol. First-strand cDNA was synthesized using an iScript cDNA Synthesis Kit (Bio-Rad). qPCR reactions were performed using a Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies). Data were analyzed using a ViiA7 QPCR machine (Applied Biosystems, Life Technologies). Primers used for qPCR are shown in Supplementary Table 5.

Statistical analysis

Statistics were completed and visualized using GraphPad Prism 8.0. Differences between two independent groups were evaluated using two-tailed Student’s t-tests or the Mann–Whitney test. Differences between multiple groups were analyzed using one-way ANOVA or two-way ANOVA followed by Bonferroni’s post hoc test where applicable. Correlations were analyzed using Spearman’s non-parametric test. All tests were two-tailed unless otherwise indicated. All data are presented as the mean ± s.e.m . Results with a P < 0.05 were considered statistically significant. Significance values were set as follows: *P < 0.05; **P < 0.01, ***P < 0.001. All biological replicates were justified by a power calculator PASS 15.0 and shown in Supplementary Table 6.

Results

Serum GP73 levels are elevated in diabetic mice and humans

Since excessive gluconeogenesis directly predisposes the host to abnormal glucose metabolism and secreted GP73 is a glucogenic hormone, we then compared the serum GP73 levels in healthy and T2DM individuals. Notably, the serum GP73 levels were significantly increased in patients with T2DM compared with healthy controls (Fig. 1A). In addition, the serum GP73 levels were positively correlated with the plasma HbA1c levels in T2DM (Fig. 1B).

Figure 1
Figure 1

Serum GP73 levels are elevated in diabetic mice and humans. (A) Serum GP73 levels in healthy (n  = 40) and T2DM participants (n  = 40). (B) Correlation analysis between serum GP73 levels and HbA1c levels in T2DM patients. (C–F) Fasting blood glucose (FBG) levels (C), serum GP73 levels (D), hepatic (E) and renal (F) glucogenic gene expression, hepatic and renal GP73 mRNA expression (G) in BKS or db/db mice (n  = 6). (H–K) FBG levels (H, J) and serum GP73 levels (I, K) in STZ-induced or HFD/STZ-induced mice and their controls. GP73 mRNA expression in various mouse organs (L) from HFD/STZ-induced mice or regular chow diet-fed mice. Data in (A) were analyzed by Mann–Whitney U test. Data in (B) were analyzed by Spearman's correlation analysis. Data in (E–G) and (L) were analyzed by two-way ANOVA followed by Bonferroni’s post hoc test. Other data were analyzed by two-tailed Student’s t-tests. *P < 0.05; **P < 0.01, ***P < 0.001.

Citation: Journal of Molecular Endocrinology 70, 2; 10.1530/JME-22-0103

To continue our investigation, the db/db mice, an established genetic mouse model for type 2 diabetes that lacks functional leptin receptors, were used. As compared with the BKS controls, db/db mice exhibited severe fasting hyperglycemia, increased serum GP73 level (Fig. 1C and D), and significantly upregulated expressions of glucogenic genes in the liver and kidney (Fig. 1E and F). In particular, GP73 expressions were higher in liver and kidney from db/db mice (Fig. 1G). The STZ-induced mice also exhibited severe fasting hyperglycemia (Fig. 1H). Moreover, the serum GP73 levels were higher in STZ-induced mice compared with their controls (Fig. 1I). HFD/STZ-induced mice, similar to db/db mice, showed elevated blood glucose levels and serum GP73 levels (Fig. 1J and K). We next measured the GP73 mRNA expression profiles in various tissues from HFD/STZ-induced mouse model to assess the potential sources of GP73. Specifically, the expressions of GP73 mRNA were significantly increased in the liver and white adipose tissue of HFD/STZ-induced mice (Fig. 1L). The upregulation was notably striking in liver tissue, indicating that the liver is a major source of serum GP73 under glucotoxicity conditions. Therefore, the pathophysiological relevance of GP73 to hyperglycemia associated with diabetes was established.

GP73 is indispensable for enhanced PKA signaling in diabetes

We next investigate the effect of serum GP73 on PKA enzymatic activity in cultured Huh-7 cells. The serum was obtained from T2DM patients with GP73 levels higher than 60 ng/mL and age-matched healthy individuals with GP73 levels lower than 30 ng/mL. PKA enzymatic activity was more strongly induced in cells exposed to serum from T2DM patients than cells exposed to serum from healthy controls (Fig. 2A and B). Treatment with an anti-GP73 antibody blocked the PKA activation induced by serum from T2DM patients with high GP73 levels (Fig. 2C and  D). Therefore, we concluded that elevated GP73 levels in diabetes might contribute to excessive gluconeogenesis.

Figure 2
Figure 2

GP73 is indispensable for enhancing PKA signaling in diabetes. (A, B) PKA enzymatic activity in Huh-7 cells cultured with the indicated serum from healthy controls or patients with T2DM. (C, D) PKA enzymatic activity in Huh-7 cells cultured with indicated serum from healthy controls or T2DM in the presence or absence of anti-GP73 antibody. The relative expression levels of PKA-C-α-p or PKA-C-α were calculated by PKA-C-α-p over α-tubulin or PKA-C-α over α-tubulin. PKA phosphorylation was analyzed by the relative expression ratio of PKA-α-p to PKA-C-α, and PKA activity was represented by phospho-PKA substrate RRXpS/T over α-tubulin. Data in (B) were analyzed by two-tailed Student’s t-tests. Data in (D) were analyzed by two-way ANOVA followed by Bonferroni’s post hoc test. *P < 0.05; **P < 0.01, ***P < 0.001.

Citation: Journal of Molecular Endocrinology 70, 2; 10.1530/JME-22-0103

Ablation of GP73 from whole animals has a profound glucose-lowering effect

To validate immunologic sequestration as a legitimate loss-of-function strategy, we first set out to measure the blood glucose levels in GP73-KO mice whose relative GP73 mRNA levels in various organs were undetectable (Fig. 3A). In adult male mice, the blood glucose levels were significantly decreased in both heterozygous (HE) and homozygous (KO) mice compared with WT littermate controls under fed and fasting conditions (Fig. 3B and C). No significantly different blood glucose levels were identified in female mice (Fig. 3D and E). Therefore, male mice were used unless otherwise noted. Lower fasting insulin levels, similar glucagon levels, similar food intake, and body weight were observed in GP73-KO mice compared with WT littermate controls (Fig. 3F, G, H, and I). Moreover, the ability of pyruvate conversion to hepatic glucose production was also significantly decreased in GP73-KO mice (Fig. 3J). However, glucose tolerance and insulin sensitivity were similar between GP73-KO mice and WT controls (Fig 3K and L). Of note, the fasting-induced gluconeogenic gene expressions were downregulated in the liver and kidney tissues from GP73-KO mice (Fig. 3M and N). Reduced gluconeogenic gene expressions and hepatic glucose production (HGP) were observed in PMHs isolated from GP73-KO mice, while rmGP73 addition rescued the reduced HGP caused by GP73 deficiency (Fig. 3O and Supplementary Fig. 2). These results suggest that genetic loss-of-function GP73 reduces hepatic and kidney gluconeogenesis.

Figure 3
Figure 3

Ablation of GP73 from whole animals has a profound glucose-lowering effect. (A) The relative GP73 mRNA levels in various organs of wild type of GP73-KO (KO) mice. (B, C) Blood glucose levels (B) and fasting blood glucose (FBG) levels (C) in WT, GP73-heterozygous (HE) or GP73-KO adult male mice (n  = 6). (D, E) Blood glucose levels (D) and FBG levels (E) in WT, GP73-HE, or GP73-KO adult female mice (n  = 6). (F–I) Serum insulin levels (F), serum glucagon levels (G), food intake (H), and body weight (I) in WT or GP73-KO adult male mice (n = 6). (J–L) PTT (J), GTT (K), and ITT (L) in WT or GP73-KO adult male mice (n  = 4 or 6). (M–N) Glucogenic gene expression in the livers (M) and kidney (N) of WT and GP73-KO adult male mice fasted for 6 h (n  = 6). (O) Glucose production in WT, GP73-KO PMHs, or GP73-KO PMHs treated with rmGP73 (GP73/Res) for 4 h (n  = 3). Data in (F–G) and (J–N) were analyzed by two-way ANOVA followed by Bonferroni’s post hoc test or Mann–Whitney U test. Data in (B–E) and (O) were analyzed by one-way ANOVA followed by Bonferroni’s post hoc test. Other data were analyzed by two-tailed Student’s t-tests. *P < 0.05; **P < 0.01, ***P < 0.001.

Citation: Journal of Molecular Endocrinology 70, 2; 10.1530/JME-22-0103

Hepatic GP73 inhibition improves glucose homeostasis in DIO mouse model

Considering the high expression of GP73 in the liver upon HFD, we further explored the effect of hepatic GP73 inhibition on the abnormal glucose homeostasis in DIO mice. To this end, we treated DIO mice with GP73 siRNA or control RNAi (siCtrl) oligos twice a week continuing for 4 weeks. The expression of GP73 in the liver from mice treated with siGP73 was significantly inhibited (Fig. 4A). Notably, the siGP73 administration significantly reduced blood glucose levels and HbA1c levels, without decreasing the body weight and food intake (Fig. 4B, C, D, and E). Liver damage and hyperlipidemia were also significantly alleviated in siGP73-treated DIO mice (Fig. 4F, G, H, and I). In particular, the ability of pyruvate conversion to glucose production was significantly improved by siGP73 (Fig. 4J). The glucose tolerance and insulin sensitivity were also greatly improved in siGP73 group compared with controls (Fig. 4K and L). Thus, glucose metabolism abnormities in DIO mice were significantly alleviated upon hepatic GP73 inhibition.

Figure 4
Figure 4

Hepatic GP73 inhibition improves glucose homeostasis in DIO mouse model. (A) GP73 expression in the liver from DIO mice treated with control RNAi (siCtrl) or GP73 siRNA (siGP73) oligos. α-Tubulin was used as the equal loading control. (B–E) Body weight (B), food intake (C), fasting blood glucose (FBG) levels (D), HbA1c levels (E), serum AST levels (F), serum ALT levels (G), serum HDL (H), serum LDL (I), PTT (J), GTT (K), and ITT (L) in DOI mice at weeks 4 after siCtrl or siGP73 treatment (n  = 4–7). Data in (B) and (J–L) were analyzed by two-way ANOVA followed by Bonferroni’s post hoc test or two-tailed Student’s t-tests. Other data were analyzed by two-tailed Student’s t-tests. *P < 0.05; **P < 0.01, ***P < 0.001.

Citation: Journal of Molecular Endocrinology 70, 2; 10.1530/JME-22-0103

Neutralizing circulating GP73 improves glucose homeostasis in diabetic mice

To further confirm this therapeutic effect, we neutralized circulating GP73 with anti-GP73 mAb in STZ and HFD/STZ-induced mice models. By using an IVIS Spectrum In Vivo Imaging System, we found that the fluorescence intensities of GP73 in liver were decreased significantly in the mice administrated with anti-GP73 mAb, suggesting that GP73 was actually blocked by anti-GP73 (Supplementary Fig. 3). In db/db and HFD/STZ-induced mice models, anti-GP73 mAb treatment led to significantly reduced FBG levels at 6 h after administration (Fig. 5A and B), without altering the body weight and food intake (Fig. 5C and D). Moreover, glucose tolerance in HFD/STZ-induced mice was significantly improved by anti-GP73 mAb (Fig. 5E). We then injected STZ-induced mice with anti-GP73 mAb twice a week for 4 weeks to examine the long-term metabolic outcomes. The FBG levels were significantly decreased at 15 and 30 days after treatment (Fig. 5F), without affecting the food intake and body weight (Fig. 5G and H). The anti-GP73 mAb administration significantly improved glucose intolerance (Fig. 5I) and led to a significant reduction in serum levels of HbA1c, CHO, and TG compared with controls treated with IgG isotype (Fig. 5J, K and L). Meanwhile, the liver functions were not impaired by anti-GP73 mAb administration (Fig. 5M and N). Of note, the expressions of glucogenic genes and PKA activity in liver were also significantly inhibited by anti-GP73 mAb (Fig. 5O and P).

Figure 5
Figure 5

Neutralizing circulating GP73 improves glucose homeostasis in STZ and HFD/STZ induced-mouse models. (A, B) Fasting blood glucose (FBG) levels in db/db mice (A) and HFD/STZ-induced mice (B) at the indicated hours after IgG or anti-GP73 treatment (n  = 6). (C–E) Body weight (C), food intake (D), and GTT (E) in HFD/STZ-induced mice. (F) FBG levels in STZ-induced mice at the indicated days after IgG or anti-GP73 treatment. (G-O) Food intake (G), body weight (H), GTT (I), plasma HbAlc levels (J), serum CHO levels (K), serum TG levels (L), serum ALT levels (M), serum AST levels (N), and hepatic glucogenic gene expressions (O) in STZ-induced mice at weeks 4 after IgG or anti-GP73 treatment (n  = 6). (P) PKA activities in livers of STZ-induced mice treated with IgG or anti-GP73 mAb (n = 3). Data in (A–C), (E–F), (H–I), and (O) were analyzed by two-way ANOVA followed by Bonferroni’s post hoc test or two-tailed Student’s t-tests. Other data were analyzed by two-tailed Student’s t-tests. *P < 0.05; **P < 0.01, ***P < 0.001.

Citation: Journal of Molecular Endocrinology 70, 2; 10.1530/JME-22-0103

Discussion

Obesity is involved in the pathogenesis of many immunometabolic disorders including type 2 diabetes, fatty liver disease, atherosclerosis, and dyslipidemia. We recently demonstrated that GP73 was secreted from multiple tissues upon fasting and contributed to SARS-CoV-2-induced hyperglycemia (Wan et al. 2022). However, the pathological effect of GP73 on abnormal glucose homeostasis in diabetic individuals has not been revealed. The discovery of glucogenic functions of secreted GP73 led us in consideration of strategies to exploit neutralizing antibody for therapeutic purposes. To this end, the pathophysiological relevance of GP73 to hyperglycemia associated with diabetes was first established. In vitro data showed that the upregulated GP73 in diabetes is indispensable for enhanced PKA signaling pathway. Actually, GP73 siRNA primarily targeting liver tissues are potently effective in improving systemic glucose metabolism. Ablation of GP73 from whole animals also has a profound glucose-lowering effect. This proof of concept is further supported by the finding that neutralizing circulating GP73 with an anti-GP73 mAb lowers fasting glucose levels in diabetic mouse models and improves systemic glucose metabolism. These results are consistent with our previous finding that circulating GP73 can traffic to the liver and bind to the hepatocyte surface. Our previous study also indicated that GP73 treatment had no effect on plasma levels of catecholamines and glucocorticoids, catabolic hormones associated with neuron circuitry known to induce hepatic glucose release (Wan et al. 2022). Since intestine also plays an important role in glucose homeostasis by regulating gluconeogenesis (Mithieux, 2009), the high expression of GP73 in intestine tissues made us wonder whether GP73 regulates intestinal gluconeogenesis, which needs further investigation.

Interestingly, the action of anti-GP73 mAb is more sustained in the STZ-induced mice compared to HFD+STZ and db/db mice. This may result from the different methods in constructing animal models. HFD+STZ and db/db mice suffering longer periods of overnutrition and hyperglycemia were more susceptible to diabetic nephropathy. The clearance of higher molecular weight proteins, including mAbs and IgG, always changes in diabetic animals (Chadha & Morris 2015). T2DM patients have been reported to have 200-fold higher concentration of IgG2 in urine (Bakoush et al. 2002). It is reasonable to speculate that urine protein leakage was also increased in HFD+STZ and db/db mice compared with STZ-induced mice, which reduced the sustained action of antibody.

Blocking GP73 may have different therapeutic efficacy in patient of different genders. Our results show that the GP73-KO female mice were less prone to glucose metabolic disorders. This phenomenon is consistent with clinical and experimental studies indicating that post-pubertal sex steroid hormones contribute to sex differences in diabetes susceptibility (Tramunt et al. 2020). The deleterious impact of the menopause on glucose homeostasis supports the protective role of endogenous estrogen (Mauvais-Jarvis et al. 2013). In addition, women exhibit increased propensity to store adipose tissue in s.c. sites, rather than in visceral areas (Chang et al. 2018). Especially, higher propensity to accumulate intramyocellular lipids in leg skeletal muscles decreases the deleterious consequences of lipid on insulin sensitivity in women (Moro et al. 2009). Therefore, the gender difference in energy balance and glucose metabolism is a factor that should be considered when studying the effects of blocking GP73 on metabolic homeostasis. Potential benefits of targeting GP73 on weight gain and hepatic steatosis warrant further investigation.

GP73 was upregulated in numerous liver diseases, including HBV/HCV-induced hepatitis, alcohol-induced liver disease, autoimmune hepatitis, liver cirrhosis, and hepatocellular carcinoma (HCC) (Wang et al. 2014). Therefore, GP73 expression was regulated via viral and nonviral pathways (Kladney et al. 2002). Irrespective of the underlying disease etiology, striking increases in GP73 protein expression occurred at the whole organ level. Mechanistically, GP73 is induced under inflammatory conditions, including proinflammatory cytokine interleukin-6 (IL-6), interferon gamma, and IL-1β (Kladney et al. 2002, Liang et al. 2012). We know proinflammatory cytokines, such as tumor necrosis factor-α, IL-1, IL-6, and IL-8, have major roles in insulin resistance and hyperglycemia during acute illnesses and stress (Krogh-Madsen et al. 2006). Our results raise the possibility that a substantial portion of the metabolic biology of GP73, at least in the context of infection and lifestyle diabetes, can be attributed to the elevated circulating GP73 levels. The contribution of GP73 dysregulation in the development of diabetes associated with liver diseases and acute stress may provide more mechanistic information of this glucogenic hormone.

This study has some limitations. First, the receptor for GP73 binding to the surface of hepatocytes has not been identified. Second, antibodies with higher binding affinity are yet to be developed.

Taken together, our findings provided evidences showing that serum GP73 was aberrantly elevated in patients with T2D. Blocking GP73 with antibody or siRNA led to significantly improved glucose homeostasis in STZ and HFD/STZ-induced diabetic mice. We thus concluded that GP73 may represent a promising target for treating diabetes.

Supplementary materials

This is linked to the online version of the paper at https://doi.org/10.1530/JME-22-0103.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by the National Key Research and Development Program of China (grant number: 2018YFA0900800), the National Natural Science Foundation of China (grant numbers: 31872715, 32070755, 81773205, 81972696, and 82070595), and the Postdoctoral Science Foundation of China (grant number: 2020M683743).

Acknowledgements

The authors would like to thank all the above organizations for their financial support.

References

  • Bachert C, Fimmel C & Linstedt AD 2007 Endosomal trafficking and proprotein convertase cleavage of cis Golgi protein GP73 produces marker for hepatocellular carcinoma. Traffic 8 14151423. (https://doi.org/10.1111/j.1600-0854.2007.00621.x)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bakoush O, Tencer J, Tapia J, Rippe B & Torffvit O 2002 Higher urinary IgM excretion in type 2 diabetic nephropathy compared to type 1 diabetic nephropathy. Kidney International 61 203208. (https://doi.org/10.1046/j.1523-1755.2002.00108.x)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chadha GS & Morris ME 2015 Effect of Type 2 Diabetes mellitus and diabetic nephropathy on IgG pharmacokinetics and subcutaneous bioavailability in the rat. AAPS Journal 17 965975. (https://doi.org/10.1208/s12248-015-9771-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chang E, Varghese M & Singer K 2018 Gender and sex differences in adipose tissue. Current Diabetes Reports 18 69. (https://doi.org/10.1007/s11892-018-1031-3)

  • Forbes JM & Cooper ME 2013 Mechanisms of diabetic complications. Physiological Reviews 93 137188. (https://doi.org/10.1152/physrev.00045.2011)

  • Gatselis NK, Tornai T, Shums Z, Zachou K, Saitis A, Gabeta S, Albesa R, Norman GL, Papp M & Dalekos GN 2020 Golgi protein-73: a biomarker for assessing cirrhosis and prognosis of liver disease patients. World Journal of Gastroenterology 26 51305145. (https://doi.org/10.3748/wjg.v26.i34.5130)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Glastras SJ, Chen H, Teh R, McGrath RT, Chen J, Pollock CA, Wong MG & Saad S 2016 Mouse models of diabetes, obesity and related kidney disease. PLoS One 11 e0162131. (https://doi.org/10.1371/journal.pone.0162131)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jin D, Tao J, Li D, Wang Y, Li L, Hu Z, Zhou Z, Chang X, Qu C & Zhang H 2015 Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion. Oncotarget 6 3352333533. (https://doi.org/10.18632/oncotarget.5590)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kacerovsky M, Jones J, Schmid AI, Barosa C, Lettner A, Kacerovsky-Bielesz G, Szendroedi J, Chmelik M, Nowotny P & Chandramouli V et al.2011 Postprandial and fasting hepatic glucose fluxes in long-standing type 1 diabetes. Diabetes 60 17521758. (https://doi.org/10.2337/db10-1001)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kladney RD, Cui X, Bulla GA, Brunt EM & Fimmel CJ 2002 Expression of GP73, a resident Golgi membrane protein, in viral and nonviral liver disease. Hepatology 35 14311440. (https://doi.org/10.1053/jhep.2002.32525)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Krogh-Madsen R, Plomgaard P, Moller K, Mittendorfer B & Pedersen BK 2006 Influence of TNF-alpha and IL-6 infusions on insulin sensitivity and expression of IL-18 in humans. American Journal of Physiology. Endocrinology and Metabolism 291 E108E114. (https://doi.org/10.1152/ajpendo.00471.2005)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Laiteerapong N, Huang ES, Cowie CC, Casagrande SS, Menke A, Cissell MA, Eberhardt MS, Meigs JB, Gregg EW & Knowler WC et al.2018 Diabetes in older adults. In Diabetes in America, vol 3, ch 16, pp 1-26. Eds Cowie CC et al.Bethesda, MD, USA: National Institute of Diabetes and Digestive and Kidney Diseases. (available at: https://www.ncbi.nlm.nih.gov/books/NBK567980/)

    • Search Google Scholar
    • Export Citation
  • Liang H, Block TM, Wang M, Nefsky B, Long R, Hafner J, Mehta AS, Marrero J, Gish R & Norton PA 2012 Interleukin-6 and oncostatin M are elevated in liver disease in conjunction with candidate hepatocellular carcinoma biomarker GP73. Cancer Biomarkers 11 161171. (https://doi.org/10.3233/CBM-2012-00276)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Magliano DJ, Sacre JW, Harding JL, Gregg EW, Zimmet PZ & Shaw JE 2020 Young-onset type 2 diabetes mellitus - implications for morbidity and mortality. Nature Reviews Endocrinology 16 321331. (https://doi.org/10.1038/s41574-020-0334-z)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mauvais-Jarvis F, Clegg DJ & Hevener AL 2013 The role of estrogens in control of energy balance and glucose homeostasis. Endocrine Reviews 34 309338. (https://doi.org/10.1210/er.2012-1055)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mithieux G 2009 A novel function of intestinal gluconeogenesis: central signaling in glucose and energy homeostasis. Nutrition 25 881884. (https://doi.org/10.1016/j.nut.2009.06.010)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Moro C, Galgani JE, Luu L, Pasarica M, Mairal A, Bajpeyi S, Schmitz G, Langin D, Liebisch G & Smith SR 2009 Influence of gender, obesity, and muscle lipase activity on intramyocellular lipids in sedentary individuals. Journal of Clinical Endocrinology and Metabolism 94 34403447. (https://doi.org/10.1210/jc.2009-0053)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Okamoto H, Cavino K, Na E, Krumm E, Kim SY, Cheng X, Murphy AJ, Yancopoulos GD & Gromada J 2017 Glucagon receptor inhibition normalizes blood glucose in severe insulin-resistant mice. PNAS 114 27532758. (https://doi.org/10.1073/pnas.1621069114)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sui T, Wang X, Li L, Liu J, Qiao N, Duan L, Shi M, Huang J, Yang H & Cheng G 2021 GOLM1 suppresses autophagy-mediated anti-tumor immunity in hepatocellular carcinoma. Signal Transduction and Targeted Therapy 6 335. (https://doi.org/10.1038/s41392-021-00673-6)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tramunt B, Smati S, Grandgeorge N, Lenfant F, Arnal JF, Montagner A & Gourdy P 2020 Sex differences in metabolic regulation and diabetes susceptibility. Diabetologia 63 453461. (https://doi.org/10.1007/s00125-019-05040-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wan L, Gao Q, Deng Y, Ke Y, Ma E, Yang H, Lin H, Li H, Yang Y & Gong J et al.2022 GP73 is a glucogenic hormone contributing to SARS-CoV-2-induced hyperglycemia. Nature Metabolism 4 2943. (https://doi.org/10.1038/s42255-021-00508-2)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang F, Long Q, Gong Y, Hu L, Zhang H, Oettgen P & Peng T 2014 Epithelium-Specific ETS (ESE)-1 upregulated GP73 expression in hepatocellular carcinoma cells. Cell and Bioscience 4 76. (https://doi.org/10.1186/2045-3701-4-76)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang J, Ning J, Qian X, Zhang T, Yao M, Wang J, Chen X & Lu F 2021 Deletion of Golgi protein 73 delayed hepatocyte proliferation of mouse in the early stages of liver regeneration. Journal of Gastroenterology and Hepatology 36 13461356. (https://doi.org/10.1111/jgh.15315)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang M, Song L, Strange C, Dong X & Wang H 2018 Therapeutic effects of adipose stem cells from diabetic mice for the treatment of Type 2 diabetes. Molecular Therapy 26 19211930. (https://doi.org/10.1016/j.ymthe.2018.06.013)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wei C, Yang X, Liu N, Geng J, Tai Y, Sun Z, Mei G, Zhou P, Peng Y & Wang C et al.2019 Tumor microenvironment regulation by the endoplasmic reticulum stress transmission mediator Golgi Protein 73 in mice. Hepatology 70 851870. (https://doi.org/10.1002/hep.30549)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yang H & Yang L 2016 Targeting cAMP/PKA pathway for glycemic control and type 2 diabetes therapy. Journal of Molecular Endocrinology 57 R93R108. (https://doi.org/10.1530/JME-15-0316)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yang X, Wu F, Chen J, Wang C, Zhu Y, Li F, Hao Q, Duan C, Wang L & Ma X et al.2017 GP73 regulates Hepatic steatosis by enhancing SCAP-SREBPs interaction. Scientific Reports 7 14932. (https://doi.org/10.1038/s41598-017-06500-9)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ye QH, Zhu WW, Zhang JB, Qin Y, Lu M, Lin GL, Guo L, Zhang B, Lin ZH & Roessler S et al.2016 GOLM1 modulates EGFR/RTK cell-surface recycling to drive hepatocellular carcinoma metastasis. Cancer Cell 30 444458. (https://doi.org/10.1016/j.ccell.2016.07.017)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation

Supplementary Materials

 

  • Collapse
  • Expand

Society for Endocrinology logo

  • View in gallery
    Figure 1

    Serum GP73 levels are elevated in diabetic mice and humans. (A) Serum GP73 levels in healthy (n  = 40) and T2DM participants (n  = 40). (B) Correlation analysis between serum GP73 levels and HbA1c levels in T2DM patients. (C–F) Fasting blood glucose (FBG) levels (C), serum GP73 levels (D), hepatic (E) and renal (F) glucogenic gene expression, hepatic and renal GP73 mRNA expression (G) in BKS or db/db mice (n  = 6). (H–K) FBG levels (H, J) and serum GP73 levels (I, K) in STZ-induced or HFD/STZ-induced mice and their controls. GP73 mRNA expression in various mouse organs (L) from HFD/STZ-induced mice or regular chow diet-fed mice. Data in (A) were analyzed by Mann–Whitney U test. Data in (B) were analyzed by Spearman's correlation analysis. Data in (E–G) and (L) were analyzed by two-way ANOVA followed by Bonferroni’s post hoc test. Other data were analyzed by two-tailed Student’s t-tests. *P < 0.05; **P < 0.01, ***P < 0.001.

  • View in gallery
    Figure 2

    GP73 is indispensable for enhancing PKA signaling in diabetes. (A, B) PKA enzymatic activity in Huh-7 cells cultured with the indicated serum from healthy controls or patients with T2DM. (C, D) PKA enzymatic activity in Huh-7 cells cultured with indicated serum from healthy controls or T2DM in the presence or absence of anti-GP73 antibody. The relative expression levels of PKA-C-α-p or PKA-C-α were calculated by PKA-C-α-p over α-tubulin or PKA-C-α over α-tubulin. PKA phosphorylation was analyzed by the relative expression ratio of PKA-α-p to PKA-C-α, and PKA activity was represented by phospho-PKA substrate RRXpS/T over α-tubulin. Data in (B) were analyzed by two-tailed Student’s t-tests. Data in (D) were analyzed by two-way ANOVA followed by Bonferroni’s post hoc test. *P < 0.05; **P < 0.01, ***P < 0.001.

  • View in gallery
    Figure 3

    Ablation of GP73 from whole animals has a profound glucose-lowering effect. (A) The relative GP73 mRNA levels in various organs of wild type of GP73-KO (KO) mice. (B, C) Blood glucose levels (B) and fasting blood glucose (FBG) levels (C) in WT, GP73-heterozygous (HE) or GP73-KO adult male mice (n  = 6). (D, E) Blood glucose levels (D) and FBG levels (E) in WT, GP73-HE, or GP73-KO adult female mice (n  = 6). (F–I) Serum insulin levels (F), serum glucagon levels (G), food intake (H), and body weight (I) in WT or GP73-KO adult male mice (n = 6). (J–L) PTT (J), GTT (K), and ITT (L) in WT or GP73-KO adult male mice (n  = 4 or 6). (M–N) Glucogenic gene expression in the livers (M) and kidney (N) of WT and GP73-KO adult male mice fasted for 6 h (n  = 6). (O) Glucose production in WT, GP73-KO PMHs, or GP73-KO PMHs treated with rmGP73 (GP73/Res) for 4 h (n  = 3). Data in (F–G) and (J–N) were analyzed by two-way ANOVA followed by Bonferroni’s post hoc test or Mann–Whitney U test. Data in (B–E) and (O) were analyzed by one-way ANOVA followed by Bonferroni’s post hoc test. Other data were analyzed by two-tailed Student’s t-tests. *P < 0.05; **P < 0.01, ***P < 0.001.

  • View in gallery
    Figure 4

    Hepatic GP73 inhibition improves glucose homeostasis in DIO mouse model. (A) GP73 expression in the liver from DIO mice treated with control RNAi (siCtrl) or GP73 siRNA (siGP73) oligos. α-Tubulin was used as the equal loading control. (B–E) Body weight (B), food intake (C), fasting blood glucose (FBG) levels (D), HbA1c levels (E), serum AST levels (F), serum ALT levels (G), serum HDL (H), serum LDL (I), PTT (J), GTT (K), and ITT (L) in DOI mice at weeks 4 after siCtrl or siGP73 treatment (n  = 4–7). Data in (B) and (J–L) were analyzed by two-way ANOVA followed by Bonferroni’s post hoc test or two-tailed Student’s t-tests. Other data were analyzed by two-tailed Student’s t-tests. *P < 0.05; **P < 0.01, ***P < 0.001.

  • View in gallery
    Figure 5

    Neutralizing circulating GP73 improves glucose homeostasis in STZ and HFD/STZ induced-mouse models. (A, B) Fasting blood glucose (FBG) levels in db/db mice (A) and HFD/STZ-induced mice (B) at the indicated hours after IgG or anti-GP73 treatment (n  = 6). (C–E) Body weight (C), food intake (D), and GTT (E) in HFD/STZ-induced mice. (F) FBG levels in STZ-induced mice at the indicated days after IgG or anti-GP73 treatment. (G-O) Food intake (G), body weight (H), GTT (I), plasma HbAlc levels (J), serum CHO levels (K), serum TG levels (L), serum ALT levels (M), serum AST levels (N), and hepatic glucogenic gene expressions (O) in STZ-induced mice at weeks 4 after IgG or anti-GP73 treatment (n  = 6). (P) PKA activities in livers of STZ-induced mice treated with IgG or anti-GP73 mAb (n = 3). Data in (A–C), (E–F), (H–I), and (O) were analyzed by two-way ANOVA followed by Bonferroni’s post hoc test or two-tailed Student’s t-tests. Other data were analyzed by two-tailed Student’s t-tests. *P < 0.05; **P < 0.01, ***P < 0.001.

  • Bachert C, Fimmel C & Linstedt AD 2007 Endosomal trafficking and proprotein convertase cleavage of cis Golgi protein GP73 produces marker for hepatocellular carcinoma. Traffic 8 14151423. (https://doi.org/10.1111/j.1600-0854.2007.00621.x)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bakoush O, Tencer J, Tapia J, Rippe B & Torffvit O 2002 Higher urinary IgM excretion in type 2 diabetic nephropathy compared to type 1 diabetic nephropathy. Kidney International 61 203208. (https://doi.org/10.1046/j.1523-1755.2002.00108.x)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chadha GS & Morris ME 2015 Effect of Type 2 Diabetes mellitus and diabetic nephropathy on IgG pharmacokinetics and subcutaneous bioavailability in the rat. AAPS Journal 17 965975. (https://doi.org/10.1208/s12248-015-9771-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chang E, Varghese M & Singer K 2018 Gender and sex differences in adipose tissue. Current Diabetes Reports 18 69. (https://doi.org/10.1007/s11892-018-1031-3)

  • Forbes JM & Cooper ME 2013 Mechanisms of diabetic complications. Physiological Reviews 93 137188. (https://doi.org/10.1152/physrev.00045.2011)

  • Gatselis NK, Tornai T, Shums Z, Zachou K, Saitis A, Gabeta S, Albesa R, Norman GL, Papp M & Dalekos GN 2020 Golgi protein-73: a biomarker for assessing cirrhosis and prognosis of liver disease patients. World Journal of Gastroenterology 26 51305145. (https://doi.org/10.3748/wjg.v26.i34.5130)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Glastras SJ, Chen H, Teh R, McGrath RT, Chen J, Pollock CA, Wong MG & Saad S 2016 Mouse models of diabetes, obesity and related kidney disease. PLoS One 11 e0162131. (https://doi.org/10.1371/journal.pone.0162131)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jin D, Tao J, Li D, Wang Y, Li L, Hu Z, Zhou Z, Chang X, Qu C & Zhang H 2015 Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion. Oncotarget 6 3352333533. (https://doi.org/10.18632/oncotarget.5590)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kacerovsky M, Jones J, Schmid AI, Barosa C, Lettner A, Kacerovsky-Bielesz G, Szendroedi J, Chmelik M, Nowotny P & Chandramouli V et al.2011 Postprandial and fasting hepatic glucose fluxes in long-standing type 1 diabetes. Diabetes 60 17521758. (https://doi.org/10.2337/db10-1001)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kladney RD, Cui X, Bulla GA, Brunt EM & Fimmel CJ 2002 Expression of GP73, a resident Golgi membrane protein, in viral and nonviral liver disease. Hepatology 35 14311440. (https://doi.org/10.1053/jhep.2002.32525)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Krogh-Madsen R, Plomgaard P, Moller K, Mittendorfer B & Pedersen BK 2006 Influence of TNF-alpha and IL-6 infusions on insulin sensitivity and expression of IL-18 in humans. American Journal of Physiology. Endocrinology and Metabolism 291 E108E114. (https://doi.org/10.1152/ajpendo.00471.2005)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Laiteerapong N, Huang ES, Cowie CC, Casagrande SS, Menke A, Cissell MA, Eberhardt MS, Meigs JB, Gregg EW & Knowler WC et al.2018 Diabetes in older adults. In Diabetes in America, vol 3, ch 16, pp 1-26. Eds Cowie CC et al.Bethesda, MD, USA: National Institute of Diabetes and Digestive and Kidney Diseases. (available at: https://www.ncbi.nlm.nih.gov/books/NBK567980/)

    • Search Google Scholar
    • Export Citation
  • Liang H, Block TM, Wang M, Nefsky B, Long R, Hafner J, Mehta AS, Marrero J, Gish R & Norton PA 2012 Interleukin-6 and oncostatin M are elevated in liver disease in conjunction with candidate hepatocellular carcinoma biomarker GP73. Cancer Biomarkers 11 161171. (https://doi.org/10.3233/CBM-2012-00276)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Magliano DJ, Sacre JW, Harding JL, Gregg EW, Zimmet PZ & Shaw JE 2020 Young-onset type 2 diabetes mellitus - implications for morbidity and mortality. Nature Reviews Endocrinology 16 321331. (https://doi.org/10.1038/s41574-020-0334-z)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mauvais-Jarvis F, Clegg DJ & Hevener AL 2013 The role of estrogens in control of energy balance and glucose homeostasis. Endocrine Reviews 34 309338. (https://doi.org/10.1210/er.2012-1055)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mithieux G 2009 A novel function of intestinal gluconeogenesis: central signaling in glucose and energy homeostasis. Nutrition 25 881884. (https://doi.org/10.1016/j.nut.2009.06.010)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Moro C, Galgani JE, Luu L, Pasarica M, Mairal A, Bajpeyi S, Schmitz G, Langin D, Liebisch G & Smith SR 2009 Influence of gender, obesity, and muscle lipase activity on intramyocellular lipids in sedentary individuals. Journal of Clinical Endocrinology and Metabolism 94 34403447. (https://doi.org/10.1210/jc.2009-0053)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Okamoto H, Cavino K, Na E, Krumm E, Kim SY, Cheng X, Murphy AJ, Yancopoulos GD & Gromada J 2017 Glucagon receptor inhibition normalizes blood glucose in severe insulin-resistant mice. PNAS 114 27532758. (https://doi.org/10.1073/pnas.1621069114)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sui T, Wang X, Li L, Liu J, Qiao N, Duan L, Shi M, Huang J, Yang H & Cheng G 2021 GOLM1 suppresses autophagy-mediated anti-tumor immunity in hepatocellular carcinoma. Signal Transduction and Targeted Therapy 6 335. (https://doi.org/10.1038/s41392-021-00673-6)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tramunt B, Smati S, Grandgeorge N, Lenfant F, Arnal JF, Montagner A & Gourdy P 2020 Sex differences in metabolic regulation and diabetes susceptibility. Diabetologia 63 453461. (https://doi.org/10.1007/s00125-019-05040-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wan L, Gao Q, Deng Y, Ke Y, Ma E, Yang H, Lin H, Li H, Yang Y & Gong J et al.2022 GP73 is a glucogenic hormone contributing to SARS-CoV-2-induced hyperglycemia. Nature Metabolism 4 2943. (https://doi.org/10.1038/s42255-021-00508-2)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang F, Long Q, Gong Y, Hu L, Zhang H, Oettgen P & Peng T 2014 Epithelium-Specific ETS (ESE)-1 upregulated GP73 expression in hepatocellular carcinoma cells. Cell and Bioscience 4 76. (https://doi.org/10.1186/2045-3701-4-76)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang J, Ning J, Qian X, Zhang T, Yao M, Wang J, Chen X & Lu F 2021 Deletion of Golgi protein 73 delayed hepatocyte proliferation of mouse in the early stages of liver regeneration. Journal of Gastroenterology and Hepatology 36 13461356. (https://doi.org/10.1111/jgh.15315)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang M, Song L, Strange C, Dong X & Wang H 2018 Therapeutic effects of adipose stem cells from diabetic mice for the treatment of Type 2 diabetes. Molecular Therapy 26 19211930. (https://doi.org/10.1016/j.ymthe.2018.06.013)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wei C, Yang X, Liu N, Geng J, Tai Y, Sun Z, Mei G, Zhou P, Peng Y & Wang C et al.2019 Tumor microenvironment regulation by the endoplasmic reticulum stress transmission mediator Golgi Protein 73 in mice. Hepatology 70 851870. (https://doi.org/10.1002/hep.30549)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yang H & Yang L 2016 Targeting cAMP/PKA pathway for glycemic control and type 2 diabetes therapy. Journal of Molecular Endocrinology 57 R93R108. (https://doi.org/10.1530/JME-15-0316)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yang X, Wu F, Chen J, Wang C, Zhu Y, Li F, Hao Q, Duan C, Wang L & Ma X et al.2017 GP73 regulates Hepatic steatosis by enhancing SCAP-SREBPs interaction. Scientific Reports 7 14932. (https://doi.org/10.1038/s41598-017-06500-9)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ye QH, Zhu WW, Zhang JB, Qin Y, Lu M, Lin GL, Guo L, Zhang B, Lin ZH & Roessler S et al.2016 GOLM1 modulates EGFR/RTK cell-surface recycling to drive hepatocellular carcinoma metastasis. Cancer Cell 30 444458. (https://doi.org/10.1016/j.ccell.2016.07.017)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation