Abstract
Obesity affects thyroid gland function. Hypothyroidism, thyroid nodules, goiter, and thyroid cancer are more frequent in patients with higher BMI values. Although these data are supported by many clinical and epidemiological studies, our knowledge is very scarce at the molecular level. In this study, we present the first experimental evidence that adipocyte signaling downregulates the expression of thyroid-specific transcription factor 2 (TTF-2/FoxE1). It plays a crucial role in thyroid development and thyroid homeostasis and it is strictly connected to thyroid cancer as well. We provide in vivo and in vitro evidence that inhibition of TTF-2/FoxE1 gene expression is mediated by adipocyte signaling.
Introduction
The thyroid transcription factor 2 (TTF-2), also named FoxE1, is crucial for both thyroid gland development and thyroid homeostasis (Fernández et al. 2015). It is a forkhead-containing protein involved in thyroid-specific gene expression and necessary for thyroid morphogenesis (Zannini et al. 1997). The major biological effect of TTF-2 during development is related to the downward migration of the primitive gland. Ttf-2−/− mice are profoundly hypothyroid and die shortly after birth (Zannini et al. 1997). In humans, homozygous TTF-2 mutations are the genetic basis for Bamforth–Lazarus syndrome, described by congenital hypothyroidism characterized by thyroid dysgenesis (in most cases athyreosis), cleft palate, and spiky hair, with or without choanal atresia, and bifid epiglottis (De Felice et al. 1998). In mature thyrocytes, TTF2 regulates the expression of the thyroid differentiation markers including thyroglobulin (TG), thyroperoxidase (TPO), and the Na(+)/I(–) symporter (SLC5A5 also termed as NIS) (Fernández et al. 2015). The promoter regions of these target genes contain the AAACA core-binding site where TTF-2 generally functions as transcriptional activator, although it can act as a transcriptional repressor as well (Perrone et al. 2000). TTF-2 gene expression requires the induction mediated by TSH and insulin; therefore, the hormonal regulation of thyroid differentiation markers is mediated by TTF-2 (Santisteban et al. 1992, Ortiz et al. 1997). Hence, TTF-2 is involved in hormonal modulation of thyroid-specific gene expression and plays a critical role in thyroid homeostasis. TTF-2 has been associated with hypothyroidism and thyroid cancer (Denny et al. 2011, Penna-Martinez et al. 2014). Multistage, well-powered case–control studies, including two genome-wide association studies (GWAS) (Gudmundsson et al. 2009, Takahashi et al. 2010) and a candidate gene approach (Landa et al. 2009), have strongly pointed out the involvement of TTF-2 in papillary thyroid cancer (PTC) susceptibility. Significant association with PTC was found for the polymorphism rs1867277 in the promoter region of TTF-2 in Belarusian children exposed to radiation and, in an independent study, in a Spanish cohort, as well. Further nucleotide polymorphism (SNPs) near TTF-2 (rs965513) has been shown to be associated with an increased risk of sporadic thyroid carcinoma in Icelandic, British, and Japanese populations and further confirmed in German patients (Penna-Martinez et al. 2014).
Obesity raised epidemic worldwide, and it has gained increasing attention and has been regarded as a significant public health challenge globally for its wide-ranging adverse consequences on human health (Deng et al. 2016). Adipose tissue is a metabolically dynamic organ that is the primary site of storage for excess energy, but it serves as an endocrine organ capable of synthesizing a number of biologically active compounds that regulate metabolic homeostasis (Coelho et al. 2013). Obesity and thyroid disorders are two common conditions and there is an intriguing relationship between them. Individuals with obesity have an increased risk of hypothyroidism (Wang et al. 2021) and epidemiologic evidence indicates that obesity is associated with at least 13 anatomical sites including thyroid cancer (TC) (Avgerinos et al. 2019). Engeland et al. performed a histopathology-focused analysis showing that the relative risk for follicular and papillary thyroid cancer (PTC) increased with higher BMI values (Engeland et al. 2006).
Although many observational studies have been reporting a correlation between excessive weight and thyroid pathologies (Zhao et al. 2012, Chen et al. 2021), the mechanisms behind this correlation are not fully understood. Since TTF-2 plays a critical role as mediator between extracellular inputs in the maintenance of thyroid-specific gene expression, we hypothesized that it could play a role in adipocyte signaling on thyroid homeostasis. In this study, we present the first experimental evidence suggesting that adipocyte signaling downregulates TTF-2 gene expression.
Materials and methods
Animals
Mice (C57BL/6 J, males, Charles River Laboratory) were housed under a 12 h light/12 h darkness cycle and controlled temperature (22 ± 1 °C) and humidity (60 ± 5%), with ad libitum access to water and standard diet (4RF21 Mucedola, Settimo Milanese, Italy) or cafeteria diet. Food consumption and body weight were recorded weekly. The mice were randomly divided into two groups: the control group (n = 3) fed with standard diet (SD) and the obese group (n = 3) fed with cafeteria diet (CD). Obesity was induced in 12‐week‐old mice by a cafeteria diet composed of chow and unhealthy food regularly consumed by humans according to the reported procedure (Lang et al. 2019, Bolin et al. 2020). It was shown that this hedonic feeding promotes voluntary hyperphagia, rapid weight gain, and increased fat pad mass (Lutz & Woods 2012). Thyroid gland collection was performed after the sixth week of experimental feeding. Mice were sacrificed by carbon dioxide overdose (Conlee et al. 2005), and thyroid tissue was removed and instantly frozen in liquid nitrogen. Thus, total protein extracts were prepared from three pooled thyroids from each SD or CD animal. Experiments were conducted according to the ethical and safety rules and guidelines for the use of animals in biomedical research provided by the relevant Italian laws and European Union directives (no. 86/609/EEC and subsequent). All experiments involving the use of laboratory animals have been approved by the Italian Ministry of Health and have been conducted according to the guidelines of the Italian Ministry of Health (pursuant to Legislative Decree 116/92), Directive 2010/63/EU of the Parliament and of the Council on the protection of animals used for scientific purposes (Legislative Decree Nr. 549/2020-PR).
Human sera
The human sera were kindly provided by the High Specialization Center for Obesity Treatment (CASCO) in the Policlinico Umberto I, Sapienza University, Rome, Italy. The human sera were prepared from blood samples obtained from women of fertile age. All human blood samples were obtained after the informed consent of individuals. The present study does not report on the direct participation of human beings, and given the retrospective nature of the study, there is no requirement for approval by an institutional review board. Human sera were all in the same range of protein concentration; therefore in our experiments, we utilized the same sera volume. In order to homogenize the sera to be tested, we have pooled the same volume of four different unknown donors, either for the control or for the obese donors. We have prepared three different pools from lean donors and three from patients with obesity and we have obtained similar results with all the replicates.
Cell lines and transfection experiments
PC CL3 (https://web.expasy.org/cellosaurus/CVCL_6712) cell line was obtained from rat thyroid and maintains, in culture, the differentiated features of the original thyrocytes. It is a stable and not transformed cell line, very well recognized as an experimental system for normal thyrocytes (Kimura et al. 2001). This cell line was cultured in Coon’s modified Ham’s F-12 medium supplemented with 5% donor calf serum and with a six-hormone mixture including, transferrin, bovine insulin, hydrocortisone, somatostatin, glycyl-l-histidyl-l-lysine acetate, and bovine TSH (complete medium). PC Cl3 cells were routinely analyzed to maintain the doubling time of about 32–36 h and the expression of thyroid-specific genes. The starvation medium indicates the lack of TSH and insulin and donor calf serum at 0.2%. In starved thyrocytes, TTF-2 gene expression is strongly inhibited at transcriptional level (Ortiz et al. 1997). All the experiments have been performed with thyrocytes grown either in starvation medium or in complete medium before the treatment with human sera or with the 3T3-L1-conditioned media. Experiments performed with starved cells indicate the differential induction of TTF-2 gene expression mediated by the human sera or by the 3T3-L1-conditioned media, whereas the experiments performed in complete medium indicate the regulation of the steady-state level of TTF-2 gene expression. In Western blot experiments, the cells were starved for 5 days and in transient transfection experiments, they are starved for 2 days and treated for 24 or 48 h as indicated. Chemicals and hormones were purchased from Sigma–Aldrich. All media were supplemented with 100 U/mL of penicillin and 100 μg/mL of streptomycin (P/S). PC CL3 cells were transfected in 12-well vessels by Lipofectamine 2000 reagent (Invitrogen) following the manufacturer’s instructions. The cells were plated 48 h before transfection. The luciferase reporter vectors containing the luciferase reporter gene were used at 800 ng, and 100 ng of the pCMV-β-galactosidase plasmid were used to determine transfections efficiency. Protein extraction and luciferase and β-galactosidase assays were performed as previously reported (De Leo et al. 2000). The plasmid p4xZ-Luc was kindly provided by professor Santisteban (Universidad Autónoma de Madrid, Madrid, Spain) (Aza-Blanc et al. 1993). Transfection experiments were performed in duplicate or triplicate and repeated two or three times. Different batches of PC Cl3 cells were used to obtain similar results. For each experiment, we report the most representative one, and the s.e.m. is shown. The statistical analysis, performed using the raw data, is reported in the figure legends. Graphpad Prism version 9.4 was used to realize the scatter plots and the statistical analysis. 3T3-L1 cells (https://web.expasy.org/cellosaurus/CVCL_0123) were grown in DMEM, with 10% FBS and P/S. The fibroblasts were differentiated in adipocytes according to the published protocol (Rosen et al. 1979). Differentiated adipocytes were grown in DMEM, with 10% FBS and P/S. Adipocyte conversion was detected with Oil Red O staining to monitor lipid accumulation (Ramírez-Zacarías et al. 1992). To collect conditioned media, from adipocytes or from fibroblasts, the cells were grown in 15 cm diameter petri dishes. The cells were washed twice with PBS, and 20 mL of DMEM with 10% FCS were added. After 48 h of incubation, the conditioned media were removed and filtered through a 0.2 µm filter and stored at 4°C.
Real-time PCR
Total RNA was extracted from cells with the RNeasy Plus Mini Kit (QIAGEN), according to the manufacturer’s instructions. cDNA was synthesized with the GoScript RT System kit (Promega). All the quantitative RT-PCR (qPCR) experiments have been repeated using at least two independent RNA extractions. qPCR was carried out with an SYBR-selected master mix on a 7500-real-time PCR system (ABI) as follows: 95°C for 30 s, 40 cycles at 95°C for 5 s, and 60°C for 60 s. Tata-box binding protein (TBP) was used as a reference control for normalization. We conducted a melting curve analysis after every qPCR to identify the PCR product and to detect for the possible presence of contaminating products. The relative quantification was determined using the comparative CT method, and we performed data processing using ABI SDS v2.3 software (Applied Biosystems). The primers used, from 5’ to 3’, are described in Table 1.
Primer sequences used in this study.
| Gene | Oligo forward | Oligo reverse |
|---|---|---|
| TTF-2 | GTGGAGTCGTTTGGCTTCA | GAGGCGAACGTGTAAAAAGC |
| NIS | TTGTGGTAATGCTCGTTGGC | TCACACCGTACATGGAGAGCC |
| Tg | CAGGTTACAAATCAGTGGCCCT | GGGACTCGTGTGGTAGGCAC |
| TSHr | AGGACATGGTGTGTACCCCC | AATCTGCAAAGGCCAGGTTG |
| TBP | CCCACCAGCAGTTCAGTAGC | CAATTCTGGGTTTGATCATTCTG |
Western blot
The proteins, extracted from PC CL3 cells, were used as input. The cells were directly lysed in RIPA buffer and incubated for 15 min on ice. The mixture was centrifuged at 15,700 g for 15 min and the supernatant was transferred to a new tube for further analysis. 30 μg of proteins were separated by SDS-PAGE followed by semidry transfer to Amersham HyBond 0.45 PVDF (GE Healthcare). Membrane was blocked with 5% non-fat dry milk in Tris-buffered saline (TBS) and 0.1% Tween 20 and incubated at first with anti-TTF-2 antibody (BioPat, www.biopatsrl.it). Filters were then processed for enhanced chemiluminescence detection (ECL Super Signal West Pico Plus, Thermo Scientific). The same filters were stripped and re-probed with the anti-α-tubulin (TUBA1A) antibody (Santa Cruz Biotechnology catalog SC-32293) or with the anti-β-actin (ACTB) antibody (Sigma–Aldrich catalog A-2228) and the normalizer is indicated in the figures; the bands were detected by a second ECL detection. Total protein extracts from mice thyroids were prepared with similar protocols but a Dounce homogenization was initially performed in RIPA buffer. Each Western blot was repeated two or three times, and for each experiment, the representative Western blot is shown.
Cell proliferation assay
Cells were seeded in 96-well plates in 100 µL of 6H complete medium. At the indicated time, 20 µL of MTT (Sigma) 5 mg/mL were added to the media for the last 3.5 h of growth. We quantified results by dissolving the MTT crystals in DMSO and recording absorption at 570 nm with a baseline subtraction at 630 nm (Mello et al. 2020). We averaged at least four points for each condition and repeated experiments at least three times, with a representative experiment selected.
Results
To mimic the effect of adipocyte signaling on the follicular cells of thyroid gland, we have grown PC CL3 cells in the presence of human serum from healthy controls (hCS) or human serum from patients with obesity (hOS). Literature data indicate that the expression of thyroid differentiation marker genes is induced in obese mice (Lee et al. 2015, Panveloski-Costa et al. 2018). Therefore, we envisaged that the treatment with hOS could have the same role on PC CL3 cells. In Fig. 1A we show that, in starved cells, Nis, Tg, and Tshr gene expression is induced by the hOS better than by the hCS. Hence, our experimental system replicates in vitro results obtained in vivo. In this experimental setting, we show that, differently from thyroid differentiation markers, Ttf-2 expression is downregulated by hOS, as detected both by qPCR and by Western blot, Fig. 1B and C-D. This experiment has been performed in starvation medium, but we have obtained similar results in complete medium as well (data not shown).
Human serum of patients with obesity affects thyroid-specific gene expression. PC CL3 cells were plated in complete 6H medium and after 48 h were shifted to starvation medium for 4 days, and then, the starved cells were challenged with 15% of human sera for 72 h. Total RNAs or total proteins were extracted to measure gene expression by real-time PCRs or Western blots. TBP and β-actin (ACTB) were used as normalizers in qPCRs and Western blots, respectively. Empty columns indicate hCS treatment and stripy pattern indicates the hOS treatment. (A). Real-time PCR experiments. The gene and the human serum are indicated. (B). Real-time PCR experiments to measure the TTF-2 mRNA level. Data represent values of three independent experiments ± s.e.m. (C). Representative Western blot of extracts from cells treated with human sera as indicated. (D). Statistical analysis of TTF-2 protein expression. Data represent the mean of three independent experiments ± s.e.m.**P ≤ 0.01.
Citation: Journal of Molecular Endocrinology 70, 1; 10.1530/JME-22-0129
To further sustain our results and to better indicate that TTF-2 gene expression is downregulated by adipocyte signaling, we settled the second set of experiments using the 3T3-L1 cell line. These mouse fibroblasts when cultivated with an appropriate medium differentiate into adipocytes (Rosen et al. 1979). We collected supernatants from cultured fibroblasts 3T3-L1 (CMF) and from adipocytes 3T3-L1 (CMA) and used these conditioned media to grow PC CL3 thyrocytes in complete medium. We show that the conditioned medium of adipocytes 3T3-L1 upregulates Nis mRNA expression and downregulates TTF-2 protein level Fig. 2A and B-C, respectively. These results indicate that the secretome from adipocytes is able to affect thyrocyte differentiation and that the secreted signal, absent in the secretome from fibroblasts, is specific to adipocytes. We have further confirmed these results using the p4xZ-Luc vector. In this plasmid, the luciferase gene expression is regulated by an artificial promoter constructed by polymerization of the oligonucleotide Z with the TTF-2 binding site identified in the rat Tpo promoter and ligated in front of a Tata box (Aza-Blanc et al. 1993). Hence, p4xZ-Luc is a reporter plasmid of TTF-2 activity. In Fig. 2D, we show transient transfection experiments of PC CL3 with the p4xZ-Luc vector transfected in complete medium. After 6 h from the DNA addiction, the cells were grown in complete medium with 35% of 3T3-L1 conditioned media for 48 h. The results indicate that, compared to MCF, MCA inhibits the activity of the artificial promoter and therefore TTF-2 activity. Same results have been obtained in starved PC CL3 cells, Fig. 2E. In this experiment, after 6 h from the DNA addiction, the cells were starved in starvation medium for 48 h and subsequently stimulated in complete medium with 35% of 3T3-L1 conditioned media for 24 h. Hence, MCA inhibits TTF-2 activity either in complete medium when TTF-2 is expressed or in starved cells when TTF-2 is absent and re-induced by the TSH and insulin. Thus, the results shown in Fig. 1 and 2 indicate that either serum from patients with obesity or conditioned medium of 3T3-L1 adipocytes induce the thyroid differentiation marker NIS and downregulate Ttf-2 expression.
Role of conditioned media of 3T3-L1 fibroblasts (CMF) and of 3T3-L1 adipocytes (CMA). PC CL3 cells were cultivated in six-well plates in complete medium, when the density reached about 50%, the cells were cultivated with 1.3 mL of complete medium and 0.7 mL of conditioned medium (35%) for 48 h before the total RNA or total proteins were extracted. Empty columns indicate CMF treatment and the spot patterns indicate the CMA treatment. (A). qPCR experiments to detect NIS mRNA levels. Data represent the values of two independent experiments in duplicate ± s.e.m. (B). Representative Western blots to determine TTF-2 expression. Proteins from PC CL3 cells cultivated without the addiction of conditioned media are shown in lane C. Tubulin was used as normalizer. The ratio between the signals of TTF-2 and tubulin in cells cultivated with the addiction of CMF was arbitrarily settled as unit. (C). Statistical analysis of TTF-2 protein expression from two independent experiments in duplicate ± s.e.m. (D and E). Transfection experiments of p4xZ-luc plasmid in PC CL3 cells. The experiment performed in complete medium is shown in panel D and the experiment performed in the starvation medium is shown in panel E. Bars indicate the s.e.m. The statistical analysis performed utilizing the row data in qPCRs and in transfection experiments is reported with single asterisk (*) when P ≤ 0.05 or with double asterisk (**) when P ≤ 0.01.
Citation: Journal of Molecular Endocrinology 70, 1; 10.1530/JME-22-0129
To better characterize the role of the human sera on PC CL3 cells, we have performed MTT cell viability assays (Mello et al. 2020). Figure 3 shows that, compared with the hCS, the hOS downregulates cell proliferation. This experiment has been conducted on PC CL3 cells starved for 4 days and then stimulated with 15% human sera in starvation medium. However, we obtained similar results with cells grown in complete medium (data not shown). Hence, the serum of patients with obesity is able to downregulate both the thyrocytes viability and TTF-2 gene expression.
MTT assay to determine cell proliferation for PC CL3 grown in the presence of human sera from lean or obese donors. The cells were plated in 6H complete medium and after 48 h were starved in starvation medium for 4 days. Starved cells were challenged with 15% of human sera in the starved medium for 48 h. A representative experiment is shown. The results are the mean ± s.d. of four replicate wells for each experimental point. Values were significantly different compared to the control group (*P < 0.05).
Citation: Journal of Molecular Endocrinology 70, 1; 10.1530/JME-22-0129
To confirm in vivo results on the regulation of TTF-2 gene expression, we settled up an in vivo system of obesity with which we get until now some significant preliminary data. Mice were fed for 6 weeks with standard diet (SD) (control or lean mice) or with cafeteria diet (CD) to induce obesity (Lang et al. 2019). To perform Western blots with the total proteins extracted from thyroids of lean mice and from the glands of obese mice, we have pooled the glands excised from three mice for each feeding program. In Fig. 4A, we show the body weight of mice at sacrifice and in Fig. 4B, TTF-2 Western blot with protein extracts from mice thyroids. The experiment indicates that TTF-2 level is downregulated in the glands of obese mice.
In vivo TTF-2 down-regulation. Western blots with proteins extracted from thyroid glands excised from mice fed with standard diet (SD) or with cafeteria diet (CD). (A). Mice body weight at time of sacrifice is reported in grams. In the last row, the average weight, x̅, for each group and the s.d. are reported. The statistical analysis performed with the mice weights indicated that the two groups are statistically different with P ≤ 0.05, reported in figure as *. (B). Western blots obtained with the total protein extracted from thyroids excised from mice fed with standard diet (SD) or with cafeteria diet (CD). Tubulin was used as normalizer. The ratio between the signals of TTF-2 and tubulin in control mice was arbitrarily settled as unit.
Citation: Journal of Molecular Endocrinology 70, 1; 10.1530/JME-22-0129
Therefore, to address the study on the biochemical mechanism triggered by adipose signaling to modulate Ttf-2 expression, we took into consideration the well-described role, in patients with obesity, of secreted pro-inflammatory adipokines (Ellulu et al. 2017). They trigger oxidative stress mediated by reactive oxygen species (ROS), namely, it has been shown that in thyroid cells, ROS/reactive nitrogen species act as important intracellular mediators (Colin et al. 2014). Furthermore, it has been shown that nitric oxide (NO) decreases TSH-induced Ttf-2 expression in the thyrocytes cell line FRTL-5 (Montesinos et al. 2016). Therefore, we have tested L-NG-nitro arginine methyl ester (L-NAME), an antagonist of NO synthase able to inhibit NO synthesis, in our transfection experiments with the p4xZ-Luc reporter vector. The experiment has been performed on starved cells. Namely, after DNA transfection and 48 h in starvation medium, the cells were stimulated for 24 h by 35% of 3T3-L1 conditioned media in complete medium with or without 1 mM of L-NAME (LN). As shown in Fig. 5, L-NAME does not affect the role of CMF on TTF-2 activity. Differently, L-NAME cancels the inhibition of TTF-2 activity elicited by CMA. This experiment strongly suggests that the adipocyte signaling induces oxidative stress, mediated by NO synthesis, and is able to downregulate Ttf-2 expression.
Role of L-NAME (LN) in transfection experiments of p4xZ-Luc vector in PC CL3 cells. L-NAME was utilized at 1 mM. Empty columns indicate CMF treatment and the spot patterns indicate the CMA treatment. The statistical analysis of all transfected experiments, performed with the raw data, resulted in P < 0.05 as indicated with *. The values of the relative luciferase activities are reported. The bars indicate the s.e.m.
Citation: Journal of Molecular Endocrinology 70, 1; 10.1530/JME-22-0129
Discussion
In this study, we provide experimental evidence that the signaling from adipose tissue inhibits TTF-2 gene expression in thyrocytes. This transcription factor regulates the expression of thyroid differentiation markers and it plays a crucial role in the maintenance of thyroid differentiation and homeostasis. TTF-2 activity has been associated with thyroid dysfunctions including hypothyroidism and neoplastic transformation (Cortés & Zerón 2019). Since obesity has been linked to both hypothyroidism and thyroid tumors (Engeland et al. 2006, Avgerinos et al. 2019, Wang et al. 2021), we envisage that TTF-2 downregulation could be, at molecular level, one of the mechanisms involved in the insurgence of these obesity-induced thyroid pathologies.
It is worth pointing out that, in our experiments, the down-regulation of Ttf-2 expression is not determined by lack of its positive inducers, TSH and insulin, because we have obtained the same results in their presence in complete medium. Accordingly, literature data indicate that in obese mice and in human sera from patients with obesity, the TSH level should be even higher than in lean mice or in human sera from healthy controls, respectively (Popovic & Duntas 2005, Reinehr 2011). Indeed, obesity is characterized by higher circulating levels of leptin, which are able to stimulate centrally the pro-thyrotropin-releasing hormone (TRH) expression and consequently the TSH level (Khodamoradi et al. 2022).
Since obesity activates the expression of thyroid differentiation markers (Lee et al. 2015, Panveloski-Costa et al. 2018), our results suggest that TTF-2 could act, in our experimental setting, as transcriptional repressor. Such a role has been already described for TTF-2; Perrone et al. reported that TTF-2 is able to inhibit the activity of the thyroid-specific transcription factors TTF-1 and Pax-8 in the regulation of thyroglobulin and thyroperoxidase gene promoters and such TTF-2 inhibitory activity is promoter-specific and can be independent of its binding to DNA (Perrone et al. 2000). In a genome-wide expression screening of the TTF-2 target genes in PC CL3, Fernández et al. have identified genes either activated or repressed by TTF-2 (Fernández et al. 2013). In the same study, it has been reported that NIS gene expression is positively regulated by the direct binding of TTF-2 to DNA regulatory sequences. By contrast, TTF-2 has been identified, in thyroid cancer cells, in a repressor complex on the human NIS gene promoter (Li & Ain 2010). These data confirm that TTF-2 can act, in the regulation of NIS gene expression, as transcriptional activator or as repressor. Hence, we could envisage that in PC CL3, the adipocytes signaling modifies TTF-2 activity from positive to negative regulator of Nis transcription. Such a dual role in transcriptional regulation has been identified for several transcription factors, the nuclear receptors, p53 and YY2 among others (Menendez et al. 2009, Li et al. 2020, Jafari et al. 2022). It is often regulated by post-transcriptional modification associated with alternative interactions in protein complexes of the transcription factor with co-activators and/or co-repressors.
Alteration of TTF-2 level of expression is particularly relevant for thyrocyte neoplastic transformation as well. It has been shown that in the context of BrafV600E-mediated thyrocyte transformation, reduced levels of TTF-2 resulted in more undifferentiated tumors with respect to the same transformation in thyrocytes with normal TTF-2 levels (Credendino et al. 2020). Therefore, our results, if further confirmed, could suggest a biochemical mechanism elicited by obesity in the insurgence or progression of thyroid cancer. Growing data indicates that TTF-2 is also related to the initiation of specific tumors in extra-thyroidal tissues, such as pancreatic cancer and cutaneous squamous cell carcinoma (Venza et al. 2010, Hata et al. 2017); therefore, our results could be of relevance for the studies on the role of obesity in these malignancies as well.
Our results open up several questions concerning the biochemical characterization of the adipocyte signal that is able to affect thyroid-specific gene expression. Adipose tissue secretes, depending on its location, different patterns of adipokines (Coelho et al. 2013). Therefore, the identification of the adipokine(s) triggering the regulation of TTF-2 gene expression is of great relevance. Interestingly, it has been reported that TNF-α, an adipokine increased in obesity (Hotamisligil et al. 1993), is able to downregulate TTF-2 expression in FRTL-5 cells (Miyazaki et al. 1999). A further question concerns the role of adipocyte-derived extracellular vesicles (EV) including exosomes. EVs or exosomes play a crucial role in mediating the pathogenesis of many diseases associated with obesity (Kwan et al. 2021). Since the exosomal cargo varies in different adipose depots, it could be envisaged that different adipose depots could differently trigger thyroid-specific gene expression and thyroid disorders. Experiments are in progress to address these questions.
Our results indicate that NO inhibits TTF-2 gene expression, and this result is consistent with the study of Montesinos et al. showing that TTF-2 is controlled by NO/cGMP/PKG signaling pathway (Montesinos et al. 2016). As shown in other cell types, the second messengers cAMP and cGMP signaling pathways often exert opposing influence (Zaccolo & Movsesian 2007). Similarly, in follicular thyroid cells, the cAMP/PKA pathways activate the expression of thyroid-specific genes (Damante et al. 2001), whereas the NO/cGMP/PKG pathway downregulates it (Bazzara et al. 2007). Accordingly, our study suggests that obesity affects thyroid-specific gene expression via the NO pathway able to downregulate TTF-2 expression. A major limitation of our study involves the transferability of our results to human beings, although we used human sera from patients with obesity, the experimental system of thyrocytes was from mice and rat PC CL3 cells. Therefore, our results need to be confirmed in humans. However, the mice strain C57BL/6J has been shown to be a particularly good model mimicking human metabolic disorders that are observed in obesity (Buettner et al. 2007, Wang & Liao 2012).
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector
Acknowledgements
The authors thank M Alimandi for critical reading of the manuscript and P Palozzo for his technical support.
References
Avgerinos KI, Spyrou N, Mantzoros CS & Dalamaga M 2019 Obesity and cancer risk: emerging biological mechanisms and perspectives. Metabolism: Clinical and Experimental 92 121–135. (https://doi.org/10.1016/j.metabol.2018.11.001)
Aza-Blanc P, Di Lauro R & Santisteban P 1993 Identification of a cis-regulatory element and a thyroid-specific nuclear factor mediating the hormonal regulation of rat thyroid peroxidase promoter activity. Molecular Endocrinology 7 1297–1306. (https://doi.org/10.1210/mend.7.10.8264661)
Bazzara LG, Vélez ML, Costamagna ME, Cabanillas AM, Fozzatti L, Lucero AM, Pellizas CG & Masini-Repiso AM 2007 Nitric oxide/cGMP signaling inhibits TSH-stimulated iodide uptake and expression of thyroid peroxidase and thyroglobulin mRNA in FRTL-5 thyroid cells. Thyroid 17 717–727. (https://doi.org/10.1089/thy.2007.0086)
Bolin AP, Sousa-Filho CPB, Dos Santos GTN, Ferreira LT, de Andrade PBM, Figueira ACM, Batista FAH & Otton R 2020 Adipogenic commitment induced by green tea polyphenols remodel adipocytes to a thermogenic phenotype. Journal of Nutritional Biochemistry 83 108429. (https://doi.org/10.1016/j.jnutbio.2020.108429)
Buettner R, Schölmerich J & Bollheimer LC 2007 High-fat diets: modeling the metabolic disorders of human obesity in rodents. Obesity 15 798–808. (https://doi.org/10.1038/oby.2007.608)
Chen X, Wang JJ, Yu L, Wang HY & Sun H 2021 The association between BMI, smoking, drinking and thyroid disease: a cross-sectional study in Wuhan, China. BMC Endocrine Disorders 21 184. (https://doi.org/10.1186/s12902-021-00852-0)
Coelho M, Oliveira T & Fernandes R 2013 Biochemistry of adipose tissue: an endocrine organ. Archives of Medical Science 9 191–200. (https://doi.org/10.5114/aoms.2013.33181)
Colin IM, Poncin S, Levêque P, Gallez B & Gérard AC 2014 Differential regulation of the production of reactive oxygen species in Th1 cytokine-treated thyroid cells. Thyroid 24 441–452. (https://doi.org/10.1089/thy.2013.0142)
Conlee KM, Stephens ML, Rowan AN & King LA 2005 Carbon dioxide for euthanasia: concerns regarding pain and distress, with special reference to mice and rats. Laboratory Animals 39 137–161. (https://doi.org/10.1258/0023677053739747)
Cortés JMR & Zerón HM 2019 Genetics of thyroid disorders. Folia Medica 61 172–179. (https://doi.org/10.2478/folmed-2018-0078)
Credendino SC, Moccia C, Amendola E, D’Avino G, Di Guida L, Clery E, Greco A, Bellevicine C, Brunetti A & De Felice M et al.2020 FOXE1 gene dosage affects thyroid cancer histology and differentiation in vivo. International Journal of Molecular Sciences 22 E25. (https://doi.org/10.3390/ijms22010025)
Damante G, Tell G & Di Lauro R 2001 A unique combination of transcription factors controls differentiation of thyroid cells. Progress in Nucleic Acid Research and Molecular Biology 66 307–356. (https://doi.org/10.1016/s0079-6603(0066033-6)
De Felice M, Ovitt C, Biffali E, Rodriguez-Mallon A, Arra C, Anastassiadis K, Macchia PE, Mattei MG, Mariano A & Schöler H et al.1998 A mouse model for hereditary thyroid dysgenesis and cleft palate. Nature Genetics 19 395–398. (https://doi.org/10.1038/1289)
De Leo R, Miccadei S, Zammarchi E & Civitareale D 2000 Role for p300 in Pax 8 induction of thyroperoxidase gene expression. Journal of Biological Chemistry 275 34100–34105. (https://doi.org/10.1074/jbc.M003043200)
Deng T, Lyon CJ, Bergin S, Caligiuri MA & Hsueh WA 2016 Obesity, inflammation, and cancer. Annual Review of Pathology 11 421–449. (https://doi.org/10.1146/annurev-pathol-012615-044359)
Denny JC, Crawford DC, Ritchie MD, Bielinski SJ, Basford MA, Bradford Y, Chai HS, Bastarache L, Zuvich R & Peissig P et al.2011 Variants near FOXE1 are associated with hypothyroidism and other thyroid conditions: using electronic medical records for genome- and phenome-wide studies. American Journal of Human Genetics 89 529–542. (https://doi.org/10.1016/j.ajhg.2011.09.008)
Ellulu MS, Patimah I, Khaza’ai H, Rahmat A & Abed Y 2017 Obesity and inflammation: the linking mechanism and the complications. Archives of Medical Science 13 851–863. (https://doi.org/10.5114/aoms.2016.58928)
Engeland A, Tretli S, Akslen LA & Bjørge T 2006 Body size and thyroid cancer in two million Norwegian men and women. British Journal of Cancer 95 366–370. (https://doi.org/10.1038/sj.bjc.6603249)
Fernández LP, López-Márquez A, Martínez AM, Gómez-López G & Santisteban P 2013 New insights into FoxE1 functions: identification of direct FoxE1 targets in thyroid cells. PLoS One 8 e62849. (https://doi.org/10.1371/journal.pone.0062849)
Fernández LP, López-Márquez A & Santisteban P 2015 Thyroid transcription factors in development, differentiation and disease. Nature Reviews. Endocrinology 11 29–42. (https://doi.org/10.1038/nrendo.2014.186)
Gudmundsson J, Sulem P, Gudbjartsson DF, Jonasson JG, Sigurdsson A, Bergthorsson JT, He H, Blondal T, Geller F & Jakobsdottir M et al.2009 Common variants on 9q22.33 and 14q13.3 predispose to thyroid cancer in European populations. Nature Genetics 41 460–464. (https://doi.org/10.1038/ng.339)
Hata T, Dal Molin M, Hong SM, Tamura K, Suenaga M, Yu J, Sedogawa H, Weiss MJ, Wolfgang CL & Lennon AM et al.2017 Predicting the grade of dysplasia of pancreatic cystic neoplasms using cyst fluid DNA methylation markers. Clinical Cancer Research 23 3935–3944. (https://doi.org/10.1158/1078-0432.CCR-16-2244)
Hotamisligil GS, Shargill NS & Spiegelman BM 1993 Adipose expression of tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science 259 87–91. (https://doi.org/10.1126/science.7678183)
Jafari H, Hussain S & Campbell MJ 2022 Nuclear receptor coregulators in hormone-dependent cancers. Cancers 14 2402. (https://doi.org/10.3390/cancers14102402)
Khodamoradi K, Khosravizadeh Z, Seetharam D, Mallepalli S, Farber N & Arora H 2022 The role of leptin and low testosterone in obesity. International Journal of Impotence Research 34 704–713. (https://doi.org/10.1038/s41443-022-00534-y)
Kimura T, Van Keymeulen A, Golstein J, Fusco A, Dumont JE & Roger PP 2001 Regulation of thyroid cell proliferation by TSH and other factors: a critical evaluation of in vitro models. Endocrine Reviews 22 631–656. (https://doi.org/10.1210/edrv.22.5.0444)
Kwan HY, Chen M, Xu K & Chen B 2021 The impact of obesity on adipocyte-derived extracellular vesicles. Cellular and Molecular Life Sciences 78 7275–7288. (https://doi.org/10.1007/s00018-021-03973-w)
Landa I, Ruiz-Llorente S, Montero-Conde C, Inglada-Pérez L, Schiavi F, Leskelä S, Pita G, Milne R, Maravall J & Ramos I et al.2009 The variant rs1867277 in FOXE1 gene confers thyroid cancer susceptibility through the recruitment of USF1/USF2 transcription factors. PLOS Genetics 5 e1000637. (https://doi.org/10.1371/journal.pgen.1000637)
Lang P, Hasselwander S, Li H & Xia N 2019 Effects of different diets used in diet-induced obesity models on insulin resistance and vascular dysfunction in C57BL/6 mice. Scientific Reports 9 19556. (https://doi.org/10.1038/s41598-019-55987-x)
Lee MH, Lee JU, Joung KH, Kim YK, Ryu MJ, Lee SE, Kim SJ, Chung HK, Choi MJ & Chang JY et al.2015 Thyroid dysfunction associated with follicular cell steatosis in obese male mice and humans. Endocrinology 156 1181–1193. (https://doi.org/10.1210/en.2014-1670)
Li L, Li Y, Timothy Sembiring Meliala I, Kasim V & Wu S 2020 Biological roles of Yin Yang 2: Its implications in physiological and pathological events. Journal of Cellular and Molecular Medicine 24 12886–12899. (https://doi.org/10.1111/jcmm.15919)
Li W & Ain KB 2010 Human sodium-iodide symporter (hNIS) gene expression is inhibited by a trans-active transcriptional repressor, NIS-repressor, containing PARP-1 in thyroid cancer cells. Endocrine-Related Cancer 17 383–398. (https://doi.org/10.1677/ERC-09-0156)
Lutz TA & Woods SC 2012 Overview of animal models of obesity. Current Protocols in Pharmacology Chapter 5 Unit 5.61. (https://doi.org/10.1002/0471141755.ph0561s58)
Mello DF, Trevisan R, Rivera N, Geitner NK, Di Giulio RT, Wiesner MR, Hsu-Kim H & Meyer JN 2020 Caveats to the use of MTT, neutral red, Hoechst and resazurin to measure silver nanoparticle cytotoxicity. Chemico-Biological Interactions 315 108868. (https://doi.org/10.1016/j.cbi.2019.108868)
Menendez D, Inga A & Resnick MA 2009 The expanding universe of p53 targets. Nature Reviews. Cancer 9 724–737. (https://doi.org/10.1038/nrc2730)
Miyazaki A, Shimura H, Endo T, Haraguchi K & Onaya T 1999 Tumor necrosis factor-alpha and interferon-gamma suppress both gene expression and deoxyribonucleic acid-binding of TTF-2 in FRTL-5 cells. Endocrinology 140 4214–4220. (https://doi.org/10.1210/endo.140.9.6982)
Montesinos Mdel M, Nicola JP, Nazar M, Peyret V, Lucero AM, Pellizas CG & Masini-Repiso AM 2016 Nitric oxide-repressed Forkhead factor FoxE1 expression is involved in the inhibition of TSH-induced thyroid peroxidase levels. Molecular and Cellular Endocrinology 420 105–115. (https://doi.org/10.1016/j.mce.2015.11.020)
Ortiz L, Zannini M, Di Lauro R & Santisteban P 1997 Transcriptional control of the forkhead thyroid transcription factor TTF-2 by thyrotropin, insulin, and insulin-like growth factor I. Journal of Biological Chemistry 272 23334–23339. (https://doi.org/10.1074/jbc.272.37.23334)
Panveloski-Costa AC, Serrano-Nascimento C, Bargi-Souza P, Poyares LL, Viana GS & Nunes MT 2018 Beneficial effects of thyroid hormone on adipose inflammation and insulin sensitivity of obese Wistar rats. Physiological Reports 6 e13550. (https://doi.org/10.14814/phy2.13550)
Penna-Martinez M, Epp F, Kahles H, Ramos-Lopez E, Hinsch N, Hansmann ML, Selkinski I, Grünwald F, Holzer K & Bechstein WO et al.2014 FOXE1 association with differentiated thyroid cancer and its progression. Thyroid 24 845–851. (https://doi.org/10.1089/thy.2013.0274)
Perrone L, Pasca di Magliano M, Zannini M & Di Lauro R 2000 The thyroid transcription factor 2 (TTF-2) is a promoter-specific DNA-binding independent transcriptional repressor. Biochemical and Biophysical Research Communications 275 203–208. (https://doi.org/10.1006/bbrc.2000.3232)
Popovic V & Duntas LH 2005 Leptin TRH and ghrelin: influence on energy homeostasis at rest and during exercise. Hormone and Metabolic Research 37 533–537. (https://doi.org/10.1055/s-2005-870418)
Ramírez-Zacarías JL, Castro-Muñozledo F & Kuri-Harcuch W 1992 Quantitation of adipose conversion and triglycerides by staining intracytoplasmic lipids with Oil Red O. Histochemistry 97 493–497. (https://doi.org/10.1007/BF00316069)
Reinehr T 2011 Thyroid function in the nutritionally obese child and adolescent. Current Opinion in Pediatrics 23 415–420. (https://doi.org/10.1097/MOP.0b013e328344c393)
Rosen OM, Smith CJ, Hirsch A, Lai E & Rubin CS 1979 Recent studies of the 3T3-L1 adipocyte-like cell line. Recent Progress in Hormone Research 35 477–499. (https://doi.org/10.1016/b978-0-12-571135-7.50015-1)
Santisteban P, Acebrón A, Polycarpou-Schwarz M & Di Lauro R 1992 Insulin and insulin-like growth factor I regulate a thyroid-specific nuclear protein that binds to the thyroglobulin promoter. Molecular Endocrinology 6 1310–1317. (https://doi.org/10.1210/mend.6.8.1406708)
Takahashi M, Saenko VA, Rogounovitch TI, Kawaguchi T, Drozd VM, Takigawa-Imamura H, Akulevich NM, Ratanajaraya C, Mitsutake N & Takamura N et al.2010 The FOXE1 locus is a major genetic determinant for radiation-related thyroid carcinoma in Chernobyl. Human Molecular Genetics 19 2516–2523. (https://doi.org/10.1093/hmg/ddq123)
Venza I, Visalli M, Tripodo B, De Grazia G, Loddo S, Teti D & Venza M 2010 FOXE1 is a target for aberrant methylation in cutaneous squamous cell carcinoma. British Journal of Dermatology 162 1093–1097. (https://doi.org/10.1111/j.1365-2133.2009.09560.x)
Wang CY & Liao JK 2012 A mouse model of diet-induced obesity and insulin resistance. Methods in Molecular Biology 821 421–433. (https://doi.org/10.1007/978-1-61779-430-8_27)
Wang Y, Lin H, Li Q, Guan L, Zhao M, Zhong F, Liu J, Yuan Z, Guo H & Song Y et al.2021 Association between different obesity phenotypes and hypothyroidism: a study based on a longitudinal health management cohort. Endocrine 72 688–698. (https://doi.org/10.1007/s12020-021-02677-2)
Zaccolo M & Movsesian MA 2007 cAMP and cGMP signaling cross-talk: role of phosphodiesterases and implications for cardiac pathophysiology. Circulation Research 100 1569–1578. (https://doi.org/10.1161/CIRCRESAHA.106.144501)
Zannini M, Avantaggiato V, Biffali E, Arnone MI, Sato K, Pischetola M, Taylor BA, Phillips SJ, Simeone A & Di Lauro R 1997 TTF-2, a new forkhead protein, shows a temporal expression in the developing thyroid which is consistent with a role in controlling the onset of differentiation. EMBO Journal 16 3185–3197. (https://doi.org/10.1093/emboj/16.11.3185)
Zhao ZG, Guo XG, Ba CX, Wang W, Yang YY, Wang J & Cao HY 2012 Overweight, obesity and thyroid cancer risk: a meta-analysis of cohort studies. Journal of International Medical Research 40 2041–2050. (https://doi.org/10.1177/030006051204000601)
