The miRNAs miR-211-5p and miR-204-5p modulate ER stress in human beta cells

in Journal of Molecular Endocrinology
View More View Less
  • 1 ULB Center for Diabetes Research, Université Libre de Bruxelles, Brussels, Belgium
  • 2 Department of Clinical and Experimental Medicine, Islet Cell Laboratory, University of Pisa, Pisa, Italy

Correspondence should be addressed to D L Eizirik: deizirik@ulb.ac.be

miRNAs are a class of small non-coding RNAs that regulate gene expression. Type 1 diabetes is an autoimmune disease characterized by insulitis (islets inflammation) and pancreatic beta cell destruction. The pro-inflammatory cytokines interleukin 1 beta (IL1B) and interferon gamma (IFNG) are released during insulitis and trigger endoplasmic reticulum (ER) stress and expression of pro-apoptotic members of the BCL2 protein family in beta cells, thus contributing to their death. The nature of miRNAs that regulate ER stress and beta cell apoptosis remains to be elucidated. We have performed a global miRNA expression profile on cytokine-treated human islets and observed a marked downregulation of miR-211-5p. By real-time PCR and Western blot analysis, we confirmed cytokine-induced changes in the expression of miR-211-5p and the closely related miR-204-5p and downstream ER stress related genes in human beta cells. Blocking of endogenous miRNA-211-5p and miR-204-5p by the same inhibitor (it is not possible to block separately these two miRs) increased human beta cell apoptosis, as measured by Hoechst/propidium Iodide staining and by determination of cleaved caspase-3 activation. Interestingly, miRs-211-5p and 204-5p regulate the expression of several ER stress markers downstream of PERK, particularly the pro-apoptotic protein DDIT3 (also known as CHOP). Blocking CHOP expression by a specific siRNA partially prevented the increased apoptosis observed following miR-211-5p/miR-204-5p inhibition. These observations identify a novel crosstalk between miRNAs, ER stress and beta cell apoptosis in early type 1 diabetes.

Abstract

miRNAs are a class of small non-coding RNAs that regulate gene expression. Type 1 diabetes is an autoimmune disease characterized by insulitis (islets inflammation) and pancreatic beta cell destruction. The pro-inflammatory cytokines interleukin 1 beta (IL1B) and interferon gamma (IFNG) are released during insulitis and trigger endoplasmic reticulum (ER) stress and expression of pro-apoptotic members of the BCL2 protein family in beta cells, thus contributing to their death. The nature of miRNAs that regulate ER stress and beta cell apoptosis remains to be elucidated. We have performed a global miRNA expression profile on cytokine-treated human islets and observed a marked downregulation of miR-211-5p. By real-time PCR and Western blot analysis, we confirmed cytokine-induced changes in the expression of miR-211-5p and the closely related miR-204-5p and downstream ER stress related genes in human beta cells. Blocking of endogenous miRNA-211-5p and miR-204-5p by the same inhibitor (it is not possible to block separately these two miRs) increased human beta cell apoptosis, as measured by Hoechst/propidium Iodide staining and by determination of cleaved caspase-3 activation. Interestingly, miRs-211-5p and 204-5p regulate the expression of several ER stress markers downstream of PERK, particularly the pro-apoptotic protein DDIT3 (also known as CHOP). Blocking CHOP expression by a specific siRNA partially prevented the increased apoptosis observed following miR-211-5p/miR-204-5p inhibition. These observations identify a novel crosstalk between miRNAs, ER stress and beta cell apoptosis in early type 1 diabetes.

Introduction

Selective beta cell death and the consequent progressive decrease in functional beta cell mass are hallmarks of type 1 diabetes. Immune-mediated apoptosis is probably the major form of beta cell death in type 1 diabetes (Cnop et al. 2005). This selective beta cell destruction occurs in the course of a specific islets inflammatory process (insulitis). Candidate genes for type 1 diabetes regulate several crucial steps in the complex dialog between beta cells and immune systems taking place during insulitis (Eizirik et al. 2009, 2012, Santin & Eizirik 2013, Floyel et al. 2015). Islets inflammation triggers endoplasmic reticulum (ER) stress in beta cells exacerbating inflammation and contributing to beta cell death (Eizirik et al. 2008, 2013, Brozzi et al. 2015, Brozzi & Eizirik 2016, Cnop et al. 2017). ER stress results from the accumulation of misfolded proteins inside the lumen of the ER, leading to the activation of the unfolded protein response (UPR) (Walter & Ron 2011). Endoplasmic reticulum to nucleus signaling 1 (ERN1, also known as IRE1A), activating transcription factor 6 (ATF6) and eukaryotic translation initiation factor 2 alpha kinase 3 (EIF2AK3, also known as PERK) are the three signaling proteins activated during UPR. Activated PERK induces the phosphorylation of EIF2A, which causes a general decrease in protein translation while inducing a paradoxical increase in the translation of activating transcription factor 4 (ATF4) and other regulators of the UPR. ATF4 increases the expression of two important transcription factors, namely ATF3 and eukaryotic translation initiation factor 2 alpha kinase 3 (EIF2AK3, also known as PERK), which contribute to beta cell apoptosis (Walter & Ron 2011, Cnop et al. 2017).

The UPR aims to restore ER homeostasis and prevent beta cell death by decreasing global protein synthesis by upregulating the expression of key ER chaperones (Ron & Walter 2007). In case of severe and/or prolonged ER stress, apoptosis is eventually triggered (Eizirik & Cnop 2010).

Importantly, markers of ER stress are present in islets from type 1 diabetes patients (Marhfour et al. 2012) and diabetes-prone NOD mice (Tersey et al. 2012) and restoring ER stress function decreases the incidence of diabetes in NOD mice (Engin et al. 2013).

miRNAs are short (~22 nucleotides in length) non-coding single-stranded RNAs that act at a post-transcriptional level controlling gene expression (Bartel 2004, Friedman et al. 2009). miRNAs function either as single molecules or as clusters of related families of miRNAs that regulate key gene networks (Dambal et al. 2015, Haier et al. 2016). miRNAs participate in beta cell differentiation, endocrine cell identity and preservation of beta cell phenotype during adult life (Martinez-Sanchez et al. 2016). miRNAs may also contribute to autoimmunity, beta cells apoptosis and diabetes development (Sayed & Abdellatif 2011, Sebastiani et al. 2011, Ventriglia et al. 2015, Isaacs et al. 2016). In line with this, we have recently described a family of miRNAs, namely miR-23a-3p, miR-23b-3p and miR-149-5p, that regulate the expression of the pro-apoptotic harakiri, BCL2 interacting protein (HRK, also known as DP5) and BCL2 binding component 3 (BBC3, also known as PUMA) in human pancreatic beta cells (Grieco et al. 2017).

There is growing evidence that miRNAs regulated ER stress and UPR activation in other cell types (Bartoszewska et al. 2013, Byrd & Brewer 2013, Maurel & Chevet 2013, Urra et al. 2013, Malhi 2014). As mentioned above, ER stress plays an important role in the ‘dialog’ between the immune system and beta cells during diabetes progression (Eizirik et al. 2008, 2013, Brozzi et al. 2015, Brozzi & Eizirik 2016, Cnop et al. 2017), and it has been recently shown that miR-204-5p regulates ER stress and the UPR response in pancreatic mouse and human beta cells (Xu et al. 2016), while miR-708 is induced by ER stress in mouse beta cells and leads to impaired beta cell function and growth (Rodriguez-Comas et al. 2017). Against this background, the aim of the present study was to further investigate a possible link between miRNAs and ER stress in human pancreatic beta cells, focusing on miR-211-5p. Of note, many of the presently described experiments were based on the use of a miR-211-5p inhibitor to evaluate the effects of mRNA-211-5p depletion in beta cell apoptosis and ER stress markers expression, but this inhibitor also decreases the expression of the closely related family member, miR-204-5p, recently shown to target PERK and modulate rodent beta cells apoptosis (Xu et al. 2016). Due to the very high similarity between these two miRNAs, it is not possible to obtain specific inhibitors for miR-211-5p or miR-204-5p. Thus, most findings described in the present study in cytokine-treated beta cells are probably the result of parallel miR-211-5p and miR-204-5p inhibition.

These observations indicate that two closely related miRNAs, namely miR-211-5p and miR-204-5p, regulate ER stress in human pancreatic beta cells exposed to pro-inflammatory cytokines.

Materials and methods

Ethic statements

Pancreases not suitable for clinical purposes were obtained from the Endocrinology and Metabolism of Organ and Cellular Transplantation unit at Cisanello University Hospital at the University of Pisa, Italy with informed written consent. They were processed with the approval of the Local Medical and Health Research Ethics Committees of the Pisa University, Italy. The donors were anonymized, and all experiments and methods using human pancreatic islets were approved by and performed in accordance with the guidelines and regulations made by the regional Medical and Health Research Ethics Committees of the Pisa University, Italy. No organs/tissues were procured from prisoners.

Culture of human islet cells and the human beta cell line endoC-βH1

Human islet isolation was performed using collagenase digestion and density gradient purification from 16 heart-beating brain-dead organ donors with no medical history of diabetes or metabolic disorders (Marchetti et al. 2007). The donors (nine men and seven women) were 72 ± 2 years old and had a BMI of 25 ± 0.6 (kg/m2) (Supplementary Table 1, see section on supplementary data given at the end of this article). The islets were cultured in M199 culture medium with 5.5 mmol/L glucose (Thermo Fisher Scientific) in Pisa and sent to Brussels within 1–5 days following isolation. After arrival in Brussels and overnight recovery, the islets were dispersed and cultured in Ham’s F-10 medium containing 6.1 mmol/L glucose (Thermo Fisher Scientific) as previously described (Moore et al. 2009, Eizirik et al. 2012). Islet beta cell purity (52 ± 4%) was evaluated by immunocytochemistry in dispersed islet cells using a specific anti-insulin antibody (Supplementary Table 2). The human insulin-producing EndoC-βH1 cell line (kindly provided by Dr R Scharfmann, University of Paris, France; RRID:CVCL_L909) (Ravassard et al. 2011) was cultured as described (Grieco et al. 2014, Brozzi et al. 2015).

Cell treatment

Human islet cells and insulin-producing EndoC-βH1 cells were exposed to recombinant human IL1B (R&D Systems), 50 U/mL and recombinant human IFNG (Peprotech, London, UK), 1000 U/mL; cytokine concentrations were selected based on our previous experiments (Eizirik et al. 1994, Moore et al. 2009, Brozzi et al. 2015). EndoC-βH1 cells were also exposed to 1 µM of the chemical ER stressor thapsigargin, (Sigma-Aldrich), based on previous experiments by our group (Cnop et al. 2014).

Transfection and RNA interference

Both EndoC-βH1 cells and human islet cells were transiently transfected with Lipofectamine RNAiMAX lipid reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. After 8 h transfection EndoC-βH1 cells and human islets cells were cultured for an additional 24-h or 48-h recovery period respectively before exposure to cytokines or thapsigargin. Single-stranded miRCURY LNA inhibitor (Sequence 5′-3′: GGCGAAGGATGACAAAGGGA, Exiqon, Vedbaek, Denmark) that blocks endogenous miR-211-5p was used at a concentration of 120 nmol/L based our own dose–response experiments (data not shown) and as described (Roggli et al. 2012, Grieco et al. 2017). The siRNA targeting CHOP (Sequence 5′-3′: GUCCUGUCUUCAGAUGAAtt, siRNA#1 s3995, Ambion-Thermo Fisher Scientific) has been previously validated by our group; this included comparison against a second siRNA that induces similar biological effects (Allagnat et al. 2012). The optimal concentration of siRNAs used for transfections (30 nmol/L) was previously established by our group (Moore et al. 2009, 2012). Allstar Negative Control siRNA (siCTRL) (Qiagen) was used as negative control. This siCTRL does not affect beta cell function, gene expression or viability as compared with non-transfected human islet cells (Moore et al. 2012) and EndoC-βH1 cells (data not shown).

Assessment of cell viability

Inverted fluorescence microscopy was used to determine viable, necrotic and apoptotic cells after 15-min incubation with the DNA dyes Hoechst 33342 (5 μg/mL) and propidium iodide (5 μg/ml) (Sigma-Aldrich). At least 600 cells were counted per experimental condition by two independent observers, with one of them unaware of the identity of the samples. This assay is quantitative and has been validated by systematic comparison against ladder formation, electron microscopy and caspase 3/9 activation (Hoorens et al. 1996, Moore et al. 2009).

Measurement of miRNA and mRNA expression

The miRNeasy micro kit (Qiagen) was used for isolation of total RNA. DNase digestion was done using Rnase-Free Dnase kit (Qiagen) according to the manufacturer’s instructions. RNA quality and quantity was evaluated by a Bio Drop instrument (Isogen Life Science, Utrecht, Netherlands). cDNAs preparation and determination of miRNA and mRNA expression were performed as described (Grieco et al. 2017). miRNA expression was evaluated using the Relative Quantification (RQ) method (RQ = 2−Δct and 2−ΔΔct). The concentration of the genes of interest was calculated as copies per µL using the standard curve method (Overbergh et al. 1999). Gene expression values were corrected for the housekeeping gene ACTB (actin beta expression in human islets is not affected by cytokine treatment; Cardozo et al. 2001, Moore et al. 2009). miRNAs expression were normalized by small nucleolar RNAs miR-U6 and miR-RD61 in the cytokine-only experiments and by miR-375-3p and let-7a-5p for experiments with transfected cells (this is specified for each experiment in the appropriate figure legend). The list of primers used in this study are provided in Supplementary Table 3.

Western blot and immunofluorescence

Cells were washed with cold PBS and lysed with Laemmli Sample Buffer for Western blot. Total proteins were then extracted, resolved by 8–14% SDS-PAGE and transferred to a nitrocellulose membrane. Immunoblot analysis for the proteins of interest was done by overnight incubation with the antibodies listed in Supplementary Table 2. Membranes were then incubated for 1 h at room temperature with secondary peroxidase-conjugated antibody (anti-IgG (H + L)-HRP). The immunoreactive bands were visualized with the SuperSignal West Femto chemiluminescent substrate (Thermo Fisher Scientific), detected by ChemiDoc XRS+ (Bio-Rad) and quantified using the Image Laboratory software (Bio-Rad). Densitometric values were normalized by the housekeeping protein Tubulin (or tubulin alpha 4a (TUBA4A)). Double immunofluorescence for insulin and cleaved caspase-3 was performed as previously described (Marroqui et al. 2015, Grieco et al. 2017). Immunofluorescence images were acquired on a Zeiss Imager A1 microscope via AxioVision software (Zeiss).

Statistical analysis

Data are presented as mean values ± s.e.m. or plotted as box plots, indicating lower quartile, median and higher quartile, with whiskers representing the range of the remaining data points when the number of experiments was ≥6 per condition. In some experiments data are represented as points indicating individual experiments. Statistical analysis was performed by two-tailed paired Student’s t-test or by ANOVA with post hoc Bonferroni, as appropriate, using GraphPad Prism 6 (GraphPad Software). A P value <0.05 was considered statistically significant.

Results

Cytokines co-regulate miR-211-5p and CHOP expression in human beta cells

We have previously identified 57 cytokines (IL1B+IFNG)-modified miRNAs in human islets using TaqMan Array Human MicroRNA Cards Panel A v2.1 (Grieco et al. 2017). Using miRNA-target prediction programs (TargetScan and TargetRank) and literature analysis (Chitnis et al. 2012, Bartoszewska et al. 2013, Malhi 2014), we have now searched for miRNAs that might modulate ER stress, particularly the pro-apoptotic transcription factor CHOP. Based on this analysis, we identified miR-211-5p as an interesting candidate, as it has been already shown to directly target CHOP (Chitnis et al. 2012). Among miRNAs downregulated after cytokines treatment, miR-211-5p was consistently modulated (i.e. changed in the same direction in each individual experiment) with a 74% decrease (i.e. fold value of 0.26 ± 0.02) vs controls (not treated with cytokines) whole human islet (Grieco et al. 2017). miR-211-5p belongs to the same family as miR-204-5p, previously found to modulate ER stress-related genes (Xu et al. 2016), regulate apoptosis in the human tubercular meshwork cells of the eye (Li et al. 2011) and promote vascular ER stress and endothelial dysfunction (Kassan et al. 2017). miR-204-5p, however, was not considered downregulated after cytokine treatment in our analysis, since it did not reach the established cut-off value of fold-change ≤0.75 vs untreated islets (the observed fold-change of cytokine-treated vs controls was 0.79) (Grieco et al. 2017). Against this background, we initially focused on miR-211-5p. Cytokine-induced downregulation of miR-211-5p was first confirmed in the same set of samples used for the miRNA expression profiling (Grieco et al. 2017). miR-211-5p was found downregulated after cytokines treatment with a fold-change of 0.65 ± 0.04 vs controls (not treated) human islets cells (n = 3). We next investigated whether the target gene CHOP was regulated by cytokine treatment in an opposite manner as compared to miR-211-5p. Following cytokine treatment, there was a significant decrease of miR-211-5p expression in dispersed human islets (Fig. 1A) and in human insulin-producing EndoC-βH1 cells (Fig. 1C), which was paralleled by a significant increase in mRNA expression of CHOP (Fig. 1B and D). We also tested miR-211-5p and CHOP expression in whole human islets after cytokine treatment and found the same trend in decrease for the first and increase for the second (Supplementary Fig. 1). miR-211-5p was also downregulated by the ER stressor thapsigargin (Supplementary Fig. 2A) in EndoC-βH1 cells, again paralleled by increased expression of CHOP (Supplementary Fig. 2B).

Figure 1
Figure 1

Cytokines co-regulate miR-211-5p and CHOP expression in human beta cells. Dispersed human islets cells (A and B) and EndoC-βH1 cells (C and D) were left untreated or treated with IL1B+IFNG for 48 h. Expression of miR-211-5p (A and C) was assayed by RT-PCR and normalized by two different small nucleolar RNAs (miR-U6 and miR-RD61). Expression of CHOP (B and D) was evaluated by RT-PCR and normalized by the housekeeping gene ACTB. The results are shown as individual experiments, before and after cytokines treatment; n = 5–6 independent experiments. *P < 0.05 and **P < 0.01 vs untreated cells; paired Student’s t-test.

Citation: Journal of Molecular Endocrinology 63, 2; 10.1530/JME-19-0066

Knockdown of CHOP protects EndoC-βH1 cells against cytokine-induced apoptosis in the context of miR-211-5p inhibition

To determine whether CHOP is regulated by miR-211-5p in beta cells, we next used a miR-211-5p inhibitor and observed a clear upregulation of CHOP mRNA expression both in untreated and cytokine-treated EndoC-βH1 cells (Fig. 2A). This miR-211-5p inhibitor-dependent induction of CHOP was abrogated when we combined the miR-211-5p inhibitor with a siRNA targeting CHOP in both untreated and cytokine-treated human EndoC-βH1 cells (Fig. 2A). The inhibition of miR-211-5p, in the range of 60–70%, was confirmed by real-time qPCR (Fig. 2B). The strong CHOP induction after miR-211-5p inhibition led to increased apoptosis in both untreated and cytokine-treated human EndoC-βH1 cells (Fig. 2C); interestingly, there seems to be a feedback mechanism between CHOP and miR-211, as miR-211-5p inhibition is less marked after blocking CHOP. Importantly, blocking CHOP induction in parallel to miR-211-5p inhibition partially prevented the increase in apoptosis observed in cytokine-treated cells (Fig. 2C), indicating that CHOP upregulation is at least in part responsible for the cell death observed following miR-211-5p inhibition.

Figure 2
Figure 2

KD of CHOP protects EndoC-βH1 cells against cytokine-induced apoptosis in the context of miR-211-5p inhibition. EndoC-βH1 cells were transfected with siCTRL, siCHOP, an anti-miRNA targeting miR-211-5p (anti-miR-211) or co-transfected with both siCHOP + anti-miR-211 (A, B and C) for 8 h. After 24 h of recovery, cells were left untreated or treated with IL1B+IFNG for 48 h as indicated. The KD of CHOP (A) was confirmed by RT-PCR, normalized by the housekeeping gene ACTB. Expression of miR-211-5p (B) was assayed by RT-PCR and normalized by miR-375-3p and let-7a-5p expression. Apoptosis was evaluated by propidium iodide/Hoechst staining after 48 h of cytokine treatment (C). In (A) results were normalized against the highest value in each independent experiment, considered as 1. Data shown are mean ± s.e.m. of 6–7 independent experiments (A, B and C). *P < 0.05, **P < 0.01 and ***P < 0.001 vs siCTRL untreated cells; $ P < 0.05, $$ P < 0.01 and $$$ P < 0.001 vs siCTRL cytokine-treated cells; §§ P < 0.01 and §§§ P < 0.001 as indicated by bars; ANOVA followed by Bonferroni’s correction.

Citation: Journal of Molecular Endocrinology 63, 2; 10.1530/JME-19-0066

Inhibition of miR-211-5p exacerbates apoptosis of human beta cells

In a subsequent set of experiments, the single-stranded miRNA inhibitor was used to block endogenous miR-211-5p expression in both human EndoC-βH1 cells and human dispersed islets cells, leading to a 60 and 80% decrease in miR-211-5p expression in human EndoC-βH1 cells and human islets respectively (Fig. 3A and F). The miR-211-5p inhibitor exacerbated both basal and cytokine-induced apoptosis, as evaluated by nuclear dyes, in both human EndoC-βH1 cells and human islets (Fig. 3B and G, respectively). In line with these observations, the inhibition of miR-211-5p increased expression of cleaved caspase-3 in human EndoC-βH1 cells (Fig. 3C and D) as evaluated by Western blot, confirming cell death activation. Similar findings were observed by double immunofluorescence for insulin and cleaved caspase-3 in human EndoC-βH1 cells (Supplementary Fig. 3). For each experimental condition the percentage of cleaved caspase-3 positive cells is shown in Fig. 3E. Similar observations were obtained in human dispersed islets cells (Supplementary Fig. 4), indicating that at least part of the observed cell death in human islet cells takes place at the beta cell level.

Figure 3
Figure 3

Inhibition of miR-211-5p exacerbates apoptosis of human beta cells. EndoC-βH1 cells (A, B, C, D and E) were transfected with siCTRL or with an anti-miRNA targeting miR-211-5p (anti-miR-211) for 8 h. After 24 h of recovery, the cells were left untreated or treated with IL1B+IFNG for 48 h as indicated. The expression of miR-211-5p (A) was assayed by RT-PCR and normalized by miR-375-3p expression. Apoptosis was evaluated by propidium iodide/Hoechst staining after 48 h of cytokine treatment (B). Cleaved caspase-3 and Tubulin protein expression were evaluated by western blot after 48 h of cytokine treatment; one representative blot of six independent experiments is shown (C). The optical density of cleaved caspase-3 (example shown in C) was quantified and corrected by T tubulin expression (D). After cytokine treatment, cells were fixed and used for histological studies (as indicated in Supplementary Fig. 3). The quantification of fluorescent cleaved caspase-3 positive cells is shown (E). Dispersed human islets cells (F and G) were transfected with siCTRL or with an anti-miRNA targeting miR-211-5p (anti-miR-211) for 8 h. After 48 h of recovery, the cells were left untreated or treated with IL1B+IFNG for 48 h as indicated. The expression of miR-211-5p (F) was assayed by RT-PCR and normalized by miR-375-3p and let-7a-5p expression. Apoptosis was evaluated by propidium iodide/Hoechst staining after 48 h of cytokine treatment (G). The results are represented as box plots, indicating lower quartile, median, and higher quartile, with whiskers representing the range of the remaining data points (B and E); n = 4–6 independent experiments. In (D) results were normalized against the highest value in each independent experiment, considered as 1. Data shown are mean ± s.e.m. of six independent experiments (A and D) or three independent experiments (F). In (G) the results are represented as box plots, indicating lower value, mean and higher value; n = 3 independent experiments. *P < 0.05, **P < 0.01 and ***P < 0.001 vs siCTRL-untreated cells; $ P < 0.05, $$ P < 0.01 and $$$ P < 0.001 vs siCTRL cytokine-treated cells; § P < 0.05 as indicated by bars; ANOVA followed by Bonferroni’s correction (A, B, D and E); paired Student’s t-test (F and G). The order of the bands in the blot image (C) is the same as in the quantification histogram (D): from left to right are indicated respectively untreated cells transfected with a control siRNA, untreated cells transfected with the miR-211-5p inhibitor, cytokine-treated cells transfected with a control siRNA and last cytokine-treated cells transfected with the miR-211-5p inhibitor. Full-length blots are presented in Supplementary Fig. 8.

Citation: Journal of Molecular Endocrinology 63, 2; 10.1530/JME-19-0066

miR-211-5p inhibition increases expression of ER stress markers in EndoC-βH1 cells in a PERK-dependent manner

In order to elucidate the molecular mechanisms by which miR-211-5p regulates ER stress we used two different miRNA-target prediction programs, namely TargetScan and TargetRank (Nielsen et al. 2007, Agarwal et al. 2015) to determine whether other ER stress genes are potential targets of miR-211-5p. Both programs found that PERK, one of the three key ER transmembrane sensors (Ron & Walter 2007, Eizirik et al. 2008), is a predicted target of two miRNAs belonging to the same family, namely miR-211-5p and miR-204-5p (Fig. 4A). Exposure of EndoC-βH1 cells to the miR-211-5p inhibitor increased mRNA expression of PERK both in untreated and cytokine-treated human EndoC-βH1 cells (Fig. 4B). These results suggested that miR-211-5p targets and inhibits PERK in beta cells. In line with this finding, upregulation at the mRNA level was observed for the transcription factors downstream of PERK, ATF4, ATF3, and CHOP (Fig. 4D, E and F, respectively), as well as for EIF2A (Fig. 4C). In agreement with mRNA expression, the miR-211-5p inhibitor increased basal protein expression of PERK (Fig. 5A and B), ATF4 (Fig. 5D and F) and ATF3 (Fig. 5D and H) and, to a less extent, of p-EIF2A and EIF2A (Fig. 5C, E and G) in EndoC-βH1 cells. These effects of the miR-211-5p inhibitor were less marked following cytokine treatment (Fig. 5A, B, C, D, E, F, G and H). On the other hand, miR-211-5p inhibition had not effect on the two other branches of the ER response pathways, namely ATF6 and IRE1A, as evaluated by mRNA and protein expression for HSPA5 (also known as BIP) (downstream of ATF6; Supplementary Fig. 5A, C and D) and mRNA expression of XBP1s (downstream of IRE1A; Supplementary Fig. 5B), respectively. Taken together, these results indicate that miR-211-5p has a preferential effect on the PERK pathway, consistent with its predicted binging site on the 3′UTR of PERK (Fig. 4A).

Figure 4
Figure 4

miR-211-5p inhibition increases mRNA expression of ER stress markers in EndoC-βH1 cells in a PERK-dependent manner. (A) Alignment of miR-211-5p and miR-204-5p, miRNAs belonging to the same family; seed sequence (gray shading) and predicted binding site for the miRNAs (gray shading) of human EIF2AK3 (also known as PERK) 3′UTR using TargetScan software version 7.1. EndoC-βH1 cells (B, C, D, E and F) were transfected with siCTRL or with an anti-miRNA targeting miR-211-5p (anti-miR-211) for 8 h. After 24 h of recovery, the cells were left untreated or treated with IL1B+IFNG for 48 h as indicated. Expression of PERK (B), EIF2A (C), ATF4 (D), ATF3 (E) and CHOP (F) were assayed by RT-PCR and normalized by the housekeeping gene ACTB. In (B, C, D, E and F) results were normalized against the highest value in each independent experiment, considered as 1. Data shown are mean ± s.e.m. of six independent experiments (B, C, D, E and F). *P < 0.05, **P < 0.01 and ***P < 0.001 vs siCTRL-untreated cells; $ P < 0.05, $$ P < 0.01 and $$$ P < 0.001 vs siCTRL cytokine-treated cells; § P < 0.05 and §§§ P < 0.001 as indicated by bars; ANOVA followed by Bonferroni’s correction.

Citation: Journal of Molecular Endocrinology 63, 2; 10.1530/JME-19-0066

Figure 5
Figure 5

miR-211-5p inhibition increases protein expression of ER stress markers in EndoC-βH1 cells in a PERK-dependent manner. Human insulin-producing EndoC-βH1 cells (A, B, C, D, E, F, G and H) were transfected with siCTRL or with an anti-miRNA targeting miR-211-5p (anti-miR-211) for 8 h. After 24 h of recovery, the cells were left untreated or treated with IL1B+IFNG for 48 h as indicated. PERK and Tubulin expression were evaluated by western blot after 48 h of cytokines treatment; one representative blot of eight independent experiments is shown; the order of the lanes is similar to the ones shown in (B). (A). The optical density quantification of PERK (example shown in A) was quantified and corrected by Tubulin expression (B). p-EIF2A, EIF2A and Tubulin expression were evaluated by western blot after 48 h of cytokine treatment; one representative blot of 9–11 independent experiments is shown (C). The optical density of p-EIF2A (E) and EIF2A (G) bands (shown in C) was quantified and corrected by Tubulin expression. ATF4, ATF3 and Tubulin expression were evaluated by Western blot after 48 h of cytokine treatment; one representative blot of 8–9 independent experiments is shown (D). The optical density of ATF4 (F) and ATF3 (H) bands (shown in D) was quantified and corrected by Tubulin expression. In (B and E, F, G, H) results were normalized against the highest value in each independent experiment, considered as 1. Data shown are mean ± s.e.m. of 8–11 independent experiments. *P < 0.05, **P < 0.01 and ***P < 0.001 vs untreated cells; $ P < 0.05 vs siCTRL cytokine-treated cells; ANOVA followed by Bonferroni’s correction. The order of the bands in the blot images (A, C and D) is the same as in the quantification histograms (B and E, F, G, H, respectively): from left to right are indicated respectively untreated cells transfected with a control siRNA, untreated cells transfected with the miR-211 inhibitor, cytokine-treated cells transfected with a control siRNA and last cytokine-treated cells transfected with the miR-211-5p inhibitor. Full-length blots are presented in Supplementary Fig. 9.

Citation: Journal of Molecular Endocrinology 63, 2; 10.1530/JME-19-0066

To investigate whether miR-211-5p also regulates PERK and its downstream transcription factors in the context of a ‘pure’ ER stress, Endo-βH1 cells transfected with the miR-211-5p inhibitor were exposed to the chemical ER stressor thapsigargin. In line with the cytokine data (see above), the miR-211-5p inhibitor exacerbated apoptosis in both untreated and thapsigargin-treated cells (Supplementary Fig. 6A). There was also increased mRNA expression of PERK, ATF4, ATF3 and CHOP, but not in EIF2A (Supplementary Fig. 6B, D, E, F and C, respectively) in miR-211-5p-depleted and thapsigargin-treated cells. The inhibition of miR-211-5p (30-40%) was confirmed by real-time qPCR (data not shown).

miR-211-5p inhibition increases expression of pro-apoptotic Bcl-2 family members in human EndoC-βH1 cells

ER stress-mediated cell death is executed via the canonical mitochondrial apoptosis pathway, with BH3-only BCL2 family members DP5 and PUMA playing a crucial role (Gurzov et al. 2009, Urra et al. 2013). miR-211-5p inhibition in untreated and cytokine-treated Endo-βH1 cells increased mRNA expression of the transcription factor JUN (also known as c-JUN, a key regulator of DP5 expression in beta cells; Gurzov et al. 2009, Supplementary Fig. 7A), and both DP5 and PUMA (Supplementary Fig. 7B and C, respectively). On the other hand, miR-211-5p inhibition did not modify BAX, BIM, PMAIP1 (also known as NOXA), MCL1 and BCL2L1 mRNA expression (data not shown). The miR-211-5p-dependent increase of c-JUN and DP5 was not mediated by CHOP since it was not reverted by its parallel inhibition (Supplementary Fig. 7A and B, respectively). On the other hand, CHOP KD partially reverted PUMA induction following miR-211-5p inhibition (Supplementary Fig. 7C). Taken together, these results suggest that miR-211-5p may also contribute to beta cell apoptosis, besides its effects on ER stress, by modulating directly or indirectly the expression of key pro-apoptotic BCL2 protein family members. The mechanisms involved in this modulation remain to be clarified but they may be mediated at least in part via upregulation of the transcription factor c-JUN (Supplementary Fig. 7A).

Cytokines downregulate miR-204-5p expression and miR-211-5p inhibition decreases miR-204-5p expression

While the present work was in progress, a new and interesting study reported that miR-204-5p targets PERK and regulates UPR signaling and beta cells apoptosis (Xu et al. 2016). Moreover, other studies described the importance of miR-204-5p in beta cell function and endocrine phenotype in rodent and human pancreatic islets (Xu et al. 2013), with a controversial role of miR-204-5p in regulating insulin mRNA expression trough MAFA (Marzinotto et al. 2017). In light of all these observations, we re-evaluated the impact of cytokines on miR-204-5p expression, and confirmed that miR-204-5p is indeed down-regulated by cytokines in both dispersed human islets and in human EndoC-βH1 cells (Fig. 6A and B, respectively). Surprisingly, miR-204-5p expression was not downregulated by thapsigargin exposure (Fig. 6C), suggesting that miR-204-5p inhibition is a specific effect of cytokines exposure.

Figure 6
Figure 6

Cytokines but not thapsigargin down-regulate miR-204-5p expression. The use of a miR-211-5p inhibitior also decreases miR-204-5p expression. Dispersed human islets cells (A) and human insulin-producing EndoC-βH1 cells (B and C), were left untreated or treated with IL1B+IFNG for 48h (A and B) and with the ER stressor thapsigargin for 24 h (C) as indicated. Expression of miR-204-5p was assayed by RT-PCR and normalized by two different small nucleolar RNAs (miR-U6 and miR-RD61). The results are represented as individual experiments; n = 5–6 independent experiments. **P < 0.01 vs untreated cells; paired Student’s t-test. Human insulin-producing EndoC-βH1 cells (D) and human dispersed islets cells (E) were transfected with siControl (CTRL) or with an anti-miRNA targeting miR-211-5p (anti-miR-211) for 8 h. After 24 h (D) and 48 h (E) of recovery, cells were left untreated of treated with IL1B+IFNG for 48 h as indicated. Expression of miR-204-5p was assayed by RT-PCR and normalized by and miR-375-3p and let7a-5p expression. Data shown are mean ± s.e.m. of six independent experiments (D) or three independent experiments (E). **P < 0.01 and ***P < 0.001 vs siCTRL untreated cells; $$$ P < 0.001 vs siCTRL cytokines-treated cells; ANOVA followed by Bonferroni’s correction.

Citation: Journal of Molecular Endocrinology 63, 2; 10.1530/JME-19-0066

Due to the close similarity between miR-211-5p and miR-204-5p, we next evaluated whether the presently utilized miR-211-5p inhibitor also affects miR-204-5p expression. There was indeed an important cross-reaction, with the miR-211-5p inhibitor decreasing the expression of both miRNAs in human EndoC-βH1 cells (Figs 3A and 6D) and in human dispersed islets cells (Figs 3F and 6E). Thus, the above-described findings based on the use of this inhibitor should be interpreted as mediated by inhibition of a family of miRNAs comprising both miR-211-5p and miR-204-5p, and not miR-211-5p alone.

Discussion

MicroRNAs are key regulators of gene expression and have been associated to autoimmunity progression and diabetes development (Ventriglia et al. 2015, Martinez-Sanchez et al. 2016). We have recently reported that the miRNAs miR-23a, miR-23b and miR-149-5p sensitize human beta cells to cytokine-induced apoptosis by modulating the expression of the BH3-only proteins DP5 and PUMA in human pancreatic beta cells (Grieco et al. 2017). In the present study, we show that the family of miRs-211-5p and -204-5p act as regulators of ER stress, particularly of the downstream pro-apoptotic transcription factor CHOP in a PERK-dependent manner. We first observed a parallel cytokine-induced downregulation of miR-211-5p and upregulation of CHOP in human islets (Grieco et al. 2017 and present data), suggesting that this could be an important mechanism by which cytokines upregulate CHOP. We subsequently used a miR-211-5p inhibitor to evaluate the effects of mRNA-211-5p depletion in beta cell apoptosis and ER stress markers expression. This inhibitor also decreases expression of miR-204-5p, a closely related family member. miR-204-5p was recently shown to target PERK and modulate rodent beta cells apoptosis (Xu et al. 2016) and due to the close similarity between these two miRNAs we could not design specific inhibitors for miR-211-5p or miR-204-5p. Taking this into account, the bulk of the present findings in cytokine-treated human beta cells are probably the result of parallel miR-211-5p and miR-204-5p inhibition. Expression of miR-204-5p is at least 50-fold higher in human beta cells than the expression of miR-211-5p (our own unpublished data; this is line with a previous study from Kameswaran and colleagues showing an even more marked different between miR-204-5p and miR-211-5p expression; Kameswaran et al. 2014), suggesting that miR-204-5p may have a more relevant biologically function than miR-211-5p. On the other hand, the fact that miR-211-5p, but not miR-204-5p, is inhibited by the pure ER stressor thapsigargin suggests that under some experimental conditions miR-211-5p may play a more relevant role in cellular responses.

miR-211-5p inhibition increased both basal and cytokine- or thapsigargin-induced apoptosis. This was paralleled by an increased expression of ER stress markers downstream of the PERK branch, namely EIF2A, ATF4, ATF3 and CHOP. On the other hand, there were no modifications in BIP and XBP1s, which are regulated by the two other branches of UPR, namely ATF6 and IRE1A, reinforcing the idea that the miR-211-5p family targets specifically PERK and downstream genes.

Besides its effect on ER stress, miR-211-5p depletion upregulates the expression of pro-apoptotic BCL2 proteins DP5 and PUMA, at least in part via the upregulation of c-JUN, a transcription factor previously shown by us to modulate DP5 expression (Gurzov et al. 2009). KD of CHOP in parallel with miR-211-5p inhibition partially prevents the upregulation of PUMA and the pro-apoptotic effects of miR-211-5p inhibition, suggesting that the miR-211-5p family may be a key component in the crosstalk between ER stress and pro-apoptotic BCL2 family members in human beta cells.

In conclusion, the cytokines (IL1B+IFNG) inhibit the expression of both miR-211-5p and miR-204-5p in human beta cells. Decreased expression of these inhibitory miRNAs enables – directly or indirectly – the upregulation of PERK and c-JUN. PERK activation triggers EIF2A, ATF4, ATF3 and CHOP, while the transcription factor c-JUN contributes for the upregulation of the pro-apoptotic BH3-only proteins DP5 and PUMA. CHOP probably also contributes to upregulate PUMA. Activation of these two pathways culminates in caspase-3 activation and beta cell apoptosis. As a whole, the present and previous findings (Xu et al. 2016) indicate that the miR-211-5p and miR-204-5p family is a key hub in the regulation of cytokine-induced ER stress and pro-apoptotic pathways in human beta cells.

Supplementary data

This is linked to the online version of the paper at https://doi.org/10.1530/JME-19-0066.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by grants from European Union (the European Union’s Horizon 2020 research and innovation program project T2DSystems, under grant agreement No 667191) and the ‘NIH-NIDDK-HIRN Consortium Grant 1UC4DK104166-01’ to D L E. D L E and P M have received funding from the Innovative Medicines Initiative 2 Joint Undertaking under grant agreement No 115797 (INNODIA). This Joint Undertaking receives support from the Union’s Horizon 2020 research and innovation program and ‘EFPIA’, ‘JDRF’ and ‘The Leona M. and Harry B. Helmsley Charitable Trust’.

Author contribution statement

F A G, F B and D L E conceived and designed the experiments. F A G, F B, J J M, A A S, M B and P M acquired data. D L E supervised the study. F A G, A A S and D L E wrote the paper. All authors revised the final version of the manuscript. D L E is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Acknowledgements

The authors are grateful to the personnel from the ULB Center for Diabetes Research including I Millard, A Musuaya, M Pangerl and N Pachera for the excellent technical support.

References

  • Agarwal V, Bell GW, Nam JW & Bartel DP 2015 Predicting effective microRNA target sites in mammalian mRNAs. eLife 4 e05005. (https://doi.org/10.7554/eLife.05005)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Allagnat F, Fukaya M, Nogueira TC, Delaroche D, Welsh N, Marselli L, Marchetti P, Haefliger JA, Eizirik DL & Cardozo AK 2012 C/EBP homologous protein contributes to cytokine-induced pro-inflammatory responses and apoptosis in β-cells. Cell Death and Differentiation 19 . (https://doi.org/10.1038/cdd.2012.67)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bartel DP 2004 MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116 . (https://doi.org/10.1016/s0092-8674(04)00045-5)

  • Bartoszewska S, Kochan K, Madanecki P, Piotrowski A, Ochocka R, Collawn JF & Bartoszewski R 2013 Regulation of the unfolded protein response by microRNAs. Cellular and Molecular Biology Letters 18 . (https://doi.org/10.2478/s11658-013-0106-z)

    • Search Google Scholar
    • Export Citation
  • Brozzi F & Eizirik DL 2016 ER stress and the decline and fall of pancreatic beta cells in type 1 diabetes. Upsala Journal of Medical Sciences 121 . (https://doi.org/10.3109/03009734.2015.1135217)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Brozzi F, Nardelli TR, Lopes M, Millard I, Barthson J, Igoillo-Esteve M, Grieco FA, Villate O, Oliveira JM, Casimir M, 2015 Cytokines induce endoplasmic reticulum stress in human, rat and mouse beta cells via different mechanisms. Diabetologia 58 . (https://doi.org/10.1007/s00125-015-3669-6)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Byrd AE & Brewer JW 2013 Micro(RNA)managing endoplasmic reticulum stress. IUBMB Life 65 . (https://doi.org/10.1002/iub.1151)

  • Cardozo AK, Kruhoffer M, Leeman R, Orntoft T & Eizirik DL 2001 Identification of novel cytokine-induced genes in pancreatic beta-cells by high-density oligonucleotide arrays. Diabetes 50 . (https://doi.org/10.2337/diabetes.50.5.909)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chitnis NS, Pytel D, Bobrovnikova-Marjon E, Pant D, Zheng H, Maas NL, Frederick B, Kushner JA, Chodosh LA, Koumenis C, 2012 miR-211 is a prosurvival microRNA that regulates chop expression in a PERK-dependent manner. Molecular Cell 48 . (https://doi.org/10.1016/j.molcel.2012.08.025)

    • Search Google Scholar
    • Export Citation
  • Cnop M, Welsh N, Jonas JC, Jörns A, Lenzen S & Eizirik DL 2005 Mechanisms of pancreatic beta-cell death in type 1 and type 2 diabetes: many differences, few similarities. Diabetes 54 (Supplement 2) S97S107. (https://doi.org/10.2337/diabetes.54.suppl_2.s97)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Cnop M, Abdulkarim B, Bottu G, Cunha DA, Igoillo-Esteve M, Masini M, Turatsinze JV, Griebel T, Villate O, Santin I, 2014 RNA sequencing identifies dysregulation of the human pancreatic islet transcriptome by the saturated fatty acid palmitate. Diabetes 63 . (https://doi.org/10.2337/db13-1383)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Cnop M, Toivonen S, Igoillo-Esteve M & Salpea P 2017 Endoplasmic reticulum stress and eIF2α phosphorylation: the Achilles heel of pancreatic β cells. Molecular Metabolism 6 . (https://doi.org/10.1016/j.molmet.2017.06.001)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dambal S, Shah M, Mihelich B & Nonn L 2015 The microRNA-183 cluster: the family that plays together stays together. Nucleic Acids Research 43 . (https://doi.org/10.1093/nar/gkv703)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Eizirik DL & Cnop M 2010 ER stress in pancreatic beta cells: The thin red line between adaptation and failure. Science Signaling 3 pe7. (https://doi.org/10.1126/scisignal.3110pe7)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Eizirik DL, Sandler S, Welsh N, Cetkovic-Cvrlje M, Nieman A, Geller DA, Pipeleers DG, Bendtzen K & Hellerstrom C 1994 Cytokines suppress human islet function irrespective of their effects on nitric oxide generation. Journal of Clinical Investigation 93 . (https://doi.org/10.1172/JCI117188)

    • Search Google Scholar
    • Export Citation
  • Eizirik DL, Cardozo AK & Cnop M 2008 The role for endoplasmic reticulum stress in diabetes mellitus. Endocrine Reviews 29 . (https://doi.org/10.1210/er.2007-0015)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Eizirik DL, Colli ML & Ortis F 2009 The role of inflammation in insulitis and beta-cell loss in type 1 diabetes. Nature Reviews: Endocrinology 5 . (https://doi.org/10.1038/nrendo.2009.21)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Eizirik DL, Sammeth M, Bouckenooghe T, Bottu G, Sisino G, Igoillo-Esteve M, Ortis F, Santin I, Colli ML, Barthson J, 2012 The human pancreatic islet transcriptome: expression of candidate genes for type 1 diabetes and the impact of pro-inflammatory cytokines. PLoS Genetics 8 e1002552. (https://doi.org/10.1371/journal.pgen.1002552)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Eizirik DL, Miani M & Cardozo AK 2013 Signalling danger: endoplasmic reticulum stress and the unfolded protein response in pancreatic islet inflammation. Diabetologia 56 . (https://doi.org/10.1007/s00125-012-2762-3)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Engin F, Yermalovich A, Nguyen T, Hummasti S, Fu W, Eizirik DL, Mathis D & Hotamisligil GS 2013 Restoration of the unfolded protein response in pancreatic beta cells protects mice against type 1 diabetes. Science Translational Medicine 5 211ra156. (https://doi.org/10.1126/scitranslmed.3006534)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Floyel T, Kaur S & Pociot F 2015 Genes affecting beta-cell function in type 1 diabetes. Current Diabetes Reports 15 97. (https://doi.org/10.1007/s11892-015-0655-9)

  • Friedman RC, Farh KK, Burge CB & Bartel DP 2009 Most mammalian mRNAs are conserved targets of microRNAs. Genome Research 19 . (https://doi.org/10.1101/gr.082701.108)

    • Search Google Scholar
    • Export Citation
  • Grieco FA, Moore F, Vigneron F, Santin I, Villate O, Marselli L, Rondas D, Korf H, Overbergh L, Dotta F, 2014 IL-17A increases the expression of proinflammatory chemokines in human pancreatic islets. Diabetologia 57 . (https://doi.org/10.1007/s00125-013-3135-2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Grieco FA, Sebastiani G, Juan-Mateu J, Villate O, Marroqui L, Ladriere L, Tugay K, Regazzi R, Bugliani M, Marchetti P, 2017 MicroRNAs miR-23a-3p, miR-23b-3p, and miR-149-5p regulate the expression of proapoptotic BH3-only proteins DP5 and PUMA in human pancreatic beta-cells. Diabetes 66 . (https://doi.org/10.2337/db16-0592)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gurzov EN, Ortis F, Cunha DA, Gosset G, Li M, Cardozo AK & Eizirik DL 2009 Signaling by IL-1beta+IFN-gamma and ER stress converge on DP5/Hrk activation: a novel mechanism for pancreatic beta-cell apoptosis. Cell Death and Differentiation 16 . (https://doi.org/10.1038/cdd.2009.99)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Haier J, Strose A, Matuszcak C & Hummel R 2016 miR clusters target cellular functional complexes by defining their degree of regulatory freedom. Cancer Metastasis Reviews 35 . (https://doi.org/10.1007/s10555-016-9617-1)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hoorens A, Van de Casteele M, Kloppel G & Pipeleers D 1996 Glucose promotes survival of rat pancreatic beta cells by activating synthesis of proteins which suppress a constitutive apoptotic program. Journal of Clinical Investigation 98 . (https://doi.org/10.1172/JCI118950)

    • Search Google Scholar
    • Export Citation
  • Isaacs SR, Wang J, Kim KW, Yin C, Zhou L, Mi QS & Craig ME 2016 Complex interregulation of the immune system, beta cell function and viral infections. Current Diabetes Reports 16 133. (https://doi.org/10.1007/s11892-016-0819-2)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kameswaran V, Bramswig NC, McKenna LB, Penn M, Schug J, Hand NJ, Chen Y, Choi I, Vourekas A, Won KJ, 2014 Epigenetic regulation of the DLK1-MEG3 microRNA cluster in human type 2 diabetic islets. Cell Metabolism 19 . (https://doi.org/10.1016/j.cmet.2013.11.016)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kassan M, Vikram A, Li Q, Kim YR, Kumar S, Gabani M, Liu J, Jacobs JS & Irani K 2017 MicroRNA-204 promotes vascular endoplasmic reticulum stress and endothelial dysfunction by targeting sirtuin. Scientific Reports 7 9308. (https://doi.org/10.1038/s41598-017-06721-y)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Li G, Luna C, Qiu J, Epstein DL & Gonzalez P 2011 Role of miR-204 in the regulation of apoptosis, endoplasmic reticulum stress response, and inflammation in human trabecular meshwork cells. Investigative Ophthalmology and Visual Science 52 . (https://doi.org/10.1167/iovs.10-6708)

    • Search Google Scholar
    • Export Citation
  • Malhi H 2014 MicroRNAs in ER stress: divergent roles in cell fate decisions. Current Pathobiology Reports 2 . (https://doi.org/10.1007/s40139-014-0046-y)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Marchetti P, Bugliani M, Lupi R, Marselli L, Masini M, Boggi U, Filipponi F, Weir GC, Eizirik DL & Cnop M 2007 The endoplasmic reticulum in pancreatic beta cells of type 2 diabetes patients. Diabetologia 50 . (https://doi.org/10.1007/s00125-007-0816-8)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Marhfour I, Lopez XM, Lefkaditis D, Salmon I, Allagnat F, Richardson SJ, Morgan NG & Eizirik DL 2012 Expression of endoplasmic reticulum stress markers in the islets of patients with type 1 diabetes. Diabetologia 55 . (https://doi.org/10.1007/s00125-012-2604-3)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Marroqui L, Dos Santos RS, Floyel T, Grieco FA, Santin I, Op de Beeck A, Marselli L, Marchetti P, Pociot F & Eizirik DL 2015 TYK2, a candidate gene for type 1 diabetes, modulates apoptosis and the innate immune response in human pancreatic beta-cells. Diabetes 64 . (https://doi.org/10.2337/db15-0362)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Martinez-Sanchez A, Rutter GA & Latreille M 2016 miRNAs in beta-cell development, identity, and disease. Frontiers in Genetics 7 226. (https://doi.org/10.3389/fgene.2016.00226)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Marzinotto I, Pellegrini S, Brigatti C, Nano R, Melzi R, Mercalli A, Liberati D, Sordi V, Ferrari M, Falconi M, 2017 miR-204 is associated with an endocrine phenotype in human pancreatic islets but does not regulate the insulin mRNA through MAFA. Scientific Reports 7 14051. (https://doi.org/10.1038/s41598-017-13622-7)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Maurel M & Chevet E 2013 Endoplasmic reticulum stress signaling: the microRNA connection. American Journal of Physiology: Cell Physiology 304 C1117C1126. (https://doi.org/10.1152/ajpcell.00061.2013)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Moore F, Colli ML, Cnop M, Esteve MI, Cardozo AK, Cunha DA, Bugliani M, Marchetti P & Eizirik DL 2009 PTPN2, a candidate gene for type 1 diabetes, modulates interferon-gamma-induced pancreatic beta-cell apoptosis. Diabetes 58 . (https://doi.org/10.2337/db08-1510)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Moore F, Cunha DA, Mulder H & Eizirik DL 2012 Use of RNA interference to investigate cytokine signal transduction in pancreatic beta cells. Methods in Molecular Biology 820 . (https://doi.org/10.1007/978-1-61779-439-1_11)

    • Search Google Scholar
    • Export Citation
  • Nielsen CB, Shomron N, Sandberg R, Hornstein E, Kitzman J & Burge CB 2007 Determinants of targeting by endogenous and exogenous microRNAs and siRNAs. RNA 13 . (https://doi.org/10.1261/rna.768207)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Overbergh L, Valckx D, Waer M & Mathieu C 1999 Quantification of murine cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine 11 . (https://doi.org/10.1006/cyto.1998.0426)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ravassard P, Hazhouz Y, Pechberty S, Bricout-Neveu E, Armanet M, Czernichow P & Scharfmann R 2011 A genetically engineered human pancreatic beta cell line exhibiting glucose-inducible insulin secretion. Journal of Clinical Investigation 121 . (https://doi.org/10.1172/JCI58447)

    • Search Google Scholar
    • Export Citation
  • Rodriguez-Comas J, Moreno-Asso A, Moreno-Vedia J, Martin M, Castano C, Marza-Florensa A, Bofill-De Ros X, Mir-Coll J, Montane J, Fillat C, 2017 Stress-induced microRNA-708 impairs beta-cell function and growth. Diabetes 66 . (https://doi.org/10.2337/db16-1569)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Roggli E, Gattesco S, Caille D, Briet C, Boitard C, Meda P & Regazzi R 2012 Changes in microRNA expression contribute to pancreatic beta-cell dysfunction in prediabetic NOD mice. Diabetes 61 . (https://doi.org/10.2337/db11-1086)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ron D & Walter P 2007 Signal integration in the endoplasmic reticulum unfolded protein response. Nature Reviews: Molecular Cell Biology 8 . (https://doi.org/10.1038/nrm2199)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Santin I & Eizirik DL 2013 Candidate genes for type 1 diabetes modulate pancreatic islet inflammation and beta-cell apoptosis. Diabetes, Obesity and Metabolism 15 (Supplement 3) . (https://doi.org/10.1111/dom.12162)

    • Search Google Scholar
    • Export Citation
  • Sayed D & Abdellatif M 2011 MicroRNAs in development and disease. Physiological Reviews 91 . (https://doi.org/10.1152/physrev.00006.2010)

  • Sebastiani G, Grieco FA, Spagnuolo I, Galleri L, Cataldo D & Dotta F 2011 Increased expression of microRNA miR-326 in type 1 diabetic patients with ongoing islet autoimmunity. Diabetes/Metabolism Research and Reviews 27 . (https://doi.org/10.1002/dmrr.1262)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tersey SA, Nishiki Y, Templin AT, Cabrera SM, Stull ND, Colvin SC, Evans-Molina C, Rickus JL, Maier B & Mirmira RG 2012 Islet beta-cell endoplasmic reticulum stress precedes the onset of type 1 diabetes in the nonobese diabetic mouse model. Diabetes 61 . (https://doi.org/10.2337/db11-1293)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Urra H, Dufey E, Lisbona F, Rojas-Rivera D & Hetz C 2013 When ER stress reaches a dead end. Biochimica and Biophysica Acta 1833 . (https://doi.org/10.1016/j.bbamcr.2013.07.024)

    • Search Google Scholar
    • Export Citation
  • Ventriglia G, Nigi L, Sebastiani G & Dotta F 2015 MicroRNAs: novel players in the dialogue between pancreatic islets and immune system in autoimmune diabetes. BioMed Research International 2015 749734. (https://doi.org/10.1155/2015/749734)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Walter P & Ron D 2011 The unfolded protein response: from stress pathway to homeostatic regulation. Science 334 . (https://doi.org/10.1126/science.1209038)

  • Xu G, Chen J, Jing G & Shalev A 2013 Thioredoxin-interacting protein regulates insulin transcription through microRNA-204. Nature Medicine 19 . (https://doi.org/10.1038/nm.3287)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Xu G, Chen J, Jing G, Grayson TB & Shalev A 2016 miR-204 targets PERK and regulates UPR signaling and beta-cell apoptosis. Molecular Endocrinology 30 . (https://doi.org/10.1210/me.2016-1056)

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

Supplementary Materials

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 1021 806 0
Full Text Views 248 218 77
PDF Downloads 115 96 35
  • View in gallery

    Cytokines co-regulate miR-211-5p and CHOP expression in human beta cells. Dispersed human islets cells (A and B) and EndoC-βH1 cells (C and D) were left untreated or treated with IL1B+IFNG for 48 h. Expression of miR-211-5p (A and C) was assayed by RT-PCR and normalized by two different small nucleolar RNAs (miR-U6 and miR-RD61). Expression of CHOP (B and D) was evaluated by RT-PCR and normalized by the housekeeping gene ACTB. The results are shown as individual experiments, before and after cytokines treatment; n = 5–6 independent experiments. *P < 0.05 and **P < 0.01 vs untreated cells; paired Student’s t-test.

  • View in gallery

    KD of CHOP protects EndoC-βH1 cells against cytokine-induced apoptosis in the context of miR-211-5p inhibition. EndoC-βH1 cells were transfected with siCTRL, siCHOP, an anti-miRNA targeting miR-211-5p (anti-miR-211) or co-transfected with both siCHOP + anti-miR-211 (A, B and C) for 8 h. After 24 h of recovery, cells were left untreated or treated with IL1B+IFNG for 48 h as indicated. The KD of CHOP (A) was confirmed by RT-PCR, normalized by the housekeeping gene ACTB. Expression of miR-211-5p (B) was assayed by RT-PCR and normalized by miR-375-3p and let-7a-5p expression. Apoptosis was evaluated by propidium iodide/Hoechst staining after 48 h of cytokine treatment (C). In (A) results were normalized against the highest value in each independent experiment, considered as 1. Data shown are mean ± s.e.m. of 6–7 independent experiments (A, B and C). *P < 0.05, **P < 0.01 and ***P < 0.001 vs siCTRL untreated cells; $ P < 0.05, $$ P < 0.01 and $$$ P < 0.001 vs siCTRL cytokine-treated cells; §§ P < 0.01 and §§§ P < 0.001 as indicated by bars; ANOVA followed by Bonferroni’s correction.

  • View in gallery

    Inhibition of miR-211-5p exacerbates apoptosis of human beta cells. EndoC-βH1 cells (A, B, C, D and E) were transfected with siCTRL or with an anti-miRNA targeting miR-211-5p (anti-miR-211) for 8 h. After 24 h of recovery, the cells were left untreated or treated with IL1B+IFNG for 48 h as indicated. The expression of miR-211-5p (A) was assayed by RT-PCR and normalized by miR-375-3p expression. Apoptosis was evaluated by propidium iodide/Hoechst staining after 48 h of cytokine treatment (B). Cleaved caspase-3 and Tubulin protein expression were evaluated by western blot after 48 h of cytokine treatment; one representative blot of six independent experiments is shown (C). The optical density of cleaved caspase-3 (example shown in C) was quantified and corrected by T tubulin expression (D). After cytokine treatment, cells were fixed and used for histological studies (as indicated in Supplementary Fig. 3). The quantification of fluorescent cleaved caspase-3 positive cells is shown (E). Dispersed human islets cells (F and G) were transfected with siCTRL or with an anti-miRNA targeting miR-211-5p (anti-miR-211) for 8 h. After 48 h of recovery, the cells were left untreated or treated with IL1B+IFNG for 48 h as indicated. The expression of miR-211-5p (F) was assayed by RT-PCR and normalized by miR-375-3p and let-7a-5p expression. Apoptosis was evaluated by propidium iodide/Hoechst staining after 48 h of cytokine treatment (G). The results are represented as box plots, indicating lower quartile, median, and higher quartile, with whiskers representing the range of the remaining data points (B and E); n = 4–6 independent experiments. In (D) results were normalized against the highest value in each independent experiment, considered as 1. Data shown are mean ± s.e.m. of six independent experiments (A and D) or three independent experiments (F). In (G) the results are represented as box plots, indicating lower value, mean and higher value; n = 3 independent experiments. *P < 0.05, **P < 0.01 and ***P < 0.001 vs siCTRL-untreated cells; $ P < 0.05, $$ P < 0.01 and $$$ P < 0.001 vs siCTRL cytokine-treated cells; § P < 0.05 as indicated by bars; ANOVA followed by Bonferroni’s correction (A, B, D and E); paired Student’s t-test (F and G). The order of the bands in the blot image (C) is the same as in the quantification histogram (D): from left to right are indicated respectively untreated cells transfected with a control siRNA, untreated cells transfected with the miR-211-5p inhibitor, cytokine-treated cells transfected with a control siRNA and last cytokine-treated cells transfected with the miR-211-5p inhibitor. Full-length blots are presented in Supplementary Fig. 8.

  • View in gallery

    miR-211-5p inhibition increases mRNA expression of ER stress markers in EndoC-βH1 cells in a PERK-dependent manner. (A) Alignment of miR-211-5p and miR-204-5p, miRNAs belonging to the same family; seed sequence (gray shading) and predicted binding site for the miRNAs (gray shading) of human EIF2AK3 (also known as PERK) 3′UTR using TargetScan software version 7.1. EndoC-βH1 cells (B, C, D, E and F) were transfected with siCTRL or with an anti-miRNA targeting miR-211-5p (anti-miR-211) for 8 h. After 24 h of recovery, the cells were left untreated or treated with IL1B+IFNG for 48 h as indicated. Expression of PERK (B), EIF2A (C), ATF4 (D), ATF3 (E) and CHOP (F) were assayed by RT-PCR and normalized by the housekeeping gene ACTB. In (B, C, D, E and F) results were normalized against the highest value in each independent experiment, considered as 1. Data shown are mean ± s.e.m. of six independent experiments (B, C, D, E and F). *P < 0.05, **P < 0.01 and ***P < 0.001 vs siCTRL-untreated cells; $ P < 0.05, $$ P < 0.01 and $$$ P < 0.001 vs siCTRL cytokine-treated cells; § P < 0.05 and §§§ P < 0.001 as indicated by bars; ANOVA followed by Bonferroni’s correction.

  • View in gallery

    miR-211-5p inhibition increases protein expression of ER stress markers in EndoC-βH1 cells in a PERK-dependent manner. Human insulin-producing EndoC-βH1 cells (A, B, C, D, E, F, G and H) were transfected with siCTRL or with an anti-miRNA targeting miR-211-5p (anti-miR-211) for 8 h. After 24 h of recovery, the cells were left untreated or treated with IL1B+IFNG for 48 h as indicated. PERK and Tubulin expression were evaluated by western blot after 48 h of cytokines treatment; one representative blot of eight independent experiments is shown; the order of the lanes is similar to the ones shown in (B). (A). The optical density quantification of PERK (example shown in A) was quantified and corrected by Tubulin expression (B). p-EIF2A, EIF2A and Tubulin expression were evaluated by western blot after 48 h of cytokine treatment; one representative blot of 9–11 independent experiments is shown (C). The optical density of p-EIF2A (E) and EIF2A (G) bands (shown in C) was quantified and corrected by Tubulin expression. ATF4, ATF3 and Tubulin expression were evaluated by Western blot after 48 h of cytokine treatment; one representative blot of 8–9 independent experiments is shown (D). The optical density of ATF4 (F) and ATF3 (H) bands (shown in D) was quantified and corrected by Tubulin expression. In (B and E, F, G, H) results were normalized against the highest value in each independent experiment, considered as 1. Data shown are mean ± s.e.m. of 8–11 independent experiments. *P < 0.05, **P < 0.01 and ***P < 0.001 vs untreated cells; $ P < 0.05 vs siCTRL cytokine-treated cells; ANOVA followed by Bonferroni’s correction. The order of the bands in the blot images (A, C and D) is the same as in the quantification histograms (B and E, F, G, H, respectively): from left to right are indicated respectively untreated cells transfected with a control siRNA, untreated cells transfected with the miR-211 inhibitor, cytokine-treated cells transfected with a control siRNA and last cytokine-treated cells transfected with the miR-211-5p inhibitor. Full-length blots are presented in Supplementary Fig. 9.

  • View in gallery

    Cytokines but not thapsigargin down-regulate miR-204-5p expression. The use of a miR-211-5p inhibitior also decreases miR-204-5p expression. Dispersed human islets cells (A) and human insulin-producing EndoC-βH1 cells (B and C), were left untreated or treated with IL1B+IFNG for 48h (A and B) and with the ER stressor thapsigargin for 24 h (C) as indicated. Expression of miR-204-5p was assayed by RT-PCR and normalized by two different small nucleolar RNAs (miR-U6 and miR-RD61). The results are represented as individual experiments; n = 5–6 independent experiments. **P < 0.01 vs untreated cells; paired Student’s t-test. Human insulin-producing EndoC-βH1 cells (D) and human dispersed islets cells (E) were transfected with siControl (CTRL) or with an anti-miRNA targeting miR-211-5p (anti-miR-211) for 8 h. After 24 h (D) and 48 h (E) of recovery, cells were left untreated of treated with IL1B+IFNG for 48 h as indicated. Expression of miR-204-5p was assayed by RT-PCR and normalized by and miR-375-3p and let7a-5p expression. Data shown are mean ± s.e.m. of six independent experiments (D) or three independent experiments (E). **P < 0.01 and ***P < 0.001 vs siCTRL untreated cells; $$$ P < 0.001 vs siCTRL cytokines-treated cells; ANOVA followed by Bonferroni’s correction.