Abstract
Obesity causes white and brown adipocyte dysfunction, reducing browning and stimulating whitening. Drugs that tackle adipocyte dysfunction through thermogenesis stimulation could be used to treat obesity. This study sought to address whether a combination of the PPAR-alpha agonist (WY14643) and DPP4i (linagliptin) potentiates browning and mitigates adipose tissue dysfunction, emphasizing the pathways related to browning induction and the underlying thermogenesis in high-fat-fed mice. Adult male C57BL/6 mice were randomly assigned to receive a control diet (C, 10% lipids) or a high-fat diet (HF, 50% lipids) for 12 weeks. Experiment 1 aimed to evaluate whether 5 weeks of combined therapy was able to potentiate browning using a five-group design: C, HF, HFW (monotherapy with WY14643, 2.5 mg/kg body mass), HFL (monotherapy with linagliptin, 15 mg/kg body mass), and HFC (a combination of both drugs). Experiment 2 further addressed the pathways involved in browning maximization using a four-group study design: C, CC (C diet plus the drug combination), HF, and HFC (HF diet plus the drug combination). The HF group showed overweight, oral glucose intolerance, sWAT adipocyte hypertrophy, and reduced numerical density of nuclei per area of BAT confirming whitening. Only the combined treatment normalized these parameters in addition to body temperature increase, browning induction, and whitening rescue. The high expression of thermogenic marker genes parallel to reduced expression of inflammatory and endoplasmic reticulum stress genes mediated the beneficial findings. Hence, the PPAR-alpha agonist and DPP-4i combination is a promising target for obesity control by inducing functional brown adipocytes, browning of sWAT, and enhanced adaptive thermogenesis.
Introduction
Obesity damages the white adipose tissue (WAT) and brown adipose tissue (BAT) structure and function (Strissel et al. 2007, Shimizu et al. 2014). White adipocyte dysfunction is reflected in inflammation, increased lipolysis, and lipogenesis, resulting in adipocyte hypertrophy and ectopic fat accumulation (Gustafson & Smith 2015, Saponaro et al. 2015). In BAT, insulin resistance and inflammation induce white-like adipocytes with impaired thermogenesis, a phenomenon called whitening (Kotzbeck et al. 2018).
Endoplasmic reticulum (ER) stress, a condition triggered by the accumulation of unfolded proteins, precedes adipocyte dysfunction and inhibits browning of s.c. WAT (sWAT). Hence, decreased thermogenesis and maximized inflammation aggravate adipocyte dysfunction in a vicious cycle (Hummasti & Hotamisligil 2010, Fernandes-da-Silva et al. 2021). Therefore, pharmacological targets that induce beige adipocytes (browning) in the sWAT reservoir while reducing whitening in BAT could treat obesity by increasing the conversion of chemical energy into heat (Nedergaard et al. 2007, Miranda et al. 2020).
In this context, peroxisome proliferator-activated receptors (PPARs) are transcription factors highly relevant in counter metabolic disorders (Souza-Mello 2015), and the PPAR-alpha isoform is essential to lipid homeostasis through oxidative metabolism and thermogenesis (Li et al. 2005, Seale 2015). Concerning linagliptin, its action encompasses increased plasma GLP1 concentrations by dipeptidyl peptidase 4 (DPP-4) inhibition (Drucker & Nauck 2006). DPP4 is the catalytic site of CD26 and is also an adipokine whose levels are augmented with adipocyte hypertrophy (Lamers et al. 2011). A high dose of DPP4i has recently increased adaptive thermogenesis and macrophage polarization to the M2 state in HFD-fed mice (de Oliveira Correia et al. 2019). Furthermore, in high-fructose-fed mice, the PPAR-alpha and linagliptin combination had beneficial effects on the gut-liver axis, mitigating fatty liver (Silva-Veiga et al. 2020). This result could imply favored thermogenesis as gut–adipose axis impairments precede liver alterations due to metabolic diseases (Poekes et al. 2017). However, there are no reports in the literature about this drug combination on adipose tissue function in obese mouse models. Therefore, we hypothesized that a combined therapy (PPAR-alpha agonist + DPP4i) could restore adipose tissue thermogenic function by mitigating BAT whitening while eliciting browning in the sWAT of obese mice.
This study sought to address whether a combination of the PPAR-alpha agonist (WY14643) and DPP4i (linagliptin) potentiates browning and mitigates adipose tissue dysfunction, emphasizing the pathways related to browning induction and the underlying thermogenesis in high-fat-fed mice.
Materials and methods
The study protocol, approved by the Ethical Committee in Animal Experimentation of the State University of Rio de Janeiro (CEUA 041/2018), followed the Guide for Care and Use of Laboratory Animals (NIH publication No. 85-23, revised in 1996).
Animals and diets
Sixty-five male C57BL/6 mice were group-housed in ventilated cages (n = 5 per cage, reusable IVC housing, NexGen, Allentown, Pennsylvania, USA) under controlled luminosity (12 h light:12 h darkness cycle), humidity (60 ± 10%), and temperature (21 ± 2°C) conditions with free access to food and water.
At 3 months of age, the mice were randomly allocated into two nutritional groups for 12 weeks: an HFD (HF, n = 40, 50% energy as lipids, 14% energy as protein, and 36% energy as carbohydrates, 20.90 kJ/g) and a control diet (C, n = 25, 10% energy as lipids, 14% energy as protein, and 76% energy as carbohydrates, 15.88 kJ/g). PragSoluções (Jau, São Paulo, Brazil) produced the diets according to the recommendations of AIN-93 M for rodents (Reeves et al. 1993). These animals were used in two different experiments:
-
Experiment 1 addressed whether the PPAR-alpha agonist and DPP-4i combination was necessary to induce the browning of sWAT. After the first 12 weeks of obesity induction, a 5-week treatment started, with the randomly divided following groups: C (n = 5), control diet, untreated; HF (n = 5), high-fat diet, untreated; HFW (n = 5), high-fat diet + PPAR-alpha agonist (WY14643, Cayman Chemical); HFL (n = 5), high-fat diet + DPP4i (linagliptin, Tradjenta, Boehringer Ingelheim, Germany); HFC (n = 5), high-fat diet, treated with PPAR-alpha agonist + DPP4i.
-
Experiment 2 further explored the main pathways related to the expressive browning found in the group that received the combination of PPAR-alpha agonist with DPP4i. After the same 12-week dietary protocol to induce obesity, animals were randomly assigned to four groups: C (n = 10), control diet, untreated; CC (n = 10), control diet, treated with PPAR-alpha agonist (WY14643, Cayman Chemical) + DPP4i (linagliptin, Tradjenta, Boehringer Ingelheim) combination; HF (n = 10), high-fat diet, untreated; HFC (n = 10), high-fat diet, treated with PPAR-alpha agonist + DPP4i combination. The treatment also lasted for 5 weeks, and the inclusion of a control group treated with the newly proposed drug combination aimed to evaluate possible side effects.
The drugs were mixed with the diets at a dose of 2.5 mg/kg of body mass (BM) for WY14643 and 15 mg/kg BM for linagliptin in both experiments (Kern et al. 2012, Rachid et al. 2018).
Thermography
At the end of both experiments, a thermographic camera (Flir C2, Flir Systems, Wilsonville, Oregon, EUA) was used to measure the conscious animals’ body surface temperature.
Sacrifice
After the 17-week protocol, animals were sacrificed under i.p. anesthesia (ketamine, 240 mg/kg, and xylazine 30 mg/kg) after a 6-h fast. Blood samples, obtained through cardiac puncture, had the plasma separated by centrifugation (712 g, 15 min) at room temperature. These samples were used to perform ELISA.
The sWAT from the inguinal region (located between the inferior part of the rib cage and the middle of the lower limb) and the interscapular region (iBAT) were carefully dissected, weighed, fixed in 4% w/v formaldehyde, 0.1 M phosphate buffer, and pH 7.2 Millonig formalin for observation by light microscopy. The sWAT was also frozen at −80°C for molecular analyses. In addition, other compartments (the retroperitoneal and epididymal fat pads) had their masses determined and comprised the intra-abdominal fat to evaluate the fat distribution.
Experiment 1
Food intake, energy intake, and body mass
Food intake was evaluated daily as the difference between the amount of food offered and the remaining food after 24 h. Energy intake is the food intake in kilogram multiplied by the energy density per gram of each diet in kilojoule. In addition, body mass was measured weekly.
Oral glucose tolerance test (OGTT)
In the last week of the treatment, the animals had their OGTT measured after a 6-h fast. All glucose measurements used a manual glucometer (Accu-Chek, Roche) and blood samples from the caudal vein. Initially, glucose evaluation at time 0 (fasting glycemia) occurred before administering a glucose solution (25% in sterile saline (0.9% NaCl)) by orogastric gavage at a dose of 2 g glucose/kg BM. Follow-up glucose measurements occurred at 15, 30, 60, and 120 min following oral glucose overload. The area under the curve (AUC) was calculated (GraphPad Prism version 8.4.0).
Indirect calorimetry
Before sacrifice, the animals underwent a 48-h protocol in the Oxylet system (Panlab/Harvard, Barcelona, Spain), with the first 24 h discarded as the acclimatization time (Penna-de-Carvalho et al. 2014). The respiratory exchange ratio (RER) complied with the ratio of carbon dioxide production (VCO2) to oxygen consumption (VO2).
Plasma analysis
Plasma concentrations of total GLP1 and insulin were measured in duplicate with commercially available ELISA (Multispecies GLP-1 ELISA Kit Cat. #EZGLP1T-36K; Rat/Mouse Insulin ELISA kit Cat. #EZRMI-13K, using Fluostar Omega equipment (BMG LABTECH GmbH, Germany)).
Light microscopy, stereology, and immunohistochemistry
sWAT
sWAT obtained by dissection, after 48 h of fixation, was embedded in Paraplast plus (Sigma–Aldrich Corp.). Tissue cut in 5-μm sections was stained with hematoxylin-eosin and analyzed under a light microscope (Olympus BX51, and the digital camera Infinity 1-5 c, Lumenera Corp., Ottawa, ON, Canada). Random microscopic fields were photographed to blindly estimate the cross-sectional area of adipocytes: volume density (Vv) of the adipocytes divided by twice the numerical density of the adipocytes per area (QA) (Mandarim-de-Lacerda 2003). A 16-point test system was used to estimate the Vv of the adipocytes (points that hit adipocytes, Pp, divided by the total number of points within the test system, PT). Conversely, QA estimation was carried out considering the number of adipocytes within a test area (except for the adipocytes that touched the forbidden lines) divided by the test system area (Bargut et al. 2016).
For immunohistochemistry, the sWAT slides were deparaffinized, and after antigen retrieval (citrate buffer, pH 6.0 at 60°C for 20 min), peroxidase and nonspecific binding blockade, they were incubated with primary antibodies against UCP1 (Cusabio, PA025554ESR2HU, Houston, Tx, USA, dilution 1:150) or β3-AR (Santa Cruz, sc-1473, 1:100) for 2 h at room temperature. Both antibodies were diluted in 1.5% horse serum (Vector Laboratories, CA, USA). Then, the slides were incubated with a biotinylated pan-specific secondary antibody for 10 min (Vector Laboratories), followed by incubation with streptavidin and peroxidase for 5 min. The staining was developed with DAB (incubation for 5 min, Vectastain Universal Quick HRP kit, peroxidase, PK-7800, Vector Laboratories). The slides were counterstained with hematoxylin and mounted with Entellan (Merck).
Concerning UCP1 immunodensity estimation, random images of five animals per group were evaluated using ImageJ (ImageJ bundled with Java 1.8.0, National Institute of Health, NIH). After normalization of the images using a plugin to remove the background, color deconvolution was performed. The image with the isolated DAB signal was analyzed with the histogram tool to determine the percentage occupied by the DAB, which was considered the UCP1 immunodensity (%).
BAT
BAT followed the same routine described for sWAT in the previous section to obtain the slides, staining protocol, and photomicrographs. Digital images of random microscopic fields were obtained to blindly estimate the numerical density of nuclei per area (QA (nuclei, BAT)). Briefly, a frame of the known area was superimposed on photomicrographs (produced by Stepanizer) (Tschanz et al. 2011), and BAT nuclei within the frame but not intersected by exclusion lines of the frame were counted (Gundersen 1977). Then, QA (nuclei, BAT): = nuclei counted/test area (Mandarim-de-Lacerda 2003).
Statistical analysis
Data are presented as the mean and s.d. The statistical analysis comprised Welch’s t-test during the first 12 weeks and Brown–Forsythe and Welch ANOVA followed by a Dunnett T3 post hoc test for the treatment phase. In addition, one-way repeated measures ANOVA was used to evaluate the duration of the glucose peak in the OGTT as it evaluates whether the means within the same group are different.
Experiment 2
Metabolic and plasma analysis
Body mass was monitored weekly, and energy intake was evaluated daily. Plasma concentrations of leptin and total adiponectin were determined by ELISA (Rat/Mouse Leptin ELISA kit Cat. #EZML-82K; Mouse adiponectin ELISA kit Cat. #EZMADP-60K, Millipore).
UCP1 immunofluorescence
After paraffin removal, antigen retrieval with citrate buffer (pH 6.0 at 60°C) and nonspecific bond blockade (2% glycine and 5% BSA in PBS), 5 µm sWAT slides were incubated with the anti-UCP1 primary antibody (1:50 CSB-PA025554ESR2HU, Cusabio Technology LLC, Houston, TX, USA) overnight, followed by incubation with the secondary antibody conjugated with Alexa Fluor 488 (rabbit anti-mouse IgG H+L, Thermo Fisher Scientific). SlowFade (Invitrogen, Molecular Probes) was used to mount the slides to maintain fluorescence until analyses under a fluorescence microscope (Nikon Confocal Laser Scanning Microscopy – Model C2; Nikon Instruments, Inc.).
RT-qPCR
In the analysis, 50 mg of sWAT was transferred to autoclaved microtubes containing lysis solution, and mRNA was extracted and isolated. Nanovue spectroscopy (GE Life Sciences) was applied to determine the RNA amount, followed by obtaining the first strand of cDNA synthesis from the mRNA of the samples. Real-time PCR (RT-qPCR) used a StepOne plus cycler, a SYBR Green (Invitrogen) mixture, and Primer3web online software version 4.0.0 for primer design. Table 1 shows the primers used in this study.
Detailed forward and reverse primer sequences of RT-qPCR.
| Primers | Forward | Reverse |
|---|---|---|
| Atf4 | CCGAGATGAGCTTCCTGAAC | ACCCATGAGGTTTCAAGTGC |
| Beta-actin | TGTTACCAACTGGGACGACA | GGGGTGTTGAAGGTCTCAAA |
| Bmp8b | CTATGCAGGCCCTGGTACAT | AGGCCTGGACTACCATGTTG |
| Chop | CTGCCTTTCACCTTGGAGAC | CGTTTCCTGGGGATGAGATA |
| Cidea | CTCGGCTGTCTCAATGTCAA | GGAACTGTCCCGTCATCTGT |
| Cpt1b | GGCTGCCGTGGGACATT | TGCCTTGGCTACTTGGTACGA |
| Dpp4 | TGGTACACGGATGAAGACCA | GAA ATGGCTCATGTGGGA AT |
| Gadd45 | GCGAGAACGACATCAACATC | GTTCGTCACCAGCACACAGT |
| Nlpr3 | ATGCTGCTTCGACATCTCCT | GTTTCTGGAGGTTGCAGAGC |
| Pdk4 | CACCACATGCTCTTCGAACTCT | AAGGAAGGACGGTTTTCTTGA |
| Pgc1-a | GTCAACAGCAAAAGCCACAA | GTGTGAGGAGGGTCATCGTT |
| Plin1 | ACGACCAGACAGACACAGAG | GGCTGTAACCTCTCTGAGCA |
| Ppar-a | TCGGACTCGGTCTTCTTGAT | TCTTCCCAAAGCTCCTTCAA |
| Prdm16 | AGGGCAAGAACCATTACACG | GGAGGGTTTTGTCTTGTCCA |
| Tlr4 | GCCGGAAGGTTATTGTGGTA | GAAACTGCCATGTTTGAGCA |
| Ucp1 | TCTCAGCCGGCTTAATGACT | TGCATTCTGACCTTCACGAC |
| β3ar | ACAGGAATGCCACTCCAATC | TTAGCCACAACGAACACTCG |
Atf4, activating transcription factor 4; Bmp8b, bone morphogenetic protein-8b; Chop, CCAAT-enhancer binding protein homologous protein; Cidea, cell death-inducing DFFA-like effector a; Cpt1b, carnitine palmitoyltransferase I b; Dpp4, dipeptidyl peptidase-4; Gadd45, growth arrest and DNA damage inducible gene 45; Nlrp3, NLR family pyrin domain containing 3; Pdk4, pyruvate dehydrogenase lipoamide kinase isozyme 4; Pgc1-a, peroxisome proliferator-activated receptor gamma coactivator 1-alpha; Plin1, perilipin 1; Ppar, peroxisome proliferator-activated receptors; Ppar-a, Ppar-alpha; Prdm16, PR domain containing 16; Tlr4, toll-like receptor 4; Ucp1, uncoupling protein-1; β3ar, beta 3 adrenergic receptor.
The endogenous control adopted was beta-actin, which was used to normalize the expression of the selected gene. RT-qPCR efficiency, calculated from a series of cDNA dilutions, was approximately equal to the endogenous control for the target gene. The relative mRNA expression ratio (RQ) was calculated using the equation 2−∆∆Ct, which expresses the difference between the number of cycles (CT) of the target genes and the endogenous control. Throughout the text, gene nomenclature followed the international standard for rodents, with the first letter in capital letters and italics and protein acronyms in capital letters (Davisson 1994).
Statistical analysis
Data are presented as the mean and s.d. Brown–Forsythe and Welch ANOVA followed by a Dunnett T3 post hoc test was used to determine the significant differences at the end of the experiment. Two-way ANOVA tested the isolated influence of diet or treatment and possible interactions between these variables on the evaluated parameters. A significance level of P < 0.05 was considered statistically significant (GraphPad Prism, version 8.4.0).
Results
Experiment 1: PPAR-alpha agonist plus DPP-4i is necessary to induce browning of sWAT
All proposed treatments decreased BM without altering food intake
The high energy density of the HF diet elicited BM gain and large fat pads in different compartments. The C and HF groups began the experiment without differences in BM (week 0). After 1 week of diet intake, the HF group showed a higher BM than the C group (+5%, Fig. 1A), which steadily increased throughout the remaining weeks of obesity induction (+12%, week 12, Fig. 1A) until the end of the experiment (+12%, Fig. 1A). All treatments caused a significant BM reduction from the second week. However, the BM of the HFW group remained at intermediate values between the C and HF groups (Fig. 1A), whereas both the HFL and HFC groups showed BM values similar to the C group at the end of treatment (Fig. 1A).
Weekly body mass (A); Epididymal fat pad (B); s.c. fat pad (C). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated: a ≠ C; b ≠ HF; c ≠ HFW; d ≠ HFL. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
Weekly body mass (A); Epididymal fat pad (B); s.c. fat pad (C). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated: a ≠ C; b ≠ HF; c ≠ HFW; d ≠ HFL. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
Weekly body mass (A); Epididymal fat pad (B); s.c. fat pad (C). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated: a ≠ C; b ≠ HF; c ≠ HFW; d ≠ HFL. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
Furthermore, none of the groups differed regarding food intake throughout the experiment (Table 2). Notwithstanding, all HF-fed animals (untreated and treated) showed higher energy intake than the C group during the treatment (Table 2), as expected due to the high energy density of the HF diet.
Food behavior, thermography, BAT mass/body mass, and indirect calorimetry.
| Data | C | HF | HFW | HFL | HFC |
|---|---|---|---|---|---|
| Food intake (g/day/animal) | 3.07 ± 0.03 | 3.08 ± 0.01 | 3.03 ± 0.05 | 3.03 ± 0.06 | 3.06 ± 0.02 |
| Cumulative energy intake (kJ/day/animal) | 48.80 ± 0.59 | 64.29 ± 0.30a | 63.42 ± 1.102a | 63.31 ± 1.246a | 64.04 ± 0.59a |
| Body temperature (°C) | 31.70 ± 0.27 | 33.64 ± 0.11a | 34.05 ± 0.26a | 34.30 ± 0.55a | 34.10 ± 0.23a,b |
| BAT / body mass (%) | 0.27 ± 0.02 | 0.36 ± 0.04a | 0.29 ± 0.02 | 0.27 ± 0.03b | 0.27 ± 0.02b |
| Respiratory Exchange ratio (CO2/O2) | 0.84 ± 0.02 | 0.91 ± 0.01a | 0.79 ± 0.04b | 0.70 ± 0.05a,b | 0.82 ± 0.02b,d |
Data presented as mean ± s.d. Significant differences (P< 0.05) are indicated: a ≠ C; b ≠ HF; d ≠ HFL as determined by Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i), brown adipose tissue (BAT).
Only the combined treatment normalized epididymal and s.c. fat pad accumulation
The HF group had a larger epididymal fat pad than the C group (+50%, Fig. 1B). In contrast, only the HFC group had a significant reduction in epididymal fat pad accumulation compared with the HF group (−31%, Fig. 1B), resembling the C group. These data show that the proposed combined treatment rescued the epididymal fat pad even with HF diet intake continuation by the HFC group. The HF group showed a significant increase in the size of the s.c. fat pad as compared to the C group (+64%, Fig. 1C). Only the HFW and HFC groups had a significant reduction in s.c. fat accumulation (−41% for HFW vs HF and −35% for HFC vs HF, Fig. 1C).
The combined treatment countered insulin resistance while increasing GLP1 concentrations
The HF group had a 27% increase in fasting glycemia compared to the C group (Fig. 2A). Only the combined treatment caused a significant decrease in fasting glycemia compared to the HF group (−13%, Fig. 2A), suggesting a complete rescue of this parameter, as glycemic values in the HFC did not differ from those of the C group. Moreover, the area under the curve (AUC) revealed that the HF group had oral glucose intolerance through increased AUC values (+38% for HF vs C, Fig. 2B). In line with the AUC results, repeated-measures ANOVA showed that the HF group had a long-lasting glucose peak, reestablishing the baseline glucose levels only after 60 min.
Oral glucose tolerance test curve (A); area under the curve (B); plasma insulin concentrations (C); plasma GLP-1 concentrations (D). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences are indicated as follows: *P< 0.05; **P< 0.01; ***P< 0.001; ****P< 0.0001. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
Oral glucose tolerance test curve (A); area under the curve (B); plasma insulin concentrations (C); plasma GLP-1 concentrations (D). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences are indicated as follows: *P< 0.05; **P< 0.01; ***P< 0.001; ****P< 0.0001. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
Oral glucose tolerance test curve (A); area under the curve (B); plasma insulin concentrations (C); plasma GLP-1 concentrations (D). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences are indicated as follows: *P< 0.05; **P< 0.01; ***P< 0.001; ****P< 0.0001. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
All treatments (monotherapy and combination) improved oral glucose intolerance, causing significant reductions in AUC in the HFW (−13%), HFL (−31%), and HFC (−26%) groups (Fig. 2B). In addition, the treatment reverted oral glucose intolerance in the HFL and HFC groups, which did not differ from the C group. Repeated measures ANOVA showed that all treated groups reestablished their baseline glucose levels 15 min after the peak and in the C group.
In agreement with the OGTT results, the HF group showed hyperinsulinemia (+119% for HF vs C, Fig. 2C). The HFW and HFC groups had significantly reduced insulin concentrations (−65% for HFW vsHF and −64% for HFC vs HF, Fig. 2C). In contrast to the insulin results, the HFC group showed increased GLP1 concentrations compared to the HF (+23%), HFW (+22%), and HFL (+18%) groups (Fig. 2D), suggesting a possible interaction between PPAR-alpha activation and DPP-4 inhibition regarding this endpoint.
Only the combined treatment caused marked browning in the sWAT, in addition to rescuing the white adipocyte size
The C group showed standard-sized unilocular adipocytes. In contrast, there were hypertrophied unilocular adipocytes in the HF group (Fig. 3A). The HFW and HFL groups showed standard-sized unilocular adipocytes but without significant browning. Conversely, the HFC group had abundant multilocular adipocytes within sparse standard-sized unilocular adipocytes, characterizing the browning of sWAT (Fig. 3A). The HF group showed a larger cross-sectional area of adipocytes than the C group (+148%, Fig. 3B), indicating adipocyte hypertrophy. However, all treated groups exhibited a decreased cross-sectional area of adipocytes (−54% for HFW vs HF; −55% for HFL vs HF; and −75% for HFC vs HF, Fig. 3B). The HFC group exhibited adipocytes smaller than the C group due to abundant browning (−37%, Fig. 3B).
sWAT histology and immunohistochemistry for β3AR and UCP1 (A); cross-sectional area of sWAT adipocytes (B); UCP1 immunodensity (C). (A) Photomicrographs of s.c. white adipose tissue (sWAT) stained with hematoxylin-eosin showing hypertrophied adipocytes in the HF group and normal-sized white adipocytes intertwined with beige adipocytes in the HFC group. Representative images of β3AR immunostaining revealed a positive immunoreaction in the HFC group, reinforcing the abundant browning observed. UCP1 immunostaining followed the same pattern, and the immunodensity confirmed the enhanced UCP1 expression in the HFC group, suggesting increased thermogenesis. All scale bars = 50 μm. (B and C) Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated as follows: **P< 0.01; ***P< 0.001; ****P< 0.0001. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i). A full color version of this figure is available at https://doi.org/10.1530/JME-21-0084>.
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
sWAT histology and immunohistochemistry for β3AR and UCP1 (A); cross-sectional area of sWAT adipocytes (B); UCP1 immunodensity (C). (A) Photomicrographs of s.c. white adipose tissue (sWAT) stained with hematoxylin-eosin showing hypertrophied adipocytes in the HF group and normal-sized white adipocytes intertwined with beige adipocytes in the HFC group. Representative images of β3AR immunostaining revealed a positive immunoreaction in the HFC group, reinforcing the abundant browning observed. UCP1 immunostaining followed the same pattern, and the immunodensity confirmed the enhanced UCP1 expression in the HFC group, suggesting increased thermogenesis. All scale bars = 50 μm. (B and C) Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated as follows: **P< 0.01; ***P< 0.001; ****P< 0.0001. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i). A full color version of this figure is available at https://doi.org/10.1530/JME-21-0084>.
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
sWAT histology and immunohistochemistry for β3AR and UCP1 (A); cross-sectional area of sWAT adipocytes (B); UCP1 immunodensity (C). (A) Photomicrographs of s.c. white adipose tissue (sWAT) stained with hematoxylin-eosin showing hypertrophied adipocytes in the HF group and normal-sized white adipocytes intertwined with beige adipocytes in the HFC group. Representative images of β3AR immunostaining revealed a positive immunoreaction in the HFC group, reinforcing the abundant browning observed. UCP1 immunostaining followed the same pattern, and the immunodensity confirmed the enhanced UCP1 expression in the HFC group, suggesting increased thermogenesis. All scale bars = 50 μm. (B and C) Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated as follows: **P< 0.01; ***P< 0.001; ****P< 0.0001. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i). A full color version of this figure is available at https://doi.org/10.1530/JME-21-0084>.
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
To further confirm the browning phenomenon in sWAT, immunohistochemistry revealed a positive immunoreaction for β3-AR (thermogenesis initiator) in the HFC group (Fig. 3A). Moreover, the HFC group showed expression augmentation of the thermogenesis effector UCP1 compared to the HF (+468%), HFW (+768%), and HFL (+502%) groups (Fig. 3A and C).
The combined treatment was unique to counter BAT whitening
The BAT photomicrographs (Fig. 4A) show brown adipocytes that resemble unilocular white adipocytes in the HF group, and the whitening phenomenon contrasts with the multilocular brown adipocytes in the C group. The HF group showed increased BAT mass/g BM (+33%, Table 2) coupled with a marked reduction in the numerical density of nuclei per area (QA nuclei) in comparison with the C group (−50% Fig. 4B), consistent with the presence of large, unilocular adipocytes, in line with a whitening phenotype. The groups treated with the monotherapies had a mild whitening improvement, as both HFW and HFL showed plentiful whitened adipocytes within the BAT (Fig. 4A). The HFL group showed a significant reduction in BAT mass/g BM (−25% for HFL vs HF, Table 2), and the HFW group had a discrete increase in QA nuclei (+27% for HFW vs HF, Fig. 4B) but neither rescued brown adipocyte adverse remodeling. Conversely, only the HFC group showed multilocular adipocytes similar to the C group, without whitening (Fig. 4A). Of note, the HFC group had a lessened BAT mass/g BM (−24%, Table 2) coupled with greater QA nuclei than the HF group (+71%, Fig. 4B), suggesting a restoration of BAT cytoarchitecture after the combined treatment.
Brown adipose tissue histology (A); Numerical density of nuclei per area (QA [nuclei, BAT]) (B). Photomicrographs of interscapular brown adipose tissue stained with hematoxylin-eosin. We observed a reduced nuclear numerical density per area within the test area and white-like adipocytes (whitening) in the HF group compared to the C group. Additionally, the HFC group showed an increased density of nuclei compared to the HF group and an adipocyte multilocular appearance comparable to the C group, suggesting rescue from whitening. Brown-Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5/group). Significant differences (P< 0.05) are indicated as follows: *P< 0.05. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i). A full color version of this figure is available at https://doi.org/10.1530/JME-21-0084.
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
Brown adipose tissue histology (A); Numerical density of nuclei per area (QA [nuclei, BAT]) (B). Photomicrographs of interscapular brown adipose tissue stained with hematoxylin-eosin. We observed a reduced nuclear numerical density per area within the test area and white-like adipocytes (whitening) in the HF group compared to the C group. Additionally, the HFC group showed an increased density of nuclei compared to the HF group and an adipocyte multilocular appearance comparable to the C group, suggesting rescue from whitening. Brown-Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5/group). Significant differences (P< 0.05) are indicated as follows: *P< 0.05. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i). A full color version of this figure is available at https://doi.org/10.1530/JME-21-0084.
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
Brown adipose tissue histology (A); Numerical density of nuclei per area (QA [nuclei, BAT]) (B). Photomicrographs of interscapular brown adipose tissue stained with hematoxylin-eosin. We observed a reduced nuclear numerical density per area within the test area and white-like adipocytes (whitening) in the HF group compared to the C group. Additionally, the HFC group showed an increased density of nuclei compared to the HF group and an adipocyte multilocular appearance comparable to the C group, suggesting rescue from whitening. Brown-Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5/group). Significant differences (P< 0.05) are indicated as follows: *P< 0.05. Groups: C, control diet; HF, high-fat diet; HFW, high-fat diet plus WY14643 (PPAR-alpha agonist); HFL, high-fat diet plus linagliptin (DPP-4i); HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i). A full color version of this figure is available at https://doi.org/10.1530/JME-21-0084.
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
The HF group showed a higher RER than the C group (+8%, Table 2). In comparison, all treated groups exhibited a significant reduction in RER (−13% for HFW vs HF; −23% for HFL vs HF; and −10% for HFC vs HF, Table 2) without any difference from the C group.
Experiment 2: The combined treatment elicited UCP1+ beige adipocytes by countering ER stress and inflammation
The combined treatment enhanced body temperature and UCP1 expression in sWAT and normalized the adipokine profile
At the end of the treatment, the HFC rescued the BM without any difference compared to the C group and a significant reduction compared to the HF group (−11%, Fig. 5A). Interestingly, the CC group presented a lower BM than the C group (−3%, Fig. 5A). The BM reduction can be attributed to the treatment, as animals fed the same diet did not have different energy intakes (Fig. 5B).
Final body mass (A); energy intake (B); plasma leptin concentrations (C), plasma adiponectin concentrations (D); UCP1 immunofluorescence (upper panel), and infrared thermography (lower panel) (E). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences are indicated as follows: *P< 0.05; **P< 0.01; ***P< 0.001; ****P< 0.0001. Positive UCP1 areas appear green, showing positive immunoreactions for both treated groups and the absence of UCP1 expression in the HF group (upper panel). Infrared thermography showed increased body temperature in the treated groups (lower panel). Both results suggest increased thermogenesis after the treatment. Groups: C, control diet; CC, control diet plus WY14643 and linagliptin; HF, high-fat diet; HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i). A full color version of this figure is available at https://doi.org/10.1530/JME-21-0084.
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
Final body mass (A); energy intake (B); plasma leptin concentrations (C), plasma adiponectin concentrations (D); UCP1 immunofluorescence (upper panel), and infrared thermography (lower panel) (E). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences are indicated as follows: *P< 0.05; **P< 0.01; ***P< 0.001; ****P< 0.0001. Positive UCP1 areas appear green, showing positive immunoreactions for both treated groups and the absence of UCP1 expression in the HF group (upper panel). Infrared thermography showed increased body temperature in the treated groups (lower panel). Both results suggest increased thermogenesis after the treatment. Groups: C, control diet; CC, control diet plus WY14643 and linagliptin; HF, high-fat diet; HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i). A full color version of this figure is available at https://doi.org/10.1530/JME-21-0084.
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
Final body mass (A); energy intake (B); plasma leptin concentrations (C), plasma adiponectin concentrations (D); UCP1 immunofluorescence (upper panel), and infrared thermography (lower panel) (E). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences are indicated as follows: *P< 0.05; **P< 0.01; ***P< 0.001; ****P< 0.0001. Positive UCP1 areas appear green, showing positive immunoreactions for both treated groups and the absence of UCP1 expression in the HF group (upper panel). Infrared thermography showed increased body temperature in the treated groups (lower panel). Both results suggest increased thermogenesis after the treatment. Groups: C, control diet; CC, control diet plus WY14643 and linagliptin; HF, high-fat diet; HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i). A full color version of this figure is available at https://doi.org/10.1530/JME-21-0084.
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
The high BM found in the HF group complied with hyperleptinemia (+136% for HF vs C, Fig. 5C), while the combined treatment countered this metabolic impairment (−56% for HFC vs HF, Fig. 5C). In contrast, the adiponectin concentrations were lower in the HF group than in the C group (−16%, Fig. 5D), while the combined treatment increased the adiponectin levels in both treated groups when compared to their counterparts (+18% for CC vs C and +38% for HFC vs HF, Fig. 5D).
UCP1 showed positive immunostaining in both treated groups, confirming the presence of functional beige adipocytes in the sWAT of the CC and HFC groups (Fig. 5E). Moreover, the average body temperature increased significantly after the treatment (+3% for CC vs C and +2% for HFC vs HF, Fig. 5E), implying increased thermogenesis and energy release as heat.
PPAR-alpha agonism plus DDP4 inhibition induced thermogenic genes in sWAT
The relative mRNA expression of Ppar-alpha, which has thermogenic markers as its target genes, was lower in the HF group than in the C group (−50%, Fig. 6A) but it was higher in both treated groups than in their counterparts (+189% for CC vs C and +296% for HFC vs HF, Fig. 6A).
sWAT gene expression of Ppar-a(A), Pgc1-a(B), β3ar(C), Ucp1(D), Prdm16(E) and Bmp8b(F). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated as follows: *P< 0.05; **P< 0.01; ***P< 0.001. Groups: C, control diet; CC, control diet plus WY14643 and linagliptin; HF, high-fat diet; HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
sWAT gene expression of Ppar-a(A), Pgc1-a(B), β3ar(C), Ucp1(D), Prdm16(E) and Bmp8b(F). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated as follows: *P< 0.05; **P< 0.01; ***P< 0.001. Groups: C, control diet; CC, control diet plus WY14643 and linagliptin; HF, high-fat diet; HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
sWAT gene expression of Ppar-a(A), Pgc1-a(B), β3ar(C), Ucp1(D), Prdm16(E) and Bmp8b(F). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated as follows: *P< 0.05; **P< 0.01; ***P< 0.001. Groups: C, control diet; CC, control diet plus WY14643 and linagliptin; HF, high-fat diet; HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
The mitochondrial biogenesis regulator Pgc1-ahad reduced expression in the HF group (−74% for HF vs C, Fig. 6B). In contrast, the HFC group showed higher Pgc1-aexpression than the HF group (+430%, Fig. 6B). Significantly, the HFC group did not differ from the C group or the CC group.
β3-arexpression also increased in the HFC group (+396% for HFC vs HF, Fig. 6C), implying that the combined treatment activated thermogenesis in response to the beta-adrenergic stimulus. Consistent with this, the HF group had lower Ucp1expression than the C group (−69%, Fig. 6D), while the HFC group showed enhanced Ucp1 expression (+227% for HFC vs HF, Fig. 6D).
Prdm16,an essential gene to maintain the beige phenotype, had higher expression in the HFC group than in the HF and C groups (+478% and +122%, Fig. 6E). Bmp8b, a batokine involved in energy homeostasis, also had higher expression in the HFC group than in the HF group (+117%, Fig. 6F).
Treatment mitigated local inflammation within the sWAT
The relative mRNA expression of Dpp4 did not differ between the C and HF groups. However, the treatment caused a significant reduction in Dpp4 expression in the HFC group (−59% for HFC vs HF, Fig. 7A).
sWAT gene expression of Dpp4(A), Tlr4(B), Nlrp3(C), Atf4(D), Chop(E) and Gadd45(F). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated as follows: *P< 0.05; **P< 0.01; ***P< 0.001; ****P< 0.0001. Groups: C, control diet; CC, control diet plus WY14643 and linagliptin; HF, high-fat diet; HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
sWAT gene expression of Dpp4(A), Tlr4(B), Nlrp3(C), Atf4(D), Chop(E) and Gadd45(F). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated as follows: *P< 0.05; **P< 0.01; ***P< 0.001; ****P< 0.0001. Groups: C, control diet; CC, control diet plus WY14643 and linagliptin; HF, high-fat diet; HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
sWAT gene expression of Dpp4(A), Tlr4(B), Nlrp3(C), Atf4(D), Chop(E) and Gadd45(F). Brown–Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated as follows: *P< 0.05; **P< 0.01; ***P< 0.001; ****P< 0.0001. Groups: C, control diet; CC, control diet plus WY14643 and linagliptin; HF, high-fat diet; HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
Tlr4,a proinflammatory receptor, showed higher expression in the HF group than in the C group (+183%, Fig. 7B). Nevertheless, the combined treatment elicited reduced Tlr4 expression (−66%, for HFC vs HF, Fig. 7B), suggesting enhanced thermogenesis. The expression level of Tlr4 in the HFC group did not differ from that of the C group.
Similarly, Nlrp3, an inflammasome, showed higher expression in the HF group than in the C group (+197%, Fig. 7C). Conversely, the HFC group had a marked reduction in Nlrp3expression (−44% for HFC vs HF, Fig. 7C).
The treatment alleviated endoplasmic reticulum stress
The expression of Atf4, a transcription factor that regulates several genes involved in the UPR during ER stress, was augmented in the HF group compared with the C group (+61%, Fig. 7D). In contrast, the HFC group showed lower Atf4expression than the HF group (−34%, Fig. 7D).
Chop, a transcription factor that mediates apoptosis, followed the same pattern as Atf4: the HF group had higher expression than the C group (+91%, Fig. 7E), whereas the CC and HFC groups showed lower expression than their counterparts (−42% for CC vs C and -76% for HFC vs HF, Fig. 7E). Similarly, Gadd45 showed higher expression in the HF group than in the C group (+70%, Fig. 7F), parallel to lower values in the HFC group than in the HF group (-59%, Fig. 7F). These findings reinforce the beneficial effects of PPAR-alpha agonism and DPP4 inhibition association on ER function, attenuating the expression of genes linked to UPR and apoptosis.
PPAR-alpha agonism plus DDP4 inhibition caused the cellular metabolism to shift toward lipid oxidation
Cidea, whose expression correlates with fat accumulation in WAT, showed the lowest expression in the treated groups. However, only the HFC was significantly reduced (-46% for HFC vs HF, Fig. 8A). Likewise, Plin1,related to lipid droplet instability, showed significantly lower expression in the HFC group than in the HF group (-58%, Fig. 8B).
sWAT gene expression of Cidea(A), Plin1(B), Cpt1b (C) and Pdk4 (D). Brown-Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated as follows: *P< 0.05; **P< 0.01. Groups: C, control diet; CC, control diet plus WY14643 and linagliptin; HF, high-fat diet; HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
sWAT gene expression of Cidea(A), Plin1(B), Cpt1b (C) and Pdk4 (D). Brown-Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated as follows: *P< 0.05; **P< 0.01. Groups: C, control diet; CC, control diet plus WY14643 and linagliptin; HF, high-fat diet; HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
sWAT gene expression of Cidea(A), Plin1(B), Cpt1b (C) and Pdk4 (D). Brown-Forsythe and Welch one-way ANOVA and Dunnett T3 post hoctest (mean ± s.d., n = 5). Significant differences (P< 0.05) are indicated as follows: *P< 0.05; **P< 0.01. Groups: C, control diet; CC, control diet plus WY14643 and linagliptin; HF, high-fat diet; HFC, high-fat diet plus WY14643 (PPAR-alpha agonist) and linagliptin (DPP-4i).
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
The relative expression of Cpt1b, responsible for beta-oxidation in adipose tissue, was enhanced in the HFC group compared to the HF group (+128%, Fig. 8C). Furthermore, Pdk4 expression increased in the HFC group compared to the HF group (+64%, Fig. 8D). These findings suggested that lipids were the preferential fuel for thermogenesis induced by the treatment.
Two-way ANOVA
The treatment exerted the most significant influence on the final body mass, BAT/g BM, GLP1, insulin and adiponectin concentrations, cross-sectional sWAT adipocyte area, thermogenic genes (Ppar-a, Pgc1-a, Ucp1, Prdm16, Bmp8b), inflammatory and ER stress genes (Dpp4, Chop, Gadd45), lipolysis, beta-oxidation, and fuel preference-related genes (Plin1, Cidea, Cpt1b, Pdk4).
Diet was the most significant factor in determining energy intake, sWAT mass, body temperature, QA nuclei, thermogenic genes (β3ar), inflammasome genes (Nlrp3), and ER stress genes (Atf4). Both factors (diet and treatment) interact to exert the most significant influence on sWAT mass, AUC for OGTT, leptin concentrations, RER, and Tlr4 gene expression. The two-way ANOVA details are described in Table 3.
Detailed two-way ANOVA results.
| Parameters | Interaction | Treatment | Diet | |||
|---|---|---|---|---|---|---|
| % of total variance | P-value | % of total variance | P-value | % of total variance | P-value | |
| Final body mass | 37.44 | <0.0001 | 44.27 | <0.0001 | 14.23 | <0.0001 |
| Energy intake | 0.07 | 0.0023 | NS | 0.0268 | 99.56 | <0.0001 |
| sWAT | 32.38 | 0.0001 | 22.20 | 0.0006 | 25.71 | 0.0003 |
| eWAT | 22.39 | 0.0036 | 16.45 | 0.0099 | 30.37 | 0.0011 |
| BAT/g body mass | NS | 0.0642 | 28.15 | 0.0036 | 23.47 | 0.0067 |
| Body temperature | NS | 0.0828 | 11.45 | <0.0001 | 83.00 | <0.0001 |
| RER | 45.13 | <0.0001 | 28.88 | 0.0001 | 7.22 | 0.0246 |
| AUC for OGTT | 34.41 | <0.0001 | 23.67 | <0.0001 | 37.41 | <0.0001 |
| GLP1 | 18.89 | 0.0002 | 53.79 | <0.0001 | 14.60 | 0.0006 |
| Insulin | 23.27 | <0.0001 | 42.37 | <0.0001 | 21.15 | 0.0001 |
| Adiponectin | 8.952 | 0.0028 | 73.96 | <0.0001 | 5.53 | 0.0138 |
| Leptin | 29.98 | <0.0001 | 25.48 | <0.0001 | 37.54 | <0.0001 |
| sWAT adipocytes area | 37.64 | <0.0001 | 48.28 | <0.0001 | 13.85 | <0.0001 |
| QA nuclei (BAT) | NS | 0.0702 | 24.49 | <0.0001 | 58.50 | <0.0001 |
| Gene expression | ||||||
| Ppar-a | 13.32 | 0.0004 | 75.03 | <0.0001 | NS | 0.2050 |
| Pgc1-a | NS | 0.2254 | 32.20 | 0.0012 | 30.74 | 0.0015 |
| Β3ar | 24.30 | 0.0023 | 24.09 | 0.0024 | 21.78 | 0.0035 |
| Ucp1 | 25.48 | 0.0006 | 29.71 | 0.0003 | 22.43 | 0.001 |
| Prdm16 | NS | 0.2168 | 45.45 | <0.0001 | 31.55 | 0.0002 |
| Bmp8b | NS | 0.6562 | 67.22 | <0.0001 | 9.89 | 0.0176 |
| Dpp4 | NS | 0.9610 | 51.80 | 0.0006 | NS | 0.4302 |
| Tlr4 | 11.93 | 0.0230 | 12.88 | 0.0189 | 45.00 | 0.0002 |
| Nlrp3 | 60.51 | <0.0001 | 19.72 | 0.0002 | 5.48 | 0.0248 |
| Atf4 | 35.81 | 0.0003 | 26.73 | 0.0011 | 10.48 | 0.0240 |
| Chop | 8.31 | 0.0497 | 47.69 | 0.0001 | 14.49 | 0.0128 |
| Gadd45 | 18.88 | 0.0011 | 54.70 | <0.0001 | 7.40 | 0.0239 |
| Plin1 | NS | 0.2494 | 58.81 | <0.0001 | NS | 0.2952 |
| Cidea | NS | 0.3625 | 55.42 | 0.0003 | NS | 0.4660 |
| Cpt1b | 16.35 | 0.0098 | 46.24 | 0.0002 | NS | 0.0735 |
| Pdk4 | 17.62 | 0.0160 | 39.94 | 0.0009 | NS | 0.2455 |
The most powerful factor influencing total variance is in bold for each parameter. Whenever a factor or the interaction influence on the parameter was not significant, it is described as NS.
Discussion
The present findings showed that the HF diet for 17 weeks caused overweight, insulin resistance, white adipocyte hypertrophy, BAT whitening, increased proinflammatory and ER stress markers, and decreased thermogenesis. Both monotherapies (PPAR-alpha agonist or DPP-4 inhibitor) yielded a reduced body mass and better glucose tolerance. Even though the HFW and HFL white adipocytes exhibited a normal size, significant browning did not occur and BAT whitening persisted. Conversely, animals treated with a combination of PPAR-alpha agonist and DPP4i benefited showing a complete rescue of BM, glucose tolerance, white adipocyte size, and brown adipocyte multilocularity, in addition to inflammation and ER stress alleviation. Furthermore, these positive outcomes complied with UCP1+ beige adipocyte induction and small and multilocular brown adipocytes, confirming browning of sWAT and alleviation of BAT whitening.
Due to the diet’s high saturated fatty acid content, HF-fed mice developed an obesity phenotype with increased fat pad distribution in different compartments, as previously reported (Barbosa-da-Silva et al. 2012, de Oliveira Correia et al. 2019, Miranda et al. 2020). Monotherapy with the PPAR-alpha agonist caused significant weight loss, as previously shown in mouse models (Rachid et al. 2018, Miranda et al. 2020). However, monotherapy with linagliptin and the combined treatment rescued the body mass in the present study. These effects on body mass can be attributed to the treatment since the treated groups’ food intake did not differ from their counterparts during the treatment phase.
HF rodents show a disrupted adipoinsular axis, with hyperinsulinemia and hyperleptinemia (Kieffer & Habener 2000). This scenario complies with their increased adipocyte cross-sectional area and their poor performance on the OGTT, with a significant AUC and oral glucose intolerance. Monotherapies with WY14643 or linagliptin alleviated oral glucose intolerance and adipocyte hypertrophy but did not revert the adipoinsular axis disruption or induce browning of sWAT. Conversely, the combined treatment restored the adipoinsular axis function and normalized the plasma insulin and leptin concentrations, as reflected by their standard-sized white adipocytes and robust browning induction in the sWAT, associated with metabolic benefits (Gray et al. 2010, Bartelt & Heeren 2014).
Only the combined treatment produced increased plasma total GLP-1 concentrations, which potentialize glucose-stimulated insulin secretion concomitant with glucagon inhibition (Drucker & Nauck 2006, Campbell & Drucker 2013). Interestingly, HFL and HFC showed similar performances on OGTT, but HFL had higher insulin concentrations than HFC. These results imply that although this dose of linagliptin (15 mg/kg body mass) for 5 weeks did not increase the total GLP1 concentration like the high dose (Santos et al. 2020), it increased insulin release in the HFL group. The HFC group may benefit from a possible additive effect of PPAR-alpha activation increasing the total GLP1 levels (Silva-Veiga et al. 2020) suggesting that this combined treatment is a promising approach to treat obesity by maximizing the insulin-sensitizing and anti-inflammatory effects of both agents (Zhuge et al. 2016, Takahashi et al. 2017), resulting in increased thermogenesis.
A stereological tool aimed to address brown adipocyte dysfunction (whitening) for the first time, along with metabolic data. Chronic HF feeding caused enlargement of brown adipocytes with whitened unilocular adipocytes resulting in a decreased numerical density of nuclei per tissue area. BAT whitening is triggered by proinflammatory signals and hypoxia, causing mitochondrial loss, and reducing BAT thermogenic function (Shimizu et al. 2014). Monotherapy with WY14643 increased BAT nuclei density, but it was not enough to rescue BAT whitening. In contrast, the combined treatment elicited an increased BAT nuclei density, equal to the C group, consistent with small brown adipocytes, a restoration of their multilocular characteristics, and the competence to perform thermogenesis. Furthermore, the increased body temperature and adiponectin concentrations in animals treated with the combined therapy agree with these results, suggesting energy dissipation as heat due to enhanced BAT activity (Spiegelman 2013, Sun et al. 2020).
Concerning the sWAT reservoir, only the sWAT of the HFC group expressed β3AR and UCP1, ensuring that the browning phenomenon occurred. The thermogenic pathway in sWAT relies on sympathetic stimulation for initiation, and UCP1 acts as an alternative channel to proton gradient return from the mitochondrial intermembrane space, uncoupling energy utilization from ATP synthesis and releasing energy as heat instead (Spiegelman 2013, Ricquier 2017). To further explore the browning phenomenon observed in the HFC group, immunofluorescence confirmed the observed multilocular adipocytes as UCP1+, in addition to β3-arand Ucp1 upregulation coupled with increased Bmp8b implying a greater sWAT thermogenic responsiveness to the adrenergic stimulus (Whittle et al. 2012).
It is noteworthy that the temperature used in the present study cannot induce browning of sWAT itself (Kalinovich et al. 2017) and that the browning phenomenon is reversible, with increased Prdm16 expression being necessary to maintain the beige phenotype (Cohen et al. 2014). The combined treatment yielded the most pronounced Prdm16 expression supporting the hypothesis that this drug combination induced beige adipocytes competent to perform thermogenesis (Nedergaard et al. 2007).
Regarding cellular metabolism, the WAT of obese and insulin-resistant mice benefits from Pdk4 upregulation (Wan et al. 2012), which means inhibition of glucose uptake by the cells (White et al. 2007). Thus, the high Pdk4expression complied with lipid utilization as fuel to the beige adipocytes induced by the combined treatment in HF-fed animals. However, the Pdk4 pathway in adipose tissue from HF-fed rodents is not like that in adipose tissue from lean rodents (Zhang et al. 2014). Increased adrenergic stimulation and PPAR-alpha activation by WY14643 can induce Pdk4 in white adipose tissue and emerge as a surrogate of sWAT browning (Huang et al. 2002, Zhang et al. 2014). In agreement with the preference for lipids as fuel for thermogenesis, the HFC group showed Plin1 and Cideadownregulation, implying more stability (Sztalryd et al. 2003) and smaller lipid droplets (Barneda et al. 2013, Chen et al. 2020) within the observed beige adipocytes. These observations suggest that lipid overload from the HF diet supplied cell metabolism in the sWAT.
Linagliptin association with a PPAR-alpha agonist is promising, as both mechanisms of action may overlap and interact. Recently, mice fed a high-fructose diet and treated with WY14643 showed increased GLP1 concentrations (Silva-Veiga et al. 2020) implying that PPAR-alpha anti-inflammatory effects can also trigger DPP4 inhibition (Takahashi et al. 2017). On the other hand, DPP4 inhibition by a high dose of linagliptin provoked browning in sWAT through PPAR-alpha induction (de Oliveira Correia et al. 2019). This transcription factor has many thermogenic markers as target genes (Hondares et al. 2011). Hence, the present results endorse this challenging combination as suitable to treat obesity in this experimental model by combining the highest Ppar-alphaexpression and GLP1 concentrations parallel to the lowest Dpp4and Tlr4 in the sWAT.
The PPAR-alpha agonist combined with DPP4i normalized Pgc1α expression in the HF-treated group, resembling the C and CC groups. This result indicates increased mitochondrial biogenesis, a viable strategy to counter obesity by sustaining the new beige adipocyte physiology favoring thermogenesis over lipogenesis (Tiraby et al. 2003, Puigserver 2005). Anti-inflammatory effects also mediated the present findings. This drug combination has previously been shown to counter endotoxemia by rescuing the gut ultrastructure and mitigating hepatic steatosis via reduced TLR4 expression in the liver of high-fructose-fed mice (Silva-Veiga et al. 2020). Previous findings indicate that linagliptin inhibits lipopolysaccharide-induced inflammation, causing TLR4 suppression (Sato et al. 2019) in addition to yielding cardioprotective effects by attenuating inflammasomes (Birnbaum et al. 2019). The combined treatment has driven similar findings in sWAT, showing reduced Dpp4 expression, an adipokine involved in obesity metainflammation (Lamers et al. 2011). The reduced Dpp4 and Tlr4expression levels comply with Nlrp3 downregulation in sWAT, which protects UCP1 and favors beta-adrenergic stimulated beige adipocyte formation (Okla et al. 2018).
On the other hand, Tlr4 induction by an HF diet blocks the browning of sWAT through mitochondrial functional impairment and inflammasome activation, which reduces Ucp1 in a paracrine fashion (Okla et al. 2018). Chronic HF diet intake triggers glucolipotoxicity by driving ectopic lipid accumulation (lipotoxicity) concomitant with hyperglycemia (glucotoxicity) (Veiga et al. 2017). These conditions underlie ER stress, as this organelle uses glucose as the primary fuel. ER stress, in turn, aggravates inflammation and triggers apoptosis (Hummasti & Hotamisligil 2010). When ER homeostasis is compromised, UPR activation aims to counter ER stress (Zhao et al. 2013). Herein, a chronic HF diet intake caused inflammation through Tlr4 and Nlrp3,followed by increased expression of UPR genes. Atf4 is a transcription factor that regulates other UPR genes, such as Chop(Fusakio et al. 2016), blocking the cell cycle by Gadd45 transcription (Oyadomari & Mori 2004). Atf4, Chop,and Gadd45upregulation in the HF group aimed to protect the adipocytes from the UPR toxic effects (Galligan et al. 2012), consistent with the results of a previous study that used an HF diet (40% energy as fat) for 12 weeks (Luo et al. 2016). Instead, the combined treatment managed to suppress the UPR-related genes, alleviating ER stress, complying with better insulin sensitivity and mitochondrial enhancement toward the beige phenotype in sWAT. Figure 9 summarizes the main results from the present study.
Summary of the main findings. The HF diet caused white adipocyte hypertrophy coupled with whitening of brown adipocytes. Obesity and insulin resistance cause endoplasmic reticulum stress, inflammation, and impaired thermogenesis. Conversely, the conjugation of PPAR-alpha agonism with DPP-4 inhibition reversed brown adipocyte whitening, inflammation, and ER stress in s.c. white adipose tissue, resulting in the induction of beige adipocytes and enhanced thermogenesis. These results complied with the normalization of body mass in treated animals fed a high-fat diet. A full color version of this figure is available at https://doi.org/10.1530/JME-21-0084.
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
Summary of the main findings. The HF diet caused white adipocyte hypertrophy coupled with whitening of brown adipocytes. Obesity and insulin resistance cause endoplasmic reticulum stress, inflammation, and impaired thermogenesis. Conversely, the conjugation of PPAR-alpha agonism with DPP-4 inhibition reversed brown adipocyte whitening, inflammation, and ER stress in s.c. white adipose tissue, resulting in the induction of beige adipocytes and enhanced thermogenesis. These results complied with the normalization of body mass in treated animals fed a high-fat diet. A full color version of this figure is available at https://doi.org/10.1530/JME-21-0084.
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
Summary of the main findings. The HF diet caused white adipocyte hypertrophy coupled with whitening of brown adipocytes. Obesity and insulin resistance cause endoplasmic reticulum stress, inflammation, and impaired thermogenesis. Conversely, the conjugation of PPAR-alpha agonism with DPP-4 inhibition reversed brown adipocyte whitening, inflammation, and ER stress in s.c. white adipose tissue, resulting in the induction of beige adipocytes and enhanced thermogenesis. These results complied with the normalization of body mass in treated animals fed a high-fat diet. A full color version of this figure is available at https://doi.org/10.1530/JME-21-0084.
Citation: Journal of Molecular Endocrinology 68, 4; 10.1530/JME-21-0084
This study has some limitations, as we could not evaluate gene expression in BAT due to a limited sample. We plan to establish a new stereological tool to address BAT whitening. Therefore, future research may focus on the pathways related to BAT whitening alleviation, in addition to evaluating the active GLP1 and high molecular weight adiponectin concentrations.
Conclusion
In conclusion, a PPAR-alpha agonist and DPP-4i combination were necessary to drive expressive browning in the sWAT of high-fat-fed mice as the monotherapies did not elicit browning. In BAT, the combined treatment yielded an increased nuclear density and a restoration of multilocularity suggesting the measurement of nuclei density as a complementary tool to address whitening. The present results point to a browning stimulation parallel to a complete whitening alleviation after combining a PPAR-alpha agonist with a DPP-4i treatment suggesting promising anti-obesity effects of the proposed treatment. Furthermore, this combined treatment rescued inflammation and ER stress in the sWAT, increasing thermogenesis fueled by excessive dietary lipids in the induced beige adipocytes.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brasil (CAPES – Finance Code 001), Fundação Carlos Chagas Filho de Amparo à Pesquisa do Rio de Janeiro (FAPERJ, Grant numbers: E-26/202.657/2018, and E-26/010.002136/2019 to V S-M; E-26/202.935/2017, E-26/010.001274/2016 and E-26/010.100947/2018 to C A M L), and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq, Grant number 303785/2020-9 to V S-M, and 302.920/2016-1 and 40.60.81/2018-2 to C A M L).
Author contribution statement
D A S-O and A S-F: conceptualization, methodology, formal analysis, investigation, writing – original draft, project administration. C S M and F F M: formal analysis, investigation, visualization, writing – review and editing. C A M-L: writing – review and editing, visualization, funding acquisition. V S-M: conceptualization, supervision, visualization, writing – review and editing, methodology, funding acquisition.
Acknowledgements
The authors would like to thank MS Aline Penna for her technical assistance and Professor Milena Barcza for donating the animals for this study.
References
Barbosa-da-Silva S, Fraulob-Aquino JC, Lopes JR, Mandarim-de-Lacerda CA & Aguila MB 2012 Weight cycling enhances adipose tissue inflammatory responses in male mice. PLoS ONE 7 e39837. (https://doi.org/10.1371/journal.pone.0039837)
Bargut TC, Souza-Mello V, Mandarim-de-Lacerda CA & Aguila MB 2016 Fish oil diet modulates epididymal and inguinal adipocyte metabolism in mice. Food and Function 7 1468–1476. (https://doi.org/10.1039/c5fo00909j)
Barneda D, Frontini A, Cinti S & Christian M 2013 Dynamic changes in lipid droplet-associated proteins in the ‘browning’ of white adipose tissues. Biochimica et Biophysica Acta 1831 924–933. (https://doi.org/10.1016/j.bbalip.2013.01.015)
Bartelt A & Heeren J 2014 Adipose tissue browning and metabolic health. Nature Reviews: Endocrinology 10 24–36. (https://doi.org/10.1038/nrendo.2013.204)
Birnbaum Y, Tran D, Bajaj M & Ye Y 2019 DPP-4 inhibition by linagliptin prevents cardiac dysfunction and inflammation by targeting the Nlrp3/ASC inflammasome. Basic Research in Cardiology 114 35. (https://doi.org/10.1007/s00395-019-0743-0)
Campbell JE & Drucker DJ 2013 Pharmacology, physiology, and mechanisms of incretin hormone action. Cell Metabolism 17 819–837. (https://doi.org/10.1016/j.cmet.2013.04.008)
Chen FJ, Yin Y, Chua BT & Li P 2020 CIDE family proteins control lipid homeostasis and the development of metabolic diseases. Traffic 21 94–105. (https://doi.org/10.1111/tra.12717)
Cohen P, Levy JD, Zhang Y, Frontini A, Kolodin DP, Svensson KJ, Lo JC, Zeng X, Ye L & Khandekar MJ et al.2014 Ablation of PRDM16 and beige adipose causes metabolic dysfunction and a subcutaneous to visceral fat switch. Cell 156 304–316. (https://doi.org/10.1016/j.cell.2013.12.021)
Davisson MT 1994 Rules and guidelines for nomenclature of mouse genes. International Committee on standardized genetic nomenclature for mice. Gene 147 157–160. (https://doi.org/10.1016/0378-1119(9490060-4)
de Oliveira Correia BR, Rachid TL, de Oliveira Glauser JS, Martins FF, Mandarim-de-Lacerda CA & Souza-Mello V 2019 High dose of linagliptin induces thermogenic beige adipocytes in the subcutaneous white adipose tissue in diet-induced obese C57BL/6 mice. Endocrine 65 252–262. (https://doi.org/10.1007/s12020-019-01969-y)
Drucker DJ & Nauck MA 2006 The incretin system: glucagon-like peptide-1 receptor agonists and dipeptidyl peptidase-4 inhibitors in type 2 diabetes. Lancet 368 1696–1705. (https://doi.org/10.1016/S0140-6736(0669705-5)
Fernandes-da-Silva A, Miranda CS, Santana-Oliveira DA, Oliveira-Cordeiro B, Rangel-Azevedo C, Silva-Veiga FM, Martins FF & Souza-Mello V 2021 Endoplasmic reticulum stress as the basis of obesity and metabolic diseases: focus on adipose tissue, liver, and pancreas. European Journal of Nutrition 60 2949–2960. (https://doi.org/10.1007/s00394-021-02542-y)
Fusakio ME, Willy JA, Wang Y, Mirek ET, Al Baghdadi RJ, Adams CM, Anthony TG & Wek RC 2016 Transcription factor ATF4 directs basal and stress-induced gene expression in the unfolded protein response and cholesterol metabolism in the liver. Molecular Biology of the Cell 27 1536–1551. (https://doi.org/10.1091/mbc.E16-01-0039)
Galligan JJ, Smathers RL, Shearn CT, Fritz KS, Backos DS, Jiang H, Franklin CC, Orlicky DJ, Maclean KN & Petersen DR 2012 Oxidative stress and the ER stress response in a murine model for early-stage alcoholic liver disease. Journal of Toxicology 2012 207594. (https://doi.org/10.1155/2012/207594)
Gray SL, Donald C, Jetha A, Covey SD & Kieffer TJ 2010 Hyperinsulinemia precedes insulin resistance in mice lacking pancreatic beta-cell leptin signaling. Endocrinology 151 4178–4186. (https://doi.org/10.1210/en.2010-0102)
Gundersen HJG 1977 Notes on the estimation of the numerical density of arbitrary profiles: the edge effect. Journal of Microscopy 111 219–223. (https://doi.org/10.1111/j.1365-2818.1977.tb00062.x)
Gustafson B & Smith U 2015 Regulation of white adipogenesis and its relation to ectopic fat accumulation and cardiovascular risk. Atherosclerosis 241 27–35. (https://doi.org/10.1016/j.atherosclerosis.2015.04.812)
Hondares E, Rosell M, Diaz-Delfin J, Olmos Y, Monsalve M, Iglesias R, Villarroya F & Giralt M 2011 Peroxisome proliferator-activated receptor alpha (PPARalpha) induces PPARgamma coactivator 1alpha (PGC-1alpha) gene expression and contributes to thermogenic activation of brown fat: involvement of PRDM16. Journal of Biological Chemistry 286 43112–43122. (https://doi.org/10.1074/jbc.M111.252775)
Huang B, Wu P, Bowker-Kinley MM & Harris RA 2002 Regulation of pyruvate dehydrogenase kinase expression by peroxisome proliferator-activated receptor-alpha ligands, glucocorticoids, and insulin. Diabetes 51 276–283. (https://doi.org/10.2337/diabetes.51.2.276)
Hummasti S & Hotamisligil GS 2010 Endoplasmic reticulum stress and inflammation in obesity and diabetes. Circulation Research 107 579–591. (https://doi.org/10.1161/CIRCRESAHA.110.225698)
Kalinovich AV, De Jong JM, Cannon B & Nedergaard J 2017 UCP1 in adipose tissues: two steps to full browning. Biochimie 134 127–137. (https://doi.org/10.1016/j.biochi.2017.01.007)
Kern M, Kloting N, Niessen HG, Thomas L, Stiller D, Mark M, Klein T & Bluher M 2012 Linagliptin improves insulin sensitivity and hepatic steatosis in diet-induced obesity. PLoS ONE 7 e38744. (https://doi.org/10.1371/journal.pone.0038744)
Kieffer TJ & Habener JF 2000 The adipoinsular axis: effects of leptin on pancreatic beta-cells. American Journal of Physiology: Endocrinology and Metabolism 278 E1–E14. (https://doi.org/10.1152/ajpendo.2000.278.1.E1)
Kotzbeck P, Giordano A, Mondini E, Murano I, Severi I, Venema W, Cecchini MP, Kershaw EE, Barbatelli G & Haemmerle G et al.2018 Brown adipose tissue whitening leads to brown adipocyte death and adipose tissue inflammation. Journal of Lipid Research 59 784–794. (https://doi.org/10.1194/jlr.M079665)
Lamers D, Famulla S, Wronkowitz N, Hartwig S, Lehr S, Ouwens DM, Eckardt K, Kaufman JM, Ryden M & Muller S et al.2011 Dipeptidyl peptidase 4 is a novel adipokine potentially linking obesity to the metabolic syndrome. Diabetes 60 1917–1925. (https://doi.org/10.2337/db10-1707)
Li P, Zhu Z, Lu Y & Granneman JG 2005 Metabolic and cellular plasticity in white adipose tissue II: role of peroxisome proliferator-activated receptor-alpha. American Journal of Physiology: Endocrinology and Metabolism 289 E617–E626. (https://doi.org/10.1152/ajpendo.00010.2005)
Luo Y, Burrington CM, Graff EC, Zhang J, Judd RL, Suksaranjit P, Kaewpoowat Q, Davenport SK, O’Neill AM & Greene MW 2016 Metabolic phenotype and adipose and liver features in a high-fat Western diet-induced mouse model of obesity-linked NAFLD. American Journal of Physiology: Endocrinology and Metabolism 310 E418–E439. (https://doi.org/10.1152/ajpendo.00319.2015)
Mandarim-de-Lacerda CA 2003 Stereological tools in biomedical research. Anais da Academia Brasileira de Ciências 75 469–486. (https://doi.org/10.1590/s0001-37652003000400006)
Miranda CS, Silva-Veiga F, Martins FF, Rachid TL, Mandarim-de-Lacerda CA & Souza-Mello V 2020 PPAR-α activation counters brown adipose tissue whitening: a comparative study between high-fat- and high-fructose-fed mice. Nutrition 78 110791. (https://doi.org/10.1016/j.nut.2020.110791)
Nedergaard J, Bengtsson T & Cannon B 2007 Unexpected evidence for active brown adipose tissue in adult humans. American Journal of Physiology: Endocrinology and Metabolism 293 E444–E452. (https://doi.org/10.1152/ajpendo.00691.2006)
Okla M, Zaher W, Alfayez M & Chung S 2018 Inhibitory effects of toll-like receptor 4, NLRP3 inflammasome, and interleukin-1β on white adipocyte browning. Inflammation 41 626–642. (https://doi.org/10.1007/s10753-017-0718-y)
Oyadomari S & Mori M 2004 Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death and Differentiation 11 381–389. (https://doi.org/10.1038/sj.cdd.4401373)
Penna-de-Carvalho A, Graus-Nunes F, Rabelo-Andrade J, Mandarim-de-Lacerda CA & Souza-Mello V 2014 Enhanced pan-peroxisome proliferator-activated receptor gene and protein expression in adipose tissue of diet-induced obese mice treated with telmisartan. Experimental Physiology 99 1663–1678. (https://doi.org/10.1113/expphysiol.2014.081596)
Poekes L, Legry V, Schakman O, Detrembleur C, Bol A, Horsmans Y, Farrell GC & Leclercq IA 2017 Defective adaptive thermogenesis contributes to metabolic syndrome and liver steatosis in obese mice. Clinical Science 131 285–296. (https://doi.org/10.1042/CS20160469)
Puigserver P 2005 Tissue-specific regulation of metabolic pathways through the transcriptional coactivator PGC1-alpha. International Journal of Obesity 29 (Supplement 1) S5–S9. (https://doi.org/10.1038/sj.ijo.0802905)
Rachid TL, Silva-Veiga FM, Graus-Nunes F, Bringhenti I, Mandarim-de-Lacerda CA & Souza-Mello V 2018 Differential actions of PPAR-α and PPAR-β/δ on beige adipocyte formation: a study in the subcutaneous white adipose tissue of obese male mice. PLoS ONE 13 e0191365. (https://doi.org/10.1371/journal.pone.0191365)
Reeves PG, Nielsen FH & Fahey Jr GC 1993 AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. Journal of Nutrition 123 1939–1951. (https://doi.org/10.1093/jn/123.11.1939)
Ricquier D 2017 UCP1, the mitochondrial uncoupling protein of brown adipocyte: a personal contribution and a historical perspective. Biochimie 134 3–8. (https://doi.org/10.1016/j.biochi.2016.10.018)
Santos FO, Correia BRO, Marinho TS, Barbosa-da-Silva S, Mandarim-de-Lacerda CA & Souza-Mello V 2020 Anti-steatotic linagliptin pleiotropic effects encompasses suppression of de novo lipogenesis and ER stress in high-fat-fed mice. Molecular and Cellular Endocrinology 509 110804. (https://doi.org/10.1016/j.mce.2020.110804)
Saponaro C, Gaggini M, Carli F & Gastaldelli A 2015 The subtle balance between lipolysis and lipogenesis: a critical point in metabolic homeostasis. Nutrients 7 9453–9474. (https://doi.org/10.3390/nu7115475)
Sato N, Nakamura Y, Yamadera S, Inagaki M, Kenmotsu S, Saito H, Oguchi T, Tsuji M, Chokki H & Ohsawa I et al.2019 Linagliptin inhibits lipopolysaccharide-induced inflammation concentration-dependently and -independently. Journal of Inflammation Research 12 285–291. (https://doi.org/10.2147/JIR.S221761)
Seale P 2015 Transcriptional regulatory circuits controlling brown fat development and activation. Diabetes 64 2369–2375. (https://doi.org/10.2337/db15-0203)
Shimizu I, Aprahamian T, Kikuchi R, Shimizu A, Papanicolaou KN, Maclauchlan S, Maruyama S & Walsh K 2014 Vascular rarefaction mediates whitening of brown fat in obesity. Journal of Clinical Investigation 124 2099–2112. (https://doi.org/10.1172/JCI71643)
Silva-Veiga FM, Miranda CS, Martins FF, Daleprane JB, Mandarim-de-Lacerda CA & Souza-Mello V 2020 Gut-liver axis modulation in fructose-fed mice: a role for PPAR-alpha and linagliptin. Journal of Endocrinology 247 11–24. (https://doi.org/10.1530/JOE-20-0139)
Souza-Mello V 2015 Peroxisome proliferator-activated receptors as targets to treat non-alcoholic fatty liver disease. World Journal of Hepatology 7 1012–1019. (https://doi.org/10.4254/wjh.v7.i8.1012)
Spiegelman BM 2013 Banting Lecture 2012: regulation of adipogenesis: toward new therapeutics for metabolic disease. Diabetes 62 1774–1782. (https://doi.org/10.2337/db12-1665)
Strissel KJ, Stancheva Z, Miyoshi H, Perfield JW 2nd, DeFuria J, Jick Z, Greenberg AS & Obin MS 2007 Adipocyte death, adipose tissue remodeling, and obesity complications. Diabetes 56 2910–2918. (https://doi.org/10.2337/db07-0767)
Sun L, Yan J, Goh HJ, Govindharajulu P, Verma S, Michael N, Sadananthan SA, Henry CJ, Velan SS & Leow MK 2020 Fibroblast growth factor-21, leptin, and adiponectin responses to acute cold-induced brown adipose tissue activation. Journal of Clinical Endocrinology and Metabolism 105 e520–e531. (https://doi.org/10.1210/clinem/dgaa005)
Sztalryd C, Xu G, Dorward H, Tansey JT, Contreras JA, Kimmel AR & Londos C 2003 Perilipin A is essential for the translocation of hormone-sensitive lipase during lipolytic activation. Journal of Cell Biology 161 1093–1103. (https://doi.org/10.1083/jcb.200210169)
Takahashi H, Sanada K, Nagai H, Li Y, Aoki Y, Ara T, Seno S, Matsuda H, Yu R & Kawada T et al.2017 Over-expression of PPARα in obese mice adipose tissue improves insulin sensitivity. Biochemical and Biophysical Research Communications 493 108–114. (https://doi.org/10.1016/j.bbrc.2017.09.067)
Tiraby C, Tavernier G, Lefort C, Larrouy D, Bouillaud F, Ricquier D & Langin D 2003 Acquirement of brown fat cell features by human white adipocytes. Journal of Biological Chemistry 278 33370–33376. (https://doi.org/10.1074/jbc.M305235200)
Tschanz SA, Burri PH & Weibel ER 2011 A simple tool for stereological assessment of digital images: the STEPanizer. Journal of Microscopy 243 47–59. (https://doi.org/10.1111/j.1365-2818.2010.03481.x)
Veiga FMS, Graus-Nunes F, Rachid TL, Barreto AB, Mandarim-de-Lacerda CA & Souza-Mello V 2017 Anti-obesogenic effects of Wy14643 (PPAR-alpha agonist): hepatic mitochondrial enhancement and suppressed lipogenic pathway in diet-induced obese mice. Biochimie 140 106–116. (https://doi.org/10.1016/j.biochi.2017.07.003)
Wan Z, Frier BC, Williams DB & Wright DC 2012 Epinephrine induces PDK4 mRNA expression in adipose tissue from obese, insulin resistant rats. Obesity 20 453–456. (https://doi.org/10.1038/oby.2011.252)
White UA, Coulter AA, Miles TK & Stephens JM 2007 The STAT5A-mediated induction of pyruvate dehydrogenase kinase 4 expression by prolactin or growth hormone in adipocytes. Diabetes 56 1623–1629. (https://doi.org/10.2337/db06-1286)
Whittle AJ, Carobbio S, Martins L, Slawik M, Hondares E, Vázquez MJ, Morgan D, Csikasz RI, Gallego R & Rodriguez-Cuenca S et al.2012 BMP8B increases brown adipose tissue thermogenesis through both central and peripheral actions. Cell 149 871–885. (https://doi.org/10.1016/j.cell.2012.02.066)
Zhang S, Hulver MW, Mcmillan RP, Cline MA & Gilbert ER 2014 The pivotal role of pyruvate dehydrogenase kinases in metabolic flexibility. Nutrition and Metabolism 11 10. (https://doi.org/10.1186/1743-7075-11-10)
Zhao M, Zang B, Cheng M, Ma Y, Yang Y & Yang N 2013 Differential responses of hepatic endoplasmic reticulum stress and inflammation in diet-induced obese rats with high-fat diet rich in lard oil or soybean oil. PLoS ONE 8 e78620. (https://doi.org/10.1371/journal.pone.0078620)
Zhuge F, Ni Y, Nagashimada M, Nagata N, Xu L, Mukaida N, Kaneko S & Ota T 2016 DPP-4 inhibition by linagliptin attenuates obesity-related inflammation and insulin resistance by regulating M1/M2 macrophage polarization. Diabetes 65 2966–2979. (https://doi.org/10.2337/db16-0317)
