Abstract
Vascular endothelial growth factor (VEGF) plays a pivotal role in angiogenesis in ovaries, particularly during follicular development and ovulation. Interleukin-6 (IL-6) is one of the major pro-inflammatory factors that are involved in the angiogenesis process physiologically and pathologically. Previous studies have shown that 17β-estradiol (E2) stimulates VEGF expression by upregulating hypoxia-inducible factor 1α (HIF-1α) in many cell types, and the high level of E2 causes an inflammatory-like microenvironment before ovulation. However, whether IL-6 signaling is involved in E2-regulating VEGF expression in swine granulosa cells (GCs) is still unknown. In this study, we found the estrogen membrane receptor, G-protein-coupled estrogen receptor 1 (GPER), was expressed in swine GCs, and the expression level of GPER, HIF-1α, and VEGF increased with follicular development. In vitro study showed that E2, ICI182780, and GPER agonist (G1) promoted the expressions of HIF-1α and VEGF in swine GCs, while GPER antagonist (G15) inhibited the stimulating effect of E2 and G1. Meanwhile, G15 inhibited the stimulating effect of E2 and G1 on IL-6 mRNA expression and secretion. Furthermore, IL-6 antibody and AG490 (JAK2/STAT3 inhibitor) attenuated G1-induced HIF-1α and VEGF expression. In conclusion, this study revealed how estrogen-induced HIF-1α and VEGF expressions in swine GCs are mediated through GPER-derived IL-6 secretion leading to JAK2/STAT3 activation.
Introduction
Ovarian follicular development depends on the establishment and continuous remodeling of the vascular system, which enables the follicles to receive the required supply of nutrients, oxygen, and hormone support (Devesa & Caicedo 2019). As a heparin-binding double-chain glycoprotein, vascular endothelial growth factor (VEGF) is one of the most important angiogenesis-inducing factors and of the necessary conditions for the progression of large preantral follicles toward the antral stage (Araújo et al. 2011, Nishigaki et al. 2011). There are two main sources of VEGF in the female reproductive system (Yan et al. 1993, Charnock-Jones et al. 2001), namely granulosa cells (GCs) and macrophages. In addition to promoting follicular development for angiogenesis, VEGF can also promote GCs proliferation and steroid hormone synthesis and inhibit apoptosis according to increasing evidence (Grasselli et al. 2002, Greenaway et al. 2004, Irusta et al. 2010). Meanwhile, it has been demonstrated that VEGF is present at a high expression level in swine (Barboni et al. 2000, Shimizu et al. 2002, Sant’Ana et al. 2015) and human (Gordon et al. 1996) GCs before ovulation and increases prostaglandin synthesis leading to ovulation in human (Trau et al. 2016).
Hypoxia is the primary regulator of neoangiogenesis through the activation of hypoxia-inducible factor (HIF)-1α, a highly conserved transcription factor that regulates a number of proangiogenic genes, including VEGF (Tirpe et al. 2019). Moreover, it has been demonstrated that gonadotropins (LH and FSH) (Guimerà et al. 2009, Yang et al. 2017, Devesa & Caicedo 2019) and steroid hormones (including androgens, estrogens, and progesterone) (Shimizu & Miyamoto 2007, Shimizu et al. 2007, Nichols et al. 2019) can activate HIF-1α/VEGF signaling in GCs. 17β-estradiol (E2), the most powerful estrogen, is mainly synthesized in preovulatory GCs and generally plays its role in genomic effect in combination with the classical nuclear receptors, including estrogen receptor-(ER)-α and ERβ (Hamilton et al. 2017, Tang et al. 2019). However, the potential of all the physiological functions of estrogens remains to be elucidated. In addition to the well-established genomic pathway, E2 also exerts rapid and transcription-independent signaling through the estrogen membrane receptor G protein-coupled receptor 1 (GPER), which has been detected in humans (Heublein et al. 2012) and goat (Zhang et al. 2019) GCs and oocytes in ovaries.
High steroidogenic and metabolic demands characterize developing follicles, and an inflammatory-like process may occur as a result (Duffy et al. 2019). Interleukin-6 (IL-6), an important pro-inflammatory factor, mainly originates from GCs and immune cells recruited in follicles (Machelon et al. 1994, Keck et al. 1998). Besides inducing inflammatory reaction, IL-6 may also serve as an important regulatory molecule in both physiologic and pathologic angiogenesis (Kumari et al. 2016). IL-6 exerts its effects by binding to IL-6α chain and gp130, a common cytokine receptor signal-transducing subunit which leads to the activation of the Janus kinases (JAKs) family of tyrosine kinases and also signal transduction and transcriptional activators (STATs) family, particularly STAT3 (Hunter & Jones 2015, Abid et al. 2020). Moreover, STAT3, as an essential mediator of VEGF transcription by directly binding to its promoter (Jung et al. 2005), can induce HIF-1α stability and enhance its transcriptional activity, behaving as a co-activator and conforming a transcriptional complex together with CBP/p300 (Gray et al. 2005). E2 has been reported to regulate IL-6 both positively and negatively (Straub 2007), and it has been demonstrated that E2 and G1 (a non-steroidal GPER-specific agonist) promoted the IL-6 secretion of ER-negative endometrial cancer cell lines and activated the JAK2/STAT3 pathway to stimulate HIF-1α and VEGF expressions (Smith et al. 2013, Che et al. 2019). However, it is not completely defined whether GPER-mediated estrogens inducing IL-6-mediated JAK2/STAT3 activation are linked to HIF-1α/VEGF signals in swine GCs.
Therefore, in this study, swine were used as the experimental animals. Immunohistochemistry, real-time PCR, and Western blotting were used to analyze the GPER, HIF-1α, and VEGF expressions and related functions in GCs of follicles of different sizes in swine. In addition, this study was also carried out using an in vitro model of swine GCs, so as to define the signaling mechanism of estrogens by the modulation of non-genomic GPER/IL-6/JAK2/STAT3 signaling pathways which regulate HIF-1α and VEGF expressions in swine GCs. This study may provide new information to understand the beneficial role of estrogens-induced non-genomic effect in the swine ovary.
Methods
Reagents
All of the chemicals and reagents were purchased from MedChem Express (Princeton; NJ) except for the following: DMEM/F12 (Hyclone Laboratory, Logan, UT), FBS (Hyclone Laboratory), and E2 (Sigma–Aldrich). All of the compounds were solubilized in DMSO. The reagent solution was freshly prepared for each experiment with a final DMSO concentration of 0.1% (V/V). Controls were always treated with the same amount of DMSO, otherwise specially stated.
Animals and tissue collection
The experimental animals were all processed according to the related regulations of the China Council on Animal Care, and all procedures were performed in accordance with the guidelines of the Animal Ethics Committee of Beijing University of Agriculture (Permit number: SYXK(JING)2021-0001).
A total of 60 ovaries were obtained from pubertal gilts at a local slaughterhouse and transported to the laboratory within 2 h after being collected in PBS containing 100 U/mL penicillin and 100 mg/mL streptomycin at 30–35°C. The connective tissues and attached oviducts were removed after being washed with PBS for three times. Four ovaries were randomly selected and fixed in 4% formaldehyde for 1 week, then embedded in paraffin for immunohistochemistry. All visible healthy antral follicles (which were identified as having an intact and well-vascularized follicular wall, clear follicular fluid, and neatly arranged granulosa cell layers according to the morphological criteria (Jolly et al. 1997, Lin & Rui 2010)) were aspirated from large follicles (diameter ≥ 6 mm), medium follicles (diameter 2–6 mm), and small follicles (diameter ≤ 2 mm) from ovaries. After three washes in PBS, the GCs were harvested from follicles of different sizes for future mRNA and protein analysis.
Cell culture
The GCs for in vitro culture were collected from follicles by aspirating the surface of 2–6 mm follicles from another eight ovaries. The cells were washed with PBS for three times and then cultured in DMEM/F12 with 10% FBS and antibiotics (50 IU/mL penicillin G and 50 μg/mL streptomycin) in an incubator with the humidified atmosphere containing 95% air and 5% CO2 at 37°C. When the cells reached 80% confluence, GCs were seeded in 2 mL complete medium in six-well plates (Corning) at a density of about 1.5 × 105 cells/well. After 24 h, the plating medium was replaced with DMEM/F12 without serum for further culture of 12 h.
E2 concentrations peak before ovulation in the follicular fluid in swine (up to 200 ng/mL) (Palma-Vera et al. 2017). Thus, the cells were incubated with E2 and G1 at a final concentration of 1 μM for 0, 3, 6, and 12 h, respectively and cultured to analyze HIF-1α/VEGF signals and IL-6 mRNA expressions or secretion, respectively. For the inhibition study, GCs were incubated in the presence or absence of 1 μM ICI182780 (ERs nonselective inhibitor), 1 μM G15 (GPER inhibitor), 20 μM AG490 (JAK2/STAT3 inhibitor), and 1 or 5 μg/mL IL-6 antibody (bs-4587M, Bioss, Beijing, China) for 1 h before treatment.
Immunohistochemical staining
Immunohistochemical staining was conducted as described in our previous report (Xiao et al. 2019). With the concentration of rabbit polyclonal antibody for GPER (bs-1380R, Bioss) of 1:100, the anti-rabbit SP kit (Bioss) was used for GPER-stained sections, which were observed and photographed with an Olympus-DP73 optical microscope. The negative control was incubated with 2% BSA (Solarbio, Beijing, China) instead of primary antibody, whereas subsequent conditions and steps were as described.
Total RNA isolation, RT-PCR, and qPCR
Total RNA was extracted from the GCs by using TRIzol reagent (Solarbio, Beijing, China) and immediately reverse-transcribed with the Prime Script RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China).
Relative abundance of GPER, HIF-1α, VEGF, and IL-6 transcript levels in GCs were evaluated by qPCR with the LightCycler 480 Realtime Detection System (Roche). The qPCR reaction consisted of 10 μL of 2 × SYBR Green II PCR mix (TaKaRa), 25 μmol/L forward and reverse primers, 2 μL template, and ddH2O to a total volume of 20 μL. The thermocycler was set to 95°C for 10 min, followed by 45 cycles of 95°C for 10 s, and 60°C for 30 s. The melting curve was obtained from 65 to 95°C, increasing in an increment of 0.5°C every 5 s. β-actin was chosen as the housekeeping gene. The expression level of mRNA was calculated as a relative value with the 2−ΔΔCt method. Table 1 shows the sequences of the forward and reverse primers used in this study.
Primers used in real-time RT-PCR.
| Genes | Primer sequences (5′–3′) | Length (bp) | Accession No. |
|---|---|---|---|
| GPER | F: TGACCATCCCTGACCTGTAC | 111 | XM_003124244.5 |
| R: CGGCGATGTCATAGTACTGC | |||
| HIF-1α | F: ACTTTTGGGCCGCTCAATTT | 132 | NM_001123124.1 |
| R: CCACCTCTTTTGGCAAGCAT | |||
| VEGF | F: GGGCTGCTGTAATGACGAAA | 107 | NM_214084.1 |
| R: TCTCTCCTATGTGCTGGCTT | |||
| IL-6 | F: GGCTGCTTCTGGTGATGG | 146 | NM_001252429.1 |
| R: AGAGATTTTGCCGAGGATGTA | |||
| β-actin | F: CTCGATCATGAAGTGCGACGT | 114 | U07786.1 |
| R: GTGATCTCCTTCTGCATCCTGTC |
Western blot analysis
The GCs were harvested and washed with ice-cold PBS, then treated with ice-cold radioimmunoprecipitation assay (RIPA) lysis buffer containing 1 mmol/L phenylmethylsulfonyl fluoride (PMSF). The cell lysates were centrifuged at 12,000 g at 4°C for 5min. The protein concentration was determined with the BCA Protein Assay Kit (Solarbio). Equivalent protein samples (40 μg) were loaded and separated with SDS-PAGE, then electro-transferred to polyvinylidene difluoride (PVDF) membrane (Millipore Corp). These membranes were blocked with 5% (w/v) skimmed milk in TBS/Tween for 1 h and then incubated overnight at 4°C with rabbit polyclonal antibody for HIF-1α (bs-20398R, Bioss; 1:500 dilution), rabbit polyclonal antibody for VEGF (19003-1-AP, Proteintech Group, Wuhan, China; 1:1000 dilution), rabbit polyclonal antibody for JAK2 (#3230, Cell Signaling Technology; 1:500 dilution), rabbit polyclonal antibody for p-JAK2 (Tyr1007/1008) (#3776, Cell Signaling Technology; 1:1000 dilution), rabbit polyclonal antibody for STAT3 (#30835, Cell Signaling Technology; 1:1000 dilution), rabbit polyclonal antibody for p-STAT3 (Tyr705) (#9145, Cell Signaling Technology; 1:1000 dilution), or rabbit polyclonal antibody for β-actin (bs-0061R, Bioss; 1:3000 dilution). After washing, the membranes were incubated with horse radish peroxidase (HRP)-conjugated goat anti-rabbit (bs-0295G-HRP) at 1:4000 dilution. Bands were detected with enhanced chemiluminescence (ECL) solution (Abnova, Taipei, Taiwan), and signals were quantified with Image J (NIH).
Measurement of IL-6
The concentrations of IL-6 in the culture medium were measured with ELISA. Details regarding the procedures for ELISA are described in Swine IL-6 ELISA Kit (Jianglaibio; Shanghai; China). The absorbance at 450 nm was measured in duplicate for each sample, and negative control values (blanks without any sample) were subtracted. IL-6 levels were expressed in pg/mL. The minimum detectable concentrations were 1 pg/mL for IL-6.
Data analysis
Statistical analyses were performed by using SPSS Version 19.0 (SPSS, Inc). All data were tested for normality and homoscedasticity and then subjected to a one-way ANOVA followed by Duncan’s multiple range test to detect significant differences. All the quantitative data were presented as the mean ± s.e.m. The differences were considered to be statistically significant when there is P < 0.05.
Results
GPER, HIF-1α, and VEGF expressions in swine ovaries
The localization of GPER in swine ovaries was detected by immunohistochemistry. GPER was prominently localized to the GCs of follicles of all sizes analyzed (Fig. 1A, B, C and D). GPER signals were detected in oocytes from the follicles of the primordial stage onward and in the oocyte cytoplasm and GCs of primary and secondary follicles (Fig. 1A, B and C). In antral stages, positive granules were mainly located in GCs and oocytes increased. GPER was not detected when sections were incubated with normal goat serum (Fig. 1E, F, G and H).
GPER, HIF-1α, and VEGF expressions in swine ovaries. Distribution of GPER in primordial follicles, which are indicated by arrows (A); in primary follicles (B); in secondary (preantral) follicles (C); and in large antral follicles (D). (E, F, G and H) Negative control. Scale bars correspond to 50 μm. (I) Relative mRNA expressions of GPER, HIF-1α, and VEGF in GCs from follicles of different sizes (n = 4 in each group). (J) Western blot for GPER, HIF-1α, and VEGF (n = 3 in each group). The GCs were collected from 96 small follicles, 78 medium follicles, and 47 large follicles, respectively. β-actin was used as a loading control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs small follicle. S, small follicle; M, medium follicle; L, large follicle.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
GPER, HIF-1α, and VEGF expressions in swine ovaries. Distribution of GPER in primordial follicles, which are indicated by arrows (A); in primary follicles (B); in secondary (preantral) follicles (C); and in large antral follicles (D). (E, F, G and H) Negative control. Scale bars correspond to 50 μm. (I) Relative mRNA expressions of GPER, HIF-1α, and VEGF in GCs from follicles of different sizes (n = 4 in each group). (J) Western blot for GPER, HIF-1α, and VEGF (n = 3 in each group). The GCs were collected from 96 small follicles, 78 medium follicles, and 47 large follicles, respectively. β-actin was used as a loading control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs small follicle. S, small follicle; M, medium follicle; L, large follicle.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
GPER, HIF-1α, and VEGF expressions in swine ovaries. Distribution of GPER in primordial follicles, which are indicated by arrows (A); in primary follicles (B); in secondary (preantral) follicles (C); and in large antral follicles (D). (E, F, G and H) Negative control. Scale bars correspond to 50 μm. (I) Relative mRNA expressions of GPER, HIF-1α, and VEGF in GCs from follicles of different sizes (n = 4 in each group). (J) Western blot for GPER, HIF-1α, and VEGF (n = 3 in each group). The GCs were collected from 96 small follicles, 78 medium follicles, and 47 large follicles, respectively. β-actin was used as a loading control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs small follicle. S, small follicle; M, medium follicle; L, large follicle.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
The mRNA and protein expression levels of GPER, HIF-1α, and VEGF in swine GCs from follicles of different sizes are shown in Fig. 1I and J. The mRNA expression levels of GPER did not significantly differ among small and medium follicles but significantly increased in large follicles (P < 0.01). Moreover, GPER protein, and HIF-1α, and VEGF mRNA protein expressions significantly increased with the increasing of the follicular diameter.
Effects of E2 on HIF-1α and VEGF expressions in cultured swine GCs
To explore the mechanism of E2-regulating HIF-1α/VEGF signals, HIF-1α and VEGF expressions were analyzed. As shown in Fig. 2A and B, incubation of cells with the dose of 1 μM E2 for 3 h had no effect on HIF-1α protein and VEGF mRNA and protein expression, exploration of the effects of on E2 for 6 and 12 h, the expressions of HIF-1α and VEGF mRNA and protein levels significantly increased compared with the control group (P < 0.01).
E2 induces time-dependent expressions of HIF-1α and VEGF in cultured swine GCs. (A) Relative mRNA levels of HIF-1α and VEGF (n = 4 in each group). (B) Western blot for HIF-1α and VEGF (n = 3 in each group). β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
E2 induces time-dependent expressions of HIF-1α and VEGF in cultured swine GCs. (A) Relative mRNA levels of HIF-1α and VEGF (n = 4 in each group). (B) Western blot for HIF-1α and VEGF (n = 3 in each group). β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
E2 induces time-dependent expressions of HIF-1α and VEGF in cultured swine GCs. (A) Relative mRNA levels of HIF-1α and VEGF (n = 4 in each group). (B) Western blot for HIF-1α and VEGF (n = 3 in each group). β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
E2 induces HIF-1α and VEGF expressions in GGs
To determine whether E2 regulates HIF-1α/VEGF signals via GPER receptors, GCs were treated with E2 1 μM, ICI182780 1 μM, G1 1 μM, and G-15 1 μM for 6 h. The results showed that GCs treated with E2 or ICI182780 or G1 significantly increased in HIF-1α and VEGF mRNA and protein expressions (P < 0.01) as compared to the control group cells. In addition, G-15, a selective pharmacological antagonist of GPER, completely suppressed the E2-induced HIF-1α and VEGF expressions (P < 0.01) (Fig. 3A and B).
E2 induces HIF-1α and VEGF expressions in GGs. (A) Relative mRNA levels of HIF-1α and VEGF (n = 4 in each group). (B) Western blot for HIF-1α and VEGF (n = 3 in each group). β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
E2 induces HIF-1α and VEGF expressions in GGs. (A) Relative mRNA levels of HIF-1α and VEGF (n = 4 in each group). (B) Western blot for HIF-1α and VEGF (n = 3 in each group). β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
E2 induces HIF-1α and VEGF expressions in GGs. (A) Relative mRNA levels of HIF-1α and VEGF (n = 4 in each group). (B) Western blot for HIF-1α and VEGF (n = 3 in each group). β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
E2 and G1 induce IL-6 secretion and mRNA expression via GPER in GGs
After incubation with E2 or G1 at a final concentration of 1 μM for 0, 3, 6, and 12 h, the IL-6 mRNA expression was detected in all time phases, and a time-dependent increase in IL-6 secretion and mRNA expression was found (Fig. 4A and B). Moreover, G15 significantly inhibited 1 μM E2 or G1-induced increases in IL-6 secretion and mRNA levels (Fig. 4C and D, P < 0.01).
E2 and G1 induce IL-6 secretion and mRNA expression in GGs. E2 and G1 induced time-dependent of IL-6 secretion (A, n = 6 in each group) and mRNA expression (B, n = 4 in each group) in cultured swine GCs. G15 blocked IL-6 secretion (C, n = 6 in each group) and mRNA expression (D, n = 4 in each group) in response to E2 or G1 in cultured swine GCs. β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
E2 and G1 induce IL-6 secretion and mRNA expression in GGs. E2 and G1 induced time-dependent of IL-6 secretion (A, n = 6 in each group) and mRNA expression (B, n = 4 in each group) in cultured swine GCs. G15 blocked IL-6 secretion (C, n = 6 in each group) and mRNA expression (D, n = 4 in each group) in response to E2 or G1 in cultured swine GCs. β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
E2 and G1 induce IL-6 secretion and mRNA expression in GGs. E2 and G1 induced time-dependent of IL-6 secretion (A, n = 6 in each group) and mRNA expression (B, n = 4 in each group) in cultured swine GCs. G15 blocked IL-6 secretion (C, n = 6 in each group) and mRNA expression (D, n = 4 in each group) in response to E2 or G1 in cultured swine GCs. β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
G1 mediates the expressions of HIF-1α and VEGF and activation of JAK2/STAT3 signals by inducing IL-6 secretion
To evaluate whether the secretion of IL-6 induced by G1 is involved in regulating HIF-1α/VEGF signals, anti-IL-6 antibody was used. After the application of 1 or 5 μg/mL anti-IL-6 antibody, the increased HIF-1α and VEGF mRNA and protein after 1 μM G1 incubation was partly inhibited in a dose-dependent manner (Fig. 5A and B, P < 0.05). Moreover, the stimulating effect of G1 on increased phosphorylation of JAK2 and STAT3 was also partly inhibited by IL-6-neutralizing antibody (Fig. 5C, P < 0.01).
G1 mediates the expressions of HIF-1α and VEGF and activation of JAK2/STAT3 signals by inducing IL-6 secretion. qPCR and Western blot analysis were conducted to measure the expressions of HIF-1α and VEGF mRNA (A, n = 4 in each group) and protein (B, n = 3 in each group) and the phosphorylation and total levels of JAK2 and STAT3 (C, n = 3 in each group) in GCs after treatment with G1 with or without 1 and 5 μg/mL IL-6-neutralizing antibody. β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control; and #P < 0.05, ##P < 0.01 vs G1 group.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
G1 mediates the expressions of HIF-1α and VEGF and activation of JAK2/STAT3 signals by inducing IL-6 secretion. qPCR and Western blot analysis were conducted to measure the expressions of HIF-1α and VEGF mRNA (A, n = 4 in each group) and protein (B, n = 3 in each group) and the phosphorylation and total levels of JAK2 and STAT3 (C, n = 3 in each group) in GCs after treatment with G1 with or without 1 and 5 μg/mL IL-6-neutralizing antibody. β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control; and #P < 0.05, ##P < 0.01 vs G1 group.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
G1 mediates the expressions of HIF-1α and VEGF and activation of JAK2/STAT3 signals by inducing IL-6 secretion. qPCR and Western blot analysis were conducted to measure the expressions of HIF-1α and VEGF mRNA (A, n = 4 in each group) and protein (B, n = 3 in each group) and the phosphorylation and total levels of JAK2 and STAT3 (C, n = 3 in each group) in GCs after treatment with G1 with or without 1 and 5 μg/mL IL-6-neutralizing antibody. β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control; and #P < 0.05, ##P < 0.01 vs G1 group.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
G1 mediates HIF-1α and VEGF expressions by activating IL-6 induced JAK2/STAT3 in swine GCs
To evaluate whether IL-6-mediated JAK2/STAT3 activation is involved in the expressions of G1-induced HIF-1α and VEGF, AG490, a JAK2/STAT3 inhibitor was used. As shown in Fig. 6A, AG490 alone decreased the phosphorylation of JAK2 and STAT3, without affecting total JAK2 and STAT3 levels. In combination with G1, AG490 significantly inhibited 1 μM G1-induced increases in the phosphorylation levels of JAK2 and STAT3 (P < 0.01). Moreover, the stimulative effect of G1 on the expressions of HIF-1α and VEGF mRNA and protein was also inhibited by AG490 (Fig. 6B and C, P < 0.01).
G1 mediates the expressions of HIF-1α and VEGF by activating IL-6 induced JAK2/STAT3 in swine GCs. qPCR and Western blot analysis were conducted to measure the phosphorylation and total levels of JAK2 and STAT3 (A, n = 3 in each group) and the expression of its target genes HIF-1α and VEGF mRNA (B, n = 4 in each group) and protein (C, n = 3 in each group) in GCs after treatment with G1 with or without AG490. β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
G1 mediates the expressions of HIF-1α and VEGF by activating IL-6 induced JAK2/STAT3 in swine GCs. qPCR and Western blot analysis were conducted to measure the phosphorylation and total levels of JAK2 and STAT3 (A, n = 3 in each group) and the expression of its target genes HIF-1α and VEGF mRNA (B, n = 4 in each group) and protein (C, n = 3 in each group) in GCs after treatment with G1 with or without AG490. β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
G1 mediates the expressions of HIF-1α and VEGF by activating IL-6 induced JAK2/STAT3 in swine GCs. qPCR and Western blot analysis were conducted to measure the phosphorylation and total levels of JAK2 and STAT3 (A, n = 3 in each group) and the expression of its target genes HIF-1α and VEGF mRNA (B, n = 4 in each group) and protein (C, n = 3 in each group) in GCs after treatment with G1 with or without AG490. β-actin was used as an internal control. Values are indicated with the mean ± s.e.m. *P < 0.05, **P < 0.01 vs control.
Citation: Journal of Molecular Endocrinology 68, 1; 10.1530/JME-21-0125
Discussion
VEGF is a crucial factor to promote angiogenesis in ovaries (Araújo et al. 2011, Nishigaki et al. 2011), and HIF-1α is a key promoter of VEGF expression in physiological and pathological conditions (Jung et al. 2005). Similarly to previous studies found in swine (Barboni et al. 2000, Shimizu et al. 2002, Sant’Ana et al. 2015), human (Gordon et al. 1996, Neulen et al. 1998), rat (Carmeliet et al. 1996, Ortega et al. 2007), and bovine (Babitha et al. 2013), we also found that HIF-1α and VEGF were expressed in swine GCs and their levels increased with follicular development in this study, suggesting that HIF-1α/ VEGF signals are closely related to follicular development, ovulation, and corpus luteum formation.
A large number of regulatory factors are involved in the activation of HIF-1α/ VEGF signals in ovaries, such as cytokines, gonadotropins, and steroid hormones (Shimizu & Miyamoto 2007, Shimizu et al. 2007, Guimerà et al. 2009, Yang et al. 2017, Nichols et al. 2019, Devesa & Caicedo 2019). It has been shown that E2 is one of the major inducing factors to regulate the expression of VEGF in many cell types (Shimizu et al. 2007, Shao et al. 2009, Che et al. 2019). Moreover, the E2 level in dominant follicles is significantly higher than those in atretic follicles and peaks before ovulation (Fortune et al. 2004). In this study, we found that E2 improved HIF-1α and VEGF expressions in a time-dependent manner in swine GCs. Estrogens exert their actions by binding to the estrogen receptor. Except the classic nuclear receptors ERα and ERβ, which are highly expressed in GCs (Słomczyńska & Woźniak 2001), the estrogen membrane receptor GPER was also reported to be involved in regulating HIF-1α/ VEGF signals in ER-negative breast cancer cells (De Francesco et al. 2014, Zhang et al. 2017). In this study, we also found the expression of GPER was detected in the oocytes of primordial follicles and at all subsequent stages of follicular development, and its levels in GCs increased progressively throughout follicular development, expressing a trend similar to that of HIF-1α/VEGF signals. Moreover, our data showed that GPER agonist G1 also increased HIF-1α and VEGF expressions in swine GCs, and G15 attenuated the stimulating effect through E2 and G1. It was interesting to note that in addition to estrogen, ER’s antagonist ICI 182,780 also stimulated the activation of HIF-1α/ VEGF signals, which is consistent with the results of previous reports for T47-D breast cancer cells and suggests that the anti-estrogen ICI182, 780 possess agonistic activity at GPER receptors (Wu et al. 2004).
Upon ovulation, the follicular fluid shows a much higher level of E2 (Fortune et al. 2004) than serum, which induces an inflammatory-like process with the production of induced pro-inflammatory cytokines (Duffy et al. 2019). IL-6, a pro-inflammatory and immunoregulatory cytokine, is produced in a variety of cell types, including ovarian GCs (Machelon et al. 1994, Keck et al. 1998). It has been demonstrated that E2 upregulated IL-6 expressions in endometrial cancer (Che et al. 2019). In addition, non-genomic effects of estrogen mediated by GPER have been reported to regulate IL-6 both positively and negatively (Zhang et al. 2018, Che et al. 2019). In human primary macrophages and in a murine macrophage cell line, G1 inhibits the production of lipopolysaccharide (LPS)-induced cytokines such as TNF-alpha and IL-6 in a dose-dependent manner (Blasko et al. 2009). In this study, however, we found that E2 or G1 increased IL-6 secretion and mRNA expression in a time-dependent manner, and G15 inhibited the stimulating effect of E2. Our data in swine GCs are similar to those in previous reports, indicating that E2 and G1 promoted IL-6 secretion to stimulate the proliferation of endometrial cancer cell lines (KLE and RL95-2) and the production of matrix metalloproteinase (He et al. 2009). Together, the discrepancy suggests that the effect of estrogens mediated by GPER on IL-6 secretion could be closely related to the microenvironment and cell type.
Many studies have found that IL-6 is involved in the angiogenesis process under physiological and pathological conditions (Kumari et al. 2016). In this study, our data provide evidence that the HIF-1α/VEGF signals activated by G1 are partially inhibited by IL-6 antibody, which suggests that estrogens stimulate the expressions of HIF-1α and VEGF via the upstream pathways of IL-6. Moreover, IL-6 regulates the expressions of various target genes by initiating JAK/STAT3 signaling pathways, and also, the IL-6-neutralizing antibody also blocks the increased expression of p-JAK2 and p-STAT3 induced by G1. It has been demonstrated that STAT3 is a potential modulator of HIF-1α-mediated VEGF expression, and IL-6 can increase the expression of VEGF through the JAK2/STAT3 signaling pathways in bovine GCs (Yang et al. 2017). To understand the relationship between G1 and JAK/STAT signaling pathways, which has been proved to be the upstream pathway of IL-6, we tested the effect of JAK2/STAT3 signaling pathway inhibitors, AG490, on the expression of HIF-1α and VEGF. Our results showed that G1-induced JAK2/STAT3 signaling activation was significantly abolished in the presence of AG490 in swine GCs. Moreover, G1-stimulated HIF-1α and VEGF expressions were blocked in GCs when being treated with AG490. These results suggested the involvement of G1-induced IL-6 secretion leads to JAK2/STAT3 cascade activation in regulating HIF-1α and VEGF expressions in swine GCs.
Conclusions
Altogether, the results obtained indicated that estrogens induced the expressions of HIF-1α and VEGF in swine GCs partially through the GPER/IL-6/JAK2/STAT3 signaling pathways which might enforce each other and contribute to the sustained activation of transcription factors required for VEGF expression to stimulate follicular angiogenesis and development, and ovulation as well. In particular, this work has improved our understanding of the mechanisms involved in the high estrogen level trigger of the inflammatory to regulate ovarian functions.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the construction fund for key subjects of Youth Science Fund Project of Beijing University of Agriculture (grants no: 5077516002/005) and General Science and Technology Project of Beijing Municipal Education Commission (grants no: KM202110020004).
Author contribution statement
Longfei Xiao and Xiangguo Wang designed and conceived the experiments. Longfei Xiao and Zihui Wang drafted the manuscript. Zihui Wang, Ning Lu, Yanan HE, and Limin Qiao performed the experiment. Xihui Sheng, Xiaolong Qi, Kai Xing, and Di Chang carried out the experiments and analyzed data. Junjin Zhao, Xiaobin Deng, Hemin Ni, Yong Guo, and Jian Kang revised and edited the manuscript.
Acknowledgement
The authors would like to thank Editage (www.editage.cn) for English language editing.
References
Abid H, Ryan ZC, Delmotte P, Sieck GC & Lanza IR 2020 Extramyocellular interleukin-6 influences skeletal muscle mitochondrial physiology through canonical JAK/STAT signaling pathways. FASEB Journal 34 14458–14472. (https://doi.org/10.1096/fj.202000965RR)
Araújo VR, Silva GM, Duarte AB, Magalhães DM, Almeida AP, Gonçalves RF, Bruno JB, Silva TF, Campello CC & Rodrigues AP et al.2011 Vascular endothelial growth factor-A(165) (VEGF-A(165)) stimulates the in vitro development and oocyte competence of goat preantral follicles. Cell and Tissue Research 346 273–281. (https://doi.org/10.1007/s00441-011-1251-1)
Babitha V, Panda RP, Yadav VP, Chouhan VS, Dangi SS, Khan FA, Singh G, Bag S, Taru Sharma G & Silvia WJ et al.2013 Amount of mRNA and localization of vascular endothelial growth factor and its receptors in the ovarian follicle during estrous cycle of water buffalo (Bubalus bubalis). Animal Reproduction Science 137 163–176. (https://doi.org/10.1016/j.anireprosci.2013.01.004)
Barboni B, Turriani M, Galeati G, Spinaci M, Bacci ML, Forni M & Mattioli M 2000 Vascular endothelial growth factor production in growing pig antral follicles. Biology of Reproduction 63 858–864. (https://doi.org/10.1095/biolreprod63.3.858)
Blasko E, Haskell CA, Leung S, Gualtieri G, Halks-Miller M, Mahmoudi M, Dennis MK, Prossnitz ER, Karpus WJ & Horuk R 2009 Beneficial role of the GPR30 agonist G-1 in an animal model of multiple sclerosis. Journal of Neuroimmunology 214 67–77. (https://doi.org/10.1016/j.jneuroim.2009.06.023)
Carmeliet P, Ferreira V, Breier G, Pollefeyt S, Kieckens L, Gertsenstein M, Fahrig M, Vandenhoeck A, Harpal K & Eberhardt C et al.1996 Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 380 435–439. (https://doi.org/10.1038/380435a0)
Charnock-Jones DS, Clark DE, Licence D, Day K, Wooding FB & Smith SK 2001 Distribution of vascular endothelial growth factor (VEGF) and its binding sites at the maternal-fetal interface during gestation in pigs. Reproduction 122 753–760. (https://doi.org/10.1530/rep.0.1220753)
Che Q, Xiao X, Xu J, Liu M, Lu Y, Liu S & Dong X 2019 17β-Estradiol promotes endometrial cancer proliferation and invasion through IL-6 pathway. Endocrine Connections 8 961–968. (https://doi.org/10.1530/EC-19-0258)
De Francesco EM, Pellegrino M, Santolla MF, Lappano R, Ricchio E, Abonante S & Maggiolini M 2014 GPER mediates activation of HIF1α/VEGF signaling by estrogens. Cancer Research 74 4053–4064. (https://doi.org/10.1158/0008-5472.CAN-13-3590)
Devesa J & Caicedo D 2019 The role of growth hormone on ovarian functioning and ovarian angiogenesis. Frontiers in Endocrinology 10 450. (https://doi.org/10.3389/fendo.2019.00450)
Duffy DM, Ko C, Jo M, Brannstrom M & Curry TE 2019 Ovulation: parallels with inflammatory processes. Endocrine Reviews 40 369–416. (https://doi.org/10.1210/er.2018-00075)
Fortune JE, Rivera GM & Yang MY 2004 Follicular development: the role of the follicular microenvironment in selection of the dominant follicle. Animal Reproduction Science 82–83 109–126. (https://doi.org/10.1016/j.anireprosci.2004.04.031)
Gordon JD, Mesiano S, Zaloudek CJ & Jaffe RB 1996 Vascular endothelial growth factor localization in human ovary and fallopian tubes: possible role in reproductive function and ovarian cyst formation. Journal of Clinical Endocrinology and Metabolism 81 353–359. (https://doi.org/10.1210/jcem.81.1.8550777)
Grasselli F, Basini G, Bussolati S & Tamanini C 2002 Effects of VEGF and bFGF on proliferation and production of steroids and nitric oxide in porcine granulosa cells. Reproduction in Domestic Animals 37 362–368. (https://doi.org/10.1046/j.1439-0531.2002.00386.x)
Gray MJ, Zhang J, Ellis LM, Semenza GL, Evans DB, Watowich SS & Gallick GE 2005 HIF-1alpha, STAT3, CBP/p300 and Ref-1/APE are components of a transcriptional complex that regulates Src-dependent hypoxia-induced expression of VEGF in pancreatic and prostate carcinomas. Oncogene 24 3110–3120. (https://doi.org/10.1038/sj.onc.1208513)
Greenaway J, Connor K, Pedersen HG, Coomber BL, LaMarre J & Petrik J 2004 Vascular endothelial growth factor and its receptor, Flk-1/KDR, are cytoprotective in the extravascular compartment of the ovarian follicle. Endocrinology 145 2896–2905. (https://doi.org/10.1210/en.2003-1620)
Guimerà M, Morales-Ruiz M, Jiménez W & Balasch J 2009 LH/HCG stimulation of VEGF and adrenomedullin production by follicular fluid macrophages and luteinized granulosa cells. Reproductive Biomedicine Online 18 743–749. (https://doi.org/10.1016/s1472-6483(1060021-1)
Hamilton KJ, Hewitt SC, Arao Y & Korach KS 2017 Estrogen hormone biology. Current Topics in Developmental Biology 125 109–146. (https://doi.org/10.1016/bs.ctdb.2016.12.005)
He YY, Cai B, Yang YX, Liu XL & Wan XP 2009 Estrogenic G protein-coupled receptor 30 signaling is involved in regulation of endometrial carcinoma by promoting proliferation, invasion potential, and interleukin-6 secretion via the MEK/ERK mitogen-activated protein kinase pathway. Cancer Science 100 1051–1061. (https://doi.org/10.1111/j.1349-7006.2009.01148.x)
Heublein S, Lenhard M, Vrekoussis T, Schoepfer J, Kuhn C, Friese K, Makrigiannakis A, Mayr D & Jeschke U 2012 The G-protein-coupled estrogen receptor (GPER) is expressed in normal human ovaries and is upregulated in ovarian endometriosis and pelvic inflammatory disease involving the ovary. Reproductive Sciences 19 1197–1204. (https://doi.org/10.1177/1933719112446085)
Hunter CA & Jones SA 2015 IL-6 as a keystone cytokine in health and disease. Nature Immunology 16 448–457. (https://doi.org/10.1038/ni.3153)
Irusta G, Abramovich D, Parborell F & Tesone M 2010 Direct survival role of vascular endothelial growth factor (VEGF) on rat ovarian follicular cells. Molecular and Cellular Endocrinology 325 93–100. (https://doi.org/10.1016/j.mce.2010.04.018)
Jolly PD, Smith PR, Heath DA, Hudson NL, Lun S, Still LA, Watts CH & McNatty KP 1997 Morphological evidence of apoptosis and the prevalence of apoptotic versus mitotic cells in the membrana granulosa of ovarian follicles during spontaneous and induced atresia in ewes. Biology of Reproduction 56 837–846. (https://doi.org/10.1095/biolreprod56.4.837)
Jung JE, Lee HG, Cho IH, Chung DH, Yoon SH, Yang YM, Lee JW, Choi S, Park JW & Ye SK et al.2005 STAT3 is a potential modulator of HIF-1-mediated VEGF expression in human renal carcinoma cells. FASEB Journal 19 1296–1298. (https://doi.org/10.1096/fj.04-3099fje)
Keck C, Rajabi Z, Pfeifer K, Bettendorf H, Brandstetter T & Breckwoldt M 1998 Expression of interleukin-6 and interleukin-6 receptors in human granulosa lutein cells. Molecular Human Reproduction 4 1071–1076. (https://doi.org/10.1093/molehr/4.11.1071)
Kumari N, Dwarakanath BS, Das A & Bhatt AN 2016 Role of interleukin-6 in cancer progression and therapeutic resistance. Tumour Biology 37 11553–11572. (https://doi.org/10.1007/s13277-016-5098-7)
Lin P & Rui R 2010 Effects of follicular size and FSH on granulosa cell apoptosis and atresia in porcine antral follicles. Molecular Reproduction and Development 77 670–678. (https://doi.org/10.1002/mrd.21202)
Machelon V, Emilie D, Lefevre A, Nome F, Durand-Gasselin I & Testart J 1994 Interleukin-6 biosynthesis in human preovulatory follicles: some of its potential roles at ovulation. Journal of Clinical Endocrinology and Metabolism 79 633–642. (https://doi.org/10.1210/jcem.79.2.7519193)
Neulen J, Raczek S, Pogorzelski M, Grunwald K, Yeo TK, Dvorak HF, Weich HA & Breckwoldt M 1998 Secretion of vascular endothelial growth factor/vascular permeability factor from human luteinized granulosa cells is human chorionic gonadotrophin dependent. Molecular Human Reproduction 4 203–206. (https://doi.org/10.1093/molehr/4.3.203)
Nichols JA, Perego MC, Schütz LF, Hemple AM & Spicer LJ 2019 Hormonal regulation of vascular endothelial growth factor A (VEGFA) gene expression in granulosa and theca cells of cattle1. Journal of Animal Science 97 3034–3045. (https://doi.org/10.1093/jas/skz164)
Nishigaki A, Okada H, Okamoto R, Sugiyama S, Miyazaki K, Yasuda K & Kanzaki H 2011 Concentrations of stromal cell-derived factor-1 and vascular endothelial growth factor in relation to the diameter of human follicles. Fertility and Sterility 95 742–746. (https://doi.org/10.1016/j.fertnstert.2010.10.028)
Ortega HH, Salvetti NR, Amable P, Dallard BE, Baravalle C, Barbeito CG & Gimeno EJ 2007 Intraovarian localization of growth factors in induced cystic ovaries in rats. Anatomia, Histologia, Embryologia 36 94–102. (https://doi.org/10.1111/j.1439-0264.2006.00726.x)
Palma-Vera SE, Schoen J & Chen S 2017 Periovulatory follicular fluid levels of estradiol trigger inflammatory and DNA damage responses in oviduct epithelial cells. PLoS ONE 12 e0172192. (https://doi.org/10.1371/journal.pone.0172192)
Sant’Ana F, Reis Junior JL, Blume GR, Gimeno EJ, Rey F & Ortega HH 2015 Immunohistochemical expression of growth factors in the follicular wall of normal and cystic ovaries of sows. Reproduction in Domestic Animals 50 327–332. (https://doi.org/10.1111/rda.12495)
Shao R, Nutu M, Karlsson-Lindahl L, Benrick A, Weijdegård B, Lager S, Egecioglu E, Fernandez-Rodriguez J, Gemzell-Danielsson K & Ohlsson C et al.2009 Downregulation of cilia-localized IL-6R alpha by 17beta-estradiol in mouse and human fallopian tubes. American Journal of Physiology: Cell Physiology 297 C140–C151. (https://doi.org/10.1152/ajpcell.00047.2009)
Shimizu T & Miyamoto A 2007 Progesterone induces the expression of vascular endothelial growth factor (VEGF) 120 and Flk-1, its receptor, in bovine granulosa cells. Animal Reproduction Science 102 228–237. (https://doi.org/10.1016/j.anireprosci.2006.11.012)
Shimizu T, Jiang JY, Sasada H & Sato E 2002 Changes of messenger RNA expression of angiogenic factors and related receptors during follicular development in gilts. Biology of Reproduction 67 1846–1852. (https://doi.org/10.1095/biolreprod.102.006734)
Shimizu T, Jayawardana BC, Tetsuka M & Miyamoto A 2007 Differential effect of follicle-stimulating hormone and estradiol on expressions of vascular endothelial growth factor (VEGF) 120, VEGF164 and their receptors in bovine granulosa cells. Journal of Reproduction and Development 53 105–112. (https://doi.org/10.1262/jrd.18088)
Słomczyńska M & Woźniak J 2001 Differential distribution of estrogen receptor-beta and estrogen receptor-alpha in the porcine ovary. Experimental and Clinical Endocrinology and Diabetes 109 238–244. (https://doi.org/10.1055/s-2001-15112)
Smith HO, Stephens ND, Qualls CR, Fligelman T, Wang T, Lin CY, Burton E, Griffith JK & Pollard JW 2013 The clinical significance of inflammatory cytokines in primary cell culture in endometrial carcinoma. Molecular Oncology 7 41–54. (https://doi.org/10.1016/j.molonc.2012.07.002)
Straub RH 2007 The complex role of estrogens in inflammation. Endocrine Reviews 28 521–574. (https://doi.org/10.1210/er.2007-0001)
Tang ZR, Zhang R, Lian ZX, Deng SL & Yu K 2019 Estrogen-receptor expression and function in female reproductive disease. Cells 8 1123. (https://doi.org/10.3390/cells8101123)
Tirpe AA, Gulei D, Ciortea SM, Crivii C & Berindan-Neagoe I 2019 Hypoxia: overview on hypoxia-mediated mechanisms with a focus on the role of HIF genes. International Journal of Molecular Sciences 20 6140. (https://doi.org/10.3390/ijms20246140)
Trau HA, Brännström M, Curry TE & Duffy DM 2016 Prostaglandin E2 and vascular endothelial growth factor A mediate angiogenesis of human ovarian follicular endothelial cells. Human Reproduction 31 436–444. (https://doi.org/10.1093/humrep/dev320)
Wu J, Richer J, Horwitz KB & Hyder SM 2004 Progestin-dependent induction of vascular endothelial growth factor in human breast cancer cells: preferential regulation by progesterone receptor B. Cancer Research 64 2238–2244. (https://doi.org/10.1158/0008-5472.can-03-3044)
Xiao L, Hu J, Song L, Zhang Y, Dong W, Jiang Y, Zhang Q, Yuan L & Zhao X 2019 Profile of melatonin and its receptors and synthesizing enzymes in cumulus-oocyte complexes of the developing sheep antral follicle-a potential estradiol-mediated mechanism. Reproductive Biology and Endocrinology 17 1. (https://doi.org/10.1186/s12958-018-0446-7)
Yan Z, Weich HA, Bernart W, Breckwoldt M & Neulen J 1993 Vascular endothelial growth factor (VEGF) messenger ribonucleic acid (mRNA) expression in luteinized human granulosa cells in vitro. Journal of Clinical Endocrinology and Metabolism 77 1723–1725. (https://doi.org/10.1210/jcem.77.6.8263163)
Yang M, Wang L, Wang X, Wang X, Yang Z & Li J 2017 IL-6 promotes FSH-induced VEGF expression Through JAK/STAT3 signaling pathway in bovine granulosa cells. Cellular Physiology and Biochemistry 44 293–302. (https://doi.org/10.1159/000484885)
Zhang L, Xiong W, Li N, Liu H, He H, Du Y, Zhang Z & Liu Y 2017 Estrogen stabilizes hypoxia-inducible factor 1α through G protein-coupled estrogen receptor 1 in eutopic endometrium of endometriosis. Fertility and Sterility 107 439–447. (https://doi.org/10.1016/j.fertnstert.2016.11.008)
Zhang Z, Qin P, Deng Y, Ma Z, Guo H, Guo H, Hou Y, Wang S, Zou W & Sun Y et al.2018 The novel estrogenic receptor GPR30 alleviates ischemic injury by inhibiting TLR4-mediated microglial inflammation. Journal of Neuroinflammation 15 206. (https://doi.org/10.1186/s12974-018-1246-x)
Zhang H, Wei Q, Gao Z, Ma C, Yang Z, Zhao H, Liu C, Liu J, Zhao X & Ma B 2019 G protein-coupled receptor 30 mediates meiosis resumption and gap junction communications downregulation in goat cumulus-oocyte complexes by 17β-estradiol. Journal of Steroid Biochemistry and Molecular Biology 187 58–67. (https://doi.org/10.1016/j.jsbmb.2018.11.001)
