METTL7B promotes migration and invasion in thyroid cancer through epithelial-mesenchymal transition

in Journal of Molecular Endocrinology
View More View Less
  • 1 Department of Thyroid and Breast Surgery, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, Zhejiang Province, China

Correspondence should be addressed to E Chen or X Zhang: chenendong92@163.com or oncology0zxh@163.com

*(D Ye, Y Jiang and Y Sun contributed equally to this work)

Thyroid cancer is associated with one of the most malignant endocrine tumors. However, molecular mechanisms underlying thyroid tumorigenesis and progression remain unclear. In order to investigate these mechanisms, we performed whole-transcriptome sequencing, which indicated that a differentially expressed gene, METTL7B, was highly expressed in thyroid cancers. We analyzed METTL7B expression using TCGA and performed qRT-PCR on tissue samples. Moreover, an analysis of clinicopathological characteristics revealed a positive correlation between METTL7B and lymph node metastasis. A series of in vitro experiments indicated that METTL7B enhanced migration and invasion of thyroid carcinoma cells. Further studies revealed that METTL7B may enhance TGF-β1-induced epithelial-mesenchymal transition (EMT). Our results indicate that METTL7B may promote metastasis of thyroid cancer through EMT and may therefore be considered as a potential biomarker for the diagnosis and prognosis of thyroid carcinoma.

Abstract

Thyroid cancer is associated with one of the most malignant endocrine tumors. However, molecular mechanisms underlying thyroid tumorigenesis and progression remain unclear. In order to investigate these mechanisms, we performed whole-transcriptome sequencing, which indicated that a differentially expressed gene, METTL7B, was highly expressed in thyroid cancers. We analyzed METTL7B expression using TCGA and performed qRT-PCR on tissue samples. Moreover, an analysis of clinicopathological characteristics revealed a positive correlation between METTL7B and lymph node metastasis. A series of in vitro experiments indicated that METTL7B enhanced migration and invasion of thyroid carcinoma cells. Further studies revealed that METTL7B may enhance TGF-β1-induced epithelial-mesenchymal transition (EMT). Our results indicate that METTL7B may promote metastasis of thyroid cancer through EMT and may therefore be considered as a potential biomarker for the diagnosis and prognosis of thyroid carcinoma.

Introduction

Thyroid carcinoma is considered the most common endocrine-related malignancy, and its incidence has been rapidly increasing in recent years (Davies & Welch 2006, Horn-Ross et al. 2014, La Vecchia et al. 2015). In the United States, approximately 53,990 cases of thyroid cancer were expected to be newly diagnosed in 2018, leading to a projected 2060 deaths (Siegel et al. 2018). In China, it was predicted that there would be approximately 90,000 newly diagnosed thyroid cancer cases and about 6800 estimated deaths in 2015 (Chen et al. 2016). Histologically, thyroid malignancies are classified into four main types, namely, papillary thyroid cancer (PTC: 80–85%), follicular thyroid cancer (FTC: 10–15%), poorly differentiated thyroid cancer (PDTC: 5–10%) and anaplastic thyroid cancer (ATC: 2–3%). PTC and FTC constitute well-differentiated thyroid carcinoma (WDTC). Molecular pathogenesis of thyroid cancer has been extensively studied. Related studies have indicated that genetic and epigenetic alterations may be the driving force behind thyroid cancer. These alterations include gene mutations, oncogenic gene amplification or copy-number gains, gene translocations and aberrant gene methylation and gene expression (Xing 2013). It was hypothesized that BRAF mutation may play a fundamental role in PTC tumorigenesis and progression by continuously activating the MAP kinase pathway (Xing et al. 2005, Liu et al. 2007, Xing 2007, Kim et al. 2012). Moreover, many other alterations, such as mutations in PTEN (Gustafson et al. 2007), TP53 (Donghi et al. 1993, Fagin et al. 1993) and TERT (Liu et al. 2013) may be involved in thyroid tumorigenesis. In spite of many advances and achievements that have been made in genetic research, molecular mechanisms underlying thyroid cancer remain unclear. Thus, identification of potential therapeutic targets as well as diagnostic and prognostic biomarkers of thyroid cancer should be considered a priority.

Methyltransferase-like 7B (METTL7B), also known as associated with LD protein 1 (ALD1), is localized on chromosome 12. Studies have indicated that METTL7B may be associated with some diseases, such as infection (Abdel-Hameed et al. 2014), non-alcoholic steatohepatitis lipid metabolism (Thomas et al. 2013), severe preeclampsia (Nevalainen et al. 2017) and several tumors (McKinnon & Mellor 2017, Cai et al. 2018, Wang et al. 2018). In terms of its role in thyroid cancer, Cai et al. (2018) identified top ten differentially expressed genes (DEGs) in PTCs in TCGA database, and METTL7B was one of the upregulated genes. The expression level of METTL7B was closely related to the survival time of PTC, lymph node metastasis and pathological stage. However, its biological effects have not yet been clarified in vitro; moreover, the mechanism by which it exerts its tumor-promoting role in thyroid cancer remains unknown.

Results of whole-transcriptome sequencing of 19 PTCs and matched non-cancerous thyroid tissues, conducted by the current study, indicated that human METTL7B expression was remarkably increased in PTCs. An extensive literature review showed that the function of METTL7B in thyroid cancer remains largely unexplored. Therefore, we aimed to investigate the role played by METTL7B in thyroid cancer.

Materials and methods

Patients and samples

In our study, there were 39 PTCs and matched non-cancerous thyroid tissues, which were obtained from the surgery. This study received approval of the Ethics Committee of the First Affiliated Hospital of Wenzhou Medical University. Informed consent was obtained from all patients for the use of their biological material. The specimens were placed in liquid nitrogen as soon as they were resected and stored at −80°C. All tissues were reviewed retrospectively by two pathologists to confirm histological diagnoses according to World Health Organization (WHO) criteria. Standardized mRNA expression counts were acquired via the Cancer Genome Atlas (TCGA) portal and expressed as RNA-Seq using transcripts per kilobase million (TPM) values. We downloaded TCGA clinical data in Biotab format from the TCGA portal.

Cell culture

Human thyroid cancer cell lines TPC1, BCPAP and FTC133 were generously donated by Professor Mingzhao Xing of the Johns Hopkins University School of Medicine, Baltimore, MA, USA. TPC1 and BCPAP cells were maintained in RPMI 1640 with 10% FBS (Gibco) and 1× MEM nonessential amino acids +1 × sodium pyruvate at 37°C with 5% CO2. FTC133 cells were cultured in DMEM/F12 media with 10% FBS (Gibco), and 2 mM Glutamine at 37°C with 5% CO2.

RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA of tissues and the cultured cells were isolated using TRIzol reagent (Life Technologies) according to the manufacturer’s instructions, following which they were reverse transcribed into cDNA using ReverTra Ace® qPCR RT Kit (Toyobo, Osaka, Japan). Real-time reverse transcription polymerase chain reaction (qRT-PCR) was performed using Thunderbird SYBR qPCR Mix (Toyobo) in an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems). The result was normalized to GAPDH expression. The primer sequences for PCR were as follows: METTL7B, forward CCTGCCTAGACCCAAATCCC and reverse AAACCGCTCATATTGGAGGTG.

Transient transfection

The siRNA targeting METTL7B and control siRNA was synthesized by Gene Pharma (Shanghai, China). Additionally, the plasmid vector encoding the METTL7B sequences was provided by RIBOBIO (Guangzhou, China). The sequences of siRNA are as follows: METTL7B-1(siRNA-1): forward 5′-UGACUCCCAAGAGCAACCGTT-3′ and reverse 5′-CGGUUGCUCUUGGGAGUCAGC-3′. METTL7B-2 (siRNA-2): forward 5′-AGAACCAUAUGGAAGCUGGTT-3′ and reverse 5′-CCAGCUUCCAUAUGGUUCUGC-3′. Next, we transfected siRNA into the thyroid cancer cells using RNAiMAX (Invitrogen), while the tumor cells were transfected with the plasmid vector using Lipofectamine 3000 (Invitrogen).

Cell colony formation assay and cell proliferation assay

In the colony formation experiment, transfected tumor cells (TPC1 1 × 103 cells/well; BCPAP 2 × 103 cells/well; FTC133 1.5 × 103 cells/well) were seeded into six-well plates. The medium was replaced every 3 days. Following a 7- to 12-day period, colonies were fixed using 4% paraformaldehyde for 30 min and stained with 0.01% crystal violet for 30 min. All colony formation experiments were replicated three times. The CCK-8 assay was used to detect cell proliferation. In this assay, the transfected tumor cells (TPC1 1 × 103 cells/well; BCPAP 2 × 103 cells/well; FTC133 1 × 103 cells/well) were seeded into 96-well plates in five replicates and incubated for four consecutive days at 37°C with 5% CO2. Next, CCK-8 reagent (Beyotime, China) was added to each well, and the cells were incubated for 2 h, and absorbance at 450 nm was recorded.

Cell migration and invasion assays

For migration, transwell cell culture chambers (Corning Costar Corp, Cambridge, MA, USA) were used. The three transfected cell types (TPC1 3 × 104 cells; BCPAP 5 × 104 cells; FTC133 4 × 104 cells) were seeded into the upper chamber with serum-free medium, and the bottom chamber was filled with 600 ml 10% FBS medium. For invasion, BioCoat™ Matrigel Invasion chamber 24-Well Plate 8.0 Micron (Corning) was used. Cells treated with siRNA or plasmid vector (8 × 104 cells) were seeded onto inserts in serum-free medium, and the inserts were placed into a 24-well plate filled with 20% FBS medium. Following incubation for 24 h, cells in the bottom chamber were fixed with 4% PFA (Sigma), stained with 0.01% crystal violet, imaged under a microscope at a magnification of 200× and quantified with the ImageJ software (https://imagej.nih.gov/ij/). All experiments were replicated three times.

Protein extraction and Western blot analysis

Cells transfected with siRNA or plasmid vector were lysed in RIPA buffer (Beyotime) containing PMSF, a protease inhibitor. Equal amounts of proteins were separated using SDS-PAGE and transferred onto PVDF. Next, these membranes were incubated with primary antibodies after blocking with 5% skimmed milk. Anti-METTL7B (ab110134), anti-β-actin (ab8227) and anti-N-cadherin (ab18203) were purchased from Abcam. Anti-E-cadherin (20874-1-AP) was purchased from Proteintech, China. The membranes were then incubated with secondary anti-rabbit immunoglobulin G antibodies. Finally, immunoblotting signals were visualized using the Western Bright ECL detection system (Advansta, CA, USA).

Statistical analysis

Mann–Whitney U test was used for evaluating the differences in expression between thyroid neoplasms and adjacent normal tissues in the validated cohort and TCGA cohort. The relationship between clinicopathologic characteristics and METTL7B was compared using the chi-square test or Fisher’s exact test, as appropriate. Normally distributed data were expressed as mean ± standard deviation and analyzed using Student’s t-test. All statistical analyses were performed via SPSS version 22.0. GraphPad Prism 6 (GraphPad Software) was used to generate graphs, and ImageJ was used for counts. Statistical significance was set at P < 0.05.

Results

Increased METTL7B in malignant thyroid neoplasms

The results of whole-transcriptome sequencing of 19 PTCs and their matched non-cancerous thyroid tissues (Fig. 1A) showed that METTL7B was highly expressed in tumors, compared to normal thyroid tissues. Next, qRT-PCR was performed to detect mRNA levels of METTL7B in 39 pairs of PTCs and their matched adjacent non-cancerous tissues. METTL7B expression in PTCs was significantly elevated compared to non-cancerous tissues (P < 0.001); (Fig. 1B). This was further verified using data from TCGA. The mRNA levels of METTL7B were significantly upregulated in PTCs relative to the normal control (P < 0.001) (Fig. 1C). Next, we assessed the diagnostic value of METTL7B expression in PTCs using the receiver operator characteristic (ROC) curve. Its sensitivity and specificity were 76.92 and 92.31%, respectively, in the validated cohort (AUC 86.26%) while they were 91.77% (Fig. 1D) and 100% in the TCGA cohort (AUC 96.07%) (Fig. 1E).

Figure 1
Figure 1

High expression of METTL7B in PTCs. (A) Heatmap depiction of the thyroid papillary cancer versus normal tissues differentially expressed mRNA. (B) The mRNA levels of METTL7B were analyzed by qRT-PCR in 39 paired PTCs and matched non-cancerous thyroid tissues (Mann–Whitney U test, ***P < 0.001). (C) In the TCGA cohort, data were represented as log2 fold changes, and high METTL7B mRNA levels in PTCs were relative to normal thyroid tissues (Mann–Whitney U test, ***P < 0.001). (D) ROC curve for METTL7B expression to diagnose PTCs in the validated cohort. The area under the ROC curve (AUC) was 86.26%. (E) ROC curve for METTL7B expression to diagnose PTCs in the TCGA cohort. The area under the ROC curve (AUC) was 96.07%. A full colour version of this figure is available at https://doi.org/10.1530/JME-18-0261.

Citation: Journal of Molecular Endocrinology 63, 1; 10.1530/JME-18-0261

Relationship between METTL7B expression and clinicopathologic feature

To ascertain whether METTL7B expression was involved in tumorigenesis and progression of PTC, we explored the relationship between METTL7B expression and clinicopathologic features. The data were divided into two groups, namely, low METTL7B expression and high METTL7B expression, based on the median value. In the TCGA cohort, histological type (P < 0.001), thyroiditis (P = 0.008), extrathyroidal invasion (P = 0.028), lymph node metastasis (P < 0.001) and AJCC disease stage (P = 0.037) were significantly related to high METTL7B expression (Table 1). Furthermore, results of the validated cohort revealed that advanced age (>45 years) (P = 0.008) and lymph node metastasis (P = 0.014) were associated with higher METTL7B expression (Table 2). However, the relationships between METTL7B expression and gender, tumor size and multifocal or unifocal in both cohorts were not statistically significant (P > 0.05). These results demonstrated that METTL7B may be associated with PTC progression.

Table 1

The relationship between METTL7B expression and clinicopathological characteristics in TCGA cohort.

CharacteristicsExpression of METTL7B, n (%)P value
Low expression (n = 252) (%)High expression (n = 252) (%)
Age at diagnosis, years
 Mean ± s.d.47.90 ± 16.0646.61 ± 15.630.361
 <45116 (46.03)113 (44.84)0.788
 ≥45136 (53.97)139 (55.16)
Gender0.688
 Female186 (73.81)182 (72.22)
 Male66 (26.19)70 (27.78)
Histological type<0.001*
 Classical159 (63.10)198 (78.57)
 Follicular73 (28.97)29 (11.51)
 Tall cell16 (6.35)20 (7.94)
 Other specify4 (1.58)5 (1.98)
Tumor size in cm
 Mean ± s.d.2.96 ± 1.742.86 ± 1.600.501
 ≤283 (32.94)88 (34.92)0.708
 >2153 (60.71)151 (59.92)
T stage0.234
 T177 (30.56)65 (25.79)
 >T1174 (69.05)186 (73.81)
Unilateral or bilateral0.606
 Unilateral209 (82.94)203 (80.56)
 Bilateral41 (16.27)45 (17.86)
Thyroiditis0.008*
 Yes47 (18.65)26 (10.32)
 No205 (81.35)226 (89.68)
Multifocal or unifocal0.857
 Multifocal112 (44.44)114 (45.24)
 Unifocal135 (53.57)133 (52.78)
Extrathyroidal invasion0.028*
 Yes64 (25.40)89 (35.32)
 No175 (69.44)158 (62.70)
Lymph node metastasis<0.001*
 Yes93 (36.90)131 (51.98)
 No134 (53.17)96 (38.10)
Metastasis1.000
 M0140 (55.56)141 (55.95)
 M15 (1.98)4 (1.59)
AJCC disease stage0.037*
 I + II179 (71.03)157 (62.30)
 III + IV72 (28.57)94 (37.30)

*P value < 0.05.

Table 2

The relationship between METTL7B expression and clinicopathologic features in the validated cohort.

CharacteristicsLow expression (n = 19) (%)High expression (n = 20) (%)P value
Age at diagnosis, years
 ≤4511 (57.89)3 (15.00)0.008*
 >458 (42.11)17 (85.00)
Gender
 Female15 (78.95)19 (95.00)0.182
 Male4 (21.05)1 (5.00)
Tumor size in mm
 ≤109 (47.37)6 (30.00)0.333
 >1010 (52.63)14 (70.00)
Hashimoto’s thyroiditis
 Yes9 (47.37)6 (30.00)0.333
 No10 (52.63)14 (70.00)
Multifocality
 Multifocal7 (36.84)4 (20.00)0.301
 Unifocal12 (63.16)16 (80.00)
Extrathyroidal invasion
 Yes5 (26.32)2 (10.00)0.235
 No14 (73.68)18 (90.00)
Lymph node metastasis
 Yes10 (52.63)18 (90.00)0.014*
 No9 (47.37)2 (10.00)
Clinical stage
 I–II12 (63.16)8 (40.00)0.205
 III–IV7 (36.84)12 (60.00)

*P value<0.05.

High expression of METTL7B aggravates the risk of lymph node metastasis in PTC patients

Further analysis of the association between METTL7B expression and lymph node metastasis was conducted. Univariate logistic regression analysis, indicated that age (OR: 0.981, 95% CI: 0.969–0.994, P = 0.003), gender (OR: 1.571, 95% CI: 1.03–2.394, P = 0.036), tumor size (OR: 1.187, 95% CI: 1.053–1.339, P = 0.005), T stage (OR: 1.827, 95% CI: 1.459–2.288, P < 0.001), extra thyroidal invasion (OR: 2.716, 95% CI: 1.776–4.156, P < 0.001) and METTL7B expression (OR: 2.045, 95% CI: 1.400–2.987, P < 0.001) were obviously relevant to lymph node metastasis (Table 3). Next, we performed multivariate logistic analysis of the relationship between the six mentioned parameters and lymph node metastasis. The results revealed that only age (OR: 0.972, 95% CI: 0.958–0.987, P < 0.001), extra thyroidal invasion (OR: 2.090, 95% CI: 1.079–4.045, P = 0.029) and METTL7B expression (OR: 1.832, 95% CI: 1.201–2.794, P = 0.005) were relevant to lymph node metastasis (Table 4). In conclusion, results demonstrated that increased METTL7B expression may promote lymph node metastasis in PTC patients.

Table 3

Univariate logistic regression analysis for the lymph node metastatic risk.

CharacteristicsOR (95% CI)P value
Age0.981 (0.969–0.994)0.003*
Gender1.571 (1.03–2.394)0.036*
Histological type0.831 (0.639–1.08)0.167
Tumor size1.187 (1.053–1.339)0.005*
T stage1.827 (1.459–2.288)<0.001*
Unilateral or bilateral1.597 (0.985–2.589)0.057
Multifocal or unifocal1.456 (0.997–2.127)0.052
Thyroiditis0.86 (0.515–1.436)0.565
Extra thyroidal invasion2.716 (1.776–4.156)<0.001*
Metastasis1.165 (0.285–4.759)0.831
METTL7B expression2.045 (1.400–2.987)<0.001*

*P value < 0.05.

Table 4

Multivariate logistic regression analysis for the lymph node metastatic risk.

CharacteristicsOR (95% CI)P value
Age0.972 (0.958–0.987)<0.001*
Gender1.338 (0.830–2.156)0.232
Tumor size1.102 (0.945–1.284)0.214
T stage1.334 (0.900–1.977)0.151
Extra thyroidal invasion2.090 (1.079–4.045)0.029*
METTL7B expression1.832 (1.201–2.794)0.005*

*P value < 0.05.

METTL7B increases thyroid cancer cell proliferation and colony formation

Based on the above findings, we hypothesized that this gene plays an oncogenic role in thyroid cancer initiation and progression. A series of in vitro experiments were conducted to determine the biological function of METTL7B in thyroid carcinoma. First, qRT-PCR and western blot analyses were performed to confirm the inhibitory efficiency of two different small interference RNAs (siRNAs) targeting METTL7B in BCPAP and TPC1 cells (Fig. 2A and B). METTL7B knockdown inhibited cell proliferation and colony formation (Fig. 2C and D). The effect of METTL7B overexpression on malignant behavior in BCPAP, TPC1 and FTC133 cells was assessed. Correspondingly, we also examined the effect of METTL7B re-expression on both mRNA and protein levels (Fig. 2E and F). The results revealed that with increasing METTL7B expression, thyroid cell proliferation and colony formation were significantly increased, compared to the control (Fig. 2G and H). These results demonstrated the carcinogenic activity of METTL7B.

Figure 2
Figure 2

METTL7B promotes thyroid cancer cell growth in vitro. (A and B) Inhibition of METTL7B expression by two different siRNAs in BCPAP and TPC1 were respectively verified by qRT-PCR and western blot analysis. (C) METTL7B knockdown impaired the colony formation ability of thyroid cancer cells. The upper panel shows the representative pictures of colonies in the treated cells, and the statistical data are presented in the below image. (D) The CCK-8 assay also showed its diminished role of METTL7B knockdown on the thyroid cancer cell proliferation. (E and F) METTL7B re-expression in BCPAP, TPC1 and FTC133 cells was validated by qRT-PCR and western blot analysis. (G and H) METTL7B overexpression boosted the proliferation and colony formation of thyroid cancer cells. (P values were calculated by Student’s t-test, *P < 0.05; **P < 0.01; ***P < 0.001). A full colour version of this figure is available at https://doi.org/10.1530/JME-18-0261.

Citation: Journal of Molecular Endocrinology 63, 1; 10.1530/JME-18-0261

METTL7B promotes thyroid cancer cell migration and invasion

Furthermore, we evaluated the effect of METTL7B on thyroid cancer cell migration and invasion. Our results revealed that METTL7B knockdown dramatically impaired cell migration ability of BCPAP and TPC1 relative to the control (Fig. 3A). We also performed in vitro invasion assays, which indicated that cell invasion potential was obviously suppressed due to the depletion of METTL7B (Fig. 3B). Conversely, METTL7B overexpression significantly facilitated migration and invasion in BCPAP, TPC1 and FTC133 dells (Fig. 3C and D). These findings showed that METTL7B was a significant oncogene associated with metastatic phenotypes of thyroid cancer cells.

Figure 3
Figure 3

METTL7B facilitates the metastasis of thyroid cancer cells. (A and B) METTL7B knockdown significantly weakened the ability of migration (A) and invasion (B) in BCPAP and TPC1. Inversely, transwell migration (C) and invasion (D) assays were done in BCPAP, TPC1 and FTC133 cells transfected with METTL7B expression plasmid or empty plasmid ***P < 0.001 vs Vector. All data were concluded from three different experiments. Statistical analysis was performed using Student’s t-test. A full colour version of this figure is available at https://doi.org/10.1530/JME-18-0261.

Citation: Journal of Molecular Endocrinology 63, 1; 10.1530/JME-18-0261

TGF-β1-induced EMT is intensified by METTL7B in thyroid cancer cells

Results indicated that METTL7B not only increased the risk of lymph node metastasis, but also enhanced the potential of thyroid cancer cells for migration and invasion. It is reported that epithelial-mesenchymal transition (EMT) may lead to increased migratory capacity and invasiveness of tumor cells (Kalluri & Weinberg 2009). TGF-β1 induces carcinoma progression by enhancing migration, invasion and proliferation, partly due to its effect on EMT (Akhurst & Hata 2012). Therefore, we investigated whether METTL7B mediates EMT in thyroid cancer. Firstly, we evaluated its effects on the morphology and E-cadherin and N-cadherin expression in TPC1 and FTC133, when treated with 10 ng/mL TGF-β1 for 3 days. In the presence of TGF-β1, TPC1 and FTC133 cells displayed a spindle-shape and fibroblast-like morphology, compared to the classic epithelial morphology seen in the absence of TGF-β1 (Fig. 4A). Furthermore, treatment with TGF-β1 significantly reduced expression of the epithelial marker, E-cadherin, and increased expression of the mesenchymal marker, N-cadherin, as indicated via western blot (Fig. 4B). Both of these findings show that TGF-β1 may successfully induce EMT in thyroid cancer cells. This has been shown in previous study (Hardin et al. 2014). To further determine the role of METTL7B in the process of TGF-β1-induced EMT, we examined levels of E-cadherin and N-cadherin in cells treated with TGF-β1 in samples, the METTL7B expression of which had been previously inhibited using two specific siRNAs (TPC1) or re-expressed using the METTL7B expression plasmid (TPC1, FTC133). Interestingly, METTL7B abrogation increased the level of E-cadherin and decreased the basal level of N-cadherin in TPC1, but also repressed declining E-cadherin levels and incremental levels of N-cadherin by TGF-β1 (Fig. 4C). Furthermore, TGF-β1-induced EMT was reinforced by METTL7B overexpression in TPC1 and FTC133 (Fig. 4D). Because METTL7B expression was higher in thyroid cancer cells with greater migration and invasion capacities, it was inferred that TGF-β1 may promote METTL7B expression. As expected, TGF-β1 enhanced METTL7B expression to 2.752 in TPC1 (Fig. 4E) and increased its expression to 75.054 in FTC133 (Fig. 4F) compared to the control.

Figure 4
Figure 4

METTL7B facilitates TGF-β1-induced EMT. (A and B) TPC1 and FTC133 cells were incubated with 10 ng/mL TGF-β1 for 3 days. (A) Morphological changes relevant to EMT were observed by the phase contrast microscope. (B) Western blot for E-cadherin and N-cadherin expressions in TPC1 and FTC133 cells. (C) Western blot for E-cadherin and N-cadherin in TPC1 cell, which was transfected with siRNAs and then cultivated with TGF-β1. (D) E-cadherin and N-cadherin levels were detected by western blot analysis in TPC1 and FTC133 cells in which METTL7B was overexpressed and then which were incubated with TGF-β1. (E and F) The expressions of METTL7B was measured in TPC1 and FTC133 cells treated with TGF-β1 for 3 days by qRT-PCR.

Citation: Journal of Molecular Endocrinology 63, 1; 10.1530/JME-18-0261

Discussion

METTL7B, a member of the methyltransferase-like family, is rarely studied. It was initially identified as a Golgi-interrelated methyltransferase of unknown function (Wu et al. 2004). Furthermore, it had been originally reported as being localized to the Golgi apparatus. Later, it was observed localizing to the ER in Hela cells and lipid droplets in the liver (Turro et al. 2006). It is a protein-coding gene, which encodes S-adenosyl-L-methionine-dependent methyltransferases as well as methyltransferase-like 7B protein (Turro et al. 2006). METTL7B plays a role in lipid metabolism, development of severe preeclampsia and tumor progression. Previous studies indicated that METTL7B may have a dual function in tumor progression. METTL7B expression was downregulated in breast cancer, and silencing RhoBTB1 resulted in fragmentation of the Golgi due to reduced METTL7B expression, which promoted breast cancer cell invasion (McKinnon & Mellor 2017). By contrast, METTL7B is highly expressed in PTC, and may serve as a biomarker for diagnosis and tumor progression (Cai et al. 2018). However, its function in thyroid cancer remains obscure. In this study, we provided experimental evidence showing that METTL7B may act as a potential oncogene to promote the initiation and progression of thyroid cancer. Firstly, METTL7B expression was remarkably increased in thyroid cancers compared to matched normal tissue, in addition to being associated with extrathyroidal invasion and lymph node metastasis in clinical significance analyses. Secondly, depletion of METTL7B obviously inhibited malignant biological properties of thyroid cancer cells, such as restriction of colony formation, proliferation, migration and invasion. Moreover, METTL7B overexpression significantly increased tumor growth and the ability of thyroid cancer cells to migrate and invade transwell chambers.

Next, it was hypothesized that association between high METTL7B expression and lymph node metastasis, as well as its ability to promote migration and invasion of thyroid cancer cells, were due to the increased cellular motility of thyroid cancer. The aggressive behavior of thyroid carcinoma is closely related to increased motility and invasiveness of cancer cells (Vasko & Saji 2007, Vasko et al. 2007, Liu et al. 2011), which associated with characteristic of EMT (Thiery et al. 2009). EMT plays an important role in cancer metastasis, by recruiting tumor stem cells capable of colonizing other tissues, leading to the development of secondary malignancies (Thiery 2002, Kalluri & Neilson 2003). Evidently, this process becomes aberrantly activated during thyroid cancer progression. It has been reported that in contrast to normal thyrocytes, thyroid cancer cells demonstrate an active EMT process, characterized by loose epithelial features, polarity and cohesiveness, reduced expression of epithelial markers and increased expression of mesenchymal markers (Nawshad et al. 2005, Vasko et al. 2007, Liu et al. 2011, Buehler et al. 2013, Kim et al. 2013, Montemayor-Garcia et al. 2013). Typical EMT exhibits loss of E-cadherin expression, decreased levels of tight junction proteins such as ZO-1, occluding and cytokeratins, as well as increased expression of mesenchymal markers such as N-cadherin, vimentin, fibronectin and a-smooth muscle actin (a-SMA) (Cano et al. 2000, Kalluri & Weinberg 2009, Liu et al. 2010). As expected, reduced E-cadherin expression and increased N-cadherin expression were detected in METTL7B-overexpression cells in our study, which were treated with TGF-β1. Consistent results were observed when METTL7B was silenced using siRNAs in TPC1 accompanied by TGF-β1-induced EMT.

Furthermore, we found that METTL7B may promote the growth of thyroid cancer cells in vitro. Reportedly several signaling pathways, such as MAPK/ERK, PI3K/Akt and nuclear factor-κB (NF-κB) pathways, are involved in regulating thyroid carcinogenesis (Hou et al. 2007, Xing 2013, Petrulea et al. 2015, Li et al. 2019). By searching for and investigating related genes located near the METTL7B locus (Chromosome 12: 55,681,546-55,684,611), we detected a gene relevant to apoptosis, CD63 (Chromosome 12: 55,725,323-55,729,707). Previous studies indicate that its combination with TIMP-1 would activate Akt, which in turn may cause the anti-apoptotic behavior of thyroid cancer (Berditchevski & Odintsova 1999, Bommarito et al. 2011). This may prompt for an investigation of potential mechanisms underlying the functions of METTL7B in thyroid carcinoma-related tumor growth. This was not accomplished in the current study and we expect to explore it as an next step.

In conclusion, the present study demonstrated that METTL7B was highly expressed in thyroid cancer and displayed a carcinogenic function under in vitro experimental conditions. Mechanistically, METTL7B promoted metastasis of thyroid cancer via EMT. These results underline the importance of METTL7B expression in thyroid carcinoma, indicate a reliable biomarker for the diagnosis and prognosis of thyroid cancer and offer an option for treating thyroid carcinoma by targeting this potential oncogene. As a next step, in vivo experiments involving nude mice may be implemented to further verify the function of METTL7B in thyroid cancer.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This study was funded by the Major Science and Technology Projects of Zhejiang Province (2015C03052).

Acknowledgements

The authors would also like to acknowledge the surgeons, nurses and pathologists who helped to manage patients and provide tissue samples.

References

  • Abdel-Hameed EA, Ji H, Sherman KE & Shata MT 2014 Epigenetic modification of FOXP3 in patients with chronic HIV infection. Journal of Acquired Immune Deficiency Syndromes 65 1926. (https://doi.org/10.1097/QAI.0b013e3182a1bca4)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Akhurst RJ & Hata A 2012 Targeting the TGFbeta signalling pathway in disease. Nature Reviews: Drug Discovery 11 790811. (https://doi.org/10.1038/nrd3810)

  • Berditchevski F & Odintsova E 1999 Characterization of integrin-tetraspanin adhesion complexes: role of tetraspanins in integrin signaling. Journal of Cell Biology 146 477492. (https://doi.org/10.1083/jcb.146.2.477)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Bommarito A, Richiusa P, Carissimi E, Pizzolanti G, Rodolico V, Zito G, Criscimanna A, Di Blasi F, Pitrone M, Zerilli M, 2011 BRAFV600E mutation, TIMP-1 upregulation, and NF-kappaB activation: closing the loop on the papillary thyroid cancer trilogy. Endocrine-Related Cancer 18 669685. (https://doi.org/10.1530/ERC-11-0076)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Buehler D, Hardin H, Shan W, Montemayor-Garcia C, Rush PS, Asioli S, Chen H & Lloyd RV 2013 Expression of epithelial-mesenchymal transition regulators SNAI2 and TWIST1 in thyroid carcinomas. Modern Pathology 26 5461. (https://doi.org/10.1038/modpathol.2012.137)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Cai WY, Chen X, Chen LP, Li Q, Du XJ & Zhou YY 2018 Role of differentially expressed genes and long non-coding RNAs in papillary thyroid carcinoma diagnosis, progression, and prognosis. Journal of Cellular Biochemistry 119 82498259. (https://doi.org/10.1002/jcb.26836)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Cano A, Perez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, Portillo F & Nieto MA 2000 The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nature Cell Biology 2 7683. (https://doi.org/10.1038/35000025)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, Yu XQ & He J 2016 Cancer statistics in China, 2015. CA: A Cancer Journal for Clinicians 66 115132. (https://doi.org/10.3322/caac.21338)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Davies L & Welch HG 2006 Increasing incidence of thyroid cancer in the United States, 1973–2002. JAMA 295 21642167. (https://doi.org/10.1001/jama.295.18.2164)

  • Donghi R, Longoni A, Pilotti S, Michieli P, Della Porta G & Pierotti MA 1993 Gene p53 mutations are restricted to poorly differentiated and undifferentiated carcinomas of the thyroid gland. Journal of Clinical Investigation 91 17531760. (https://doi.org/10.1172/JCI116385)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Fagin JA, Matsuo K, Karmakar A, Chen DL, Tang SH & Koeffler HP 1993 High prevalence of mutations of the p53 gene in poorly differentiated human thyroid carcinomas. Journal of Clinical Investigation 91 179184. (https://doi.org/10.1172/JCI116168)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Gustafson S, Zbuk KM, Scacheri C & Eng C 2007 Cowden syndrome. Seminars in Oncology 34 428434. (https://doi.org/10.1053/j.seminoncol.2007.07.009)

  • Hardin H, Guo Z, Shan W, Montemayor-Garcia C, Asioli S, Yu XM, Harrison AD, Chen H & Lloyd RV 2014 The roles of the epithelial-mesenchymal transition marker PRRX1 and miR-146b-5p in papillary thyroid carcinoma progression. American Journal of Pathology 184 23422354. (https://doi.org/10.1016/j.ajpath.2014.04.011)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Horn-Ross PL, Lichtensztajn DY, Clarke CA, Dosiou C, Oakley-Girvan I, Reynolds P, Gomez SL & Nelson DO 2014 Continued rapid increase in thyroid cancer incidence in california: trends by patient, tumor, and neighborhood characteristics. Cancer Epidemiology, Biomarkers and Prevention 23 10671079. (https://doi.org/10.1158/1055-9965.EPI-13-1089)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Hou P, Liu D, Shan Y, Hu S, Studeman K, Condouris S, Wang Y, Trink A, El-Naggar AK, Tallini G, 2007 Genetic alterations and their relationship in the phosphatidylinositol 3-kinase/Akt pathway in thyroid cancer. Clinical Cancer Research 13 11611170. (https://doi.org/10.1158/1078-0432.CCR-06-1125)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kalluri R & Neilson EG 2003 Epithelial-mesenchymal transition and its implications for fibrosis. Journal of Clinical Investigation 112 17761784. (https://doi.org/10.1172/JCI20530)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kalluri R & Weinberg RA 2009 The basics of epithelial-mesenchymal transition. Journal of Clinical Investigation 119 14201428. (https://doi.org/10.1172/JCI39104)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kim DW, Walker RL, Meltzer PS & Cheng SY 2013 Complex temporal changes in TGFbeta oncogenic signaling drive thyroid carcinogenesis in a mouse model. Carcinogenesis 34 23892400. (https://doi.org/10.1093/carcin/bgt175)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kim TH, Park YJ, Lim JA, Ahn HY, Lee EK, Lee YJ, Kim KW, Hahn SK, Youn YK, Kim KH, 2012 The association of the BRAF(V600E) mutation with prognostic factors and poor clinical outcome in papillary thyroid cancer: a meta-analysis. Cancer 118 17641773. (https://doi.org/10.1002/cncr.26500)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • La Vecchia C, Malvezzi M, Bosetti C, Garavello W, Bertuccio P, Levi F & Negri E 2015 Thyroid cancer mortality and incidence: a global overview. International Journal of Cancer 136 21872195. (https://doi.org/10.1002/ijc.29251)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Li H, Tian Z, Qu Y, Yang Q, Guan H, Shi B, Ji M & Hou P 2019 SIRT7 promotes thyroid tumorigenesis through phosphorylation and activation of Akt and p70S6K1 via DBC1/SIRT1 axis. Oncogene 38 345359. (https://doi.org/10.1038/s41388-018-0434-6)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu D, Liu Z, Condouris S & Xing M 2007 BRAF V600E maintains proliferation, transformation, and tumorigenicity of BRAF-mutant papillary thyroid cancer cells. Journal of Clinical Endocrinology and Metabolism 92 22642271. (https://doi.org/10.1210/jc.2006-1613)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Liu LK, Jiang XY, Zhou XX, Wang DM, Song XL & Jiang HB 2010 Upregulation of vimentin and aberrant expression of E-cadherin/beta-catenin complex in oral squamous cell carcinomas: correlation with the clinicopathological features and patient outcome. Modern Pathology 23 213224. (https://doi.org/10.1038/modpathol.2009.160)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Liu Z, Kakudo K, Bai Y, Li Y, Ozaki T, Miyauchi A, Taniguchi E & Mori I 2011 Loss of cellular polarity/cohesiveness in the invasive front of papillary thyroid carcinoma, a novel predictor for lymph node metastasis; possible morphological indicator of epithelial mesenchymal transition. Journal of Clinical Pathology 64 325329. (https://doi.org/10.1136/jcp.2010.083956)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu X, Bishop J, Shan Y, Pai S, Liu D, Murugan AK, Sun H, El-Naggar AK & Xing M 2013 Highly prevalent tert promoter mutations in aggressive thyroid cancers. Endocrine-Related Cancer 20 603610. (https://doi.org/10.1530/ERC-13-0210)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • McKinnon CM & Mellor H 2017 The tumor suppressor RhoBTB1 controls Golgi integrity and breast cancer cell invasion through METTL7B. BMC Cancer 17 145. (https://doi.org/10.1186/s12885-017-3138-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Montemayor-Garcia C, Hardin H, Guo Z, Larrain C, Buehler D, Asioli S, Chen H & Lloyd RV 2013 The role of epithelial mesenchymal transition markers in thyroid carcinoma progression. Endocrine Pathology 24 206212. (https://doi.org/10.1007/s12022-013-9272-9)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nawshad A, Lagamba D, Polad A & Hay ED 2005 Transforming growth factor-beta signaling during epithelial-mesenchymal transformation: implications for embryogenesis and tumor metastasis. Cells, Tissues, Organs 179 1123. (https://doi.org/10.1159/000084505)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nevalainen J, Skarp S, Savolainen ER, Ryynanen M & Jarvenpaa J 2017 Intrauterine growth restriction and placental gene expression in severe preeclampsia, comparing early-onset and late-onset forms. Journal of Perinatal Medicine 45 869877. (https://doi.org/10.1515/jpm-2016-0406)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Petrulea MS, Plantinga TS, Smit JW, Georgescu CE & Netea-Maier RT 2015 PI3K/Akt/mTOR: a promising therapeutic target for non-medullary thyroid carcinoma. Cancer Treatment Reviews 41 707713. (https://doi.org/10.1016/j.ctrv.2015.06.005)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Siegel RL, Miller KD & Jemal A 2018 Cancer statistics, 2018. CA: A Cancer Journal for Clinicians 68 730. (https://doi.org/10.3322/caac.21442)

  • Thiery JP 2002 Epithelial-mesenchymal transitions in tumour progression. Nature Reviews: Cancer 2 442454. (https://doi.org/10.1038/nrc822)

  • Thiery JP, Acloque H, Huang RY & Nieto MA 2009 Epithelial-mesenchymal transitions in development and disease. Cell 139 871890. (https://doi.org/10.1016/j.cell.2009.11.007)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Thomas A, Klein MS, Stevens AP, Reinders Y, Hellerbrand C, Dettmer K, Gronwald W, Oefner PJ & Reinders J 2013 Changes in the hepatic mitochondrial and membrane proteome in mice fed a non-alcoholic steatohepatitis inducing diet. Journal of Proteomics 80 107122. (https://doi.org/10.1016/j.jprot.2012.12.027)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Turro S, Ingelmo-Torres M, Estanyol JM, Tebar F, Fernandez MA, Albor CV, Gaus K, Grewal T, Enrich C & Pol A 2006 Identification and characterization of associated with lipid droplet protein 1: a novel membrane-associated protein that resides on hepatic lipid droplets. Traffic 7 12541269. (https://doi.org/10.1111/j.1600-0854.2006.00465.x)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vasko VV & Saji M 2007 Molecular mechanisms involved in differentiated thyroid cancer invasion and metastasis. Current Opinion in Oncology 19 1117. (https://doi.org/10.1097/CCO.0b013e328011ab86)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vasko V, Espinosa AV, Scouten W, He H, Auer H, Liyanarachchi S, Larin A, Savchenko V, Francis GL, de la Chapelle A, 2007 Gene expression and functional evidence of epithelial-to-mesenchymal transition in papillary thyroid carcinoma invasion. PNAS 104 28032808. (https://doi.org/10.1073/pnas.0610733104)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang Q, Acharya N, Liu Z, Zhou X, Cromie M, Zhu J & Gao W 2018 Enhanced anticancer effects of Scutellaria barbata D. Don in combination with traditional Chinese medicine components on non-small cell lung cancer cells. Journal of Ethnopharmacology 217 140151. (https://doi.org/10.1016/j.jep.2018.02.020)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Wu CC, MacCoss MJ, Mardones G, Finnigan C, Mogelsvang S, Yates JR 3rd & Howell KE 2004 Organellar proteomics reveals Golgi arginine dimethylation. Molecular Biology of the Cell 15 29072919. (https://doi.org/10.1091/mbc.e04-02-0101)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Xing M 2007 BRAF mutation in papillary thyroid cancer: pathogenic role, molecular bases, and clinical implications. Endocrine Reviews 28 742762. (https://doi.org/10.1210/er.2007-0007)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Xing M 2013 Molecular pathogenesis and mechanisms of thyroid cancer. Nature Reviews: Cancer 13 184199. (https://doi.org/10.1038/nrc3431)

  • Xing M, Westra WH, Tufano RP, Cohen Y, Rosenbaum E, Rhoden KJ, Carson KA, Vasko V, Larin A, Tallini G, 2005 BRAF mutation predicts a poorer clinical prognosis for papillary thyroid cancer. Journal of Clinical Endocrinology and Metabolism 90 63736379. (https://doi.org/10.1210/jc.2005-0987)

    • Crossref
    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 2759 822 0
Full Text Views 699 632 66
PDF Downloads 274 235 59
  • View in gallery

    High expression of METTL7B in PTCs. (A) Heatmap depiction of the thyroid papillary cancer versus normal tissues differentially expressed mRNA. (B) The mRNA levels of METTL7B were analyzed by qRT-PCR in 39 paired PTCs and matched non-cancerous thyroid tissues (Mann–Whitney U test, ***P < 0.001). (C) In the TCGA cohort, data were represented as log2 fold changes, and high METTL7B mRNA levels in PTCs were relative to normal thyroid tissues (Mann–Whitney U test, ***P < 0.001). (D) ROC curve for METTL7B expression to diagnose PTCs in the validated cohort. The area under the ROC curve (AUC) was 86.26%. (E) ROC curve for METTL7B expression to diagnose PTCs in the TCGA cohort. The area under the ROC curve (AUC) was 96.07%. A full colour version of this figure is available at https://doi.org/10.1530/JME-18-0261.

  • View in gallery

    METTL7B promotes thyroid cancer cell growth in vitro. (A and B) Inhibition of METTL7B expression by two different siRNAs in BCPAP and TPC1 were respectively verified by qRT-PCR and western blot analysis. (C) METTL7B knockdown impaired the colony formation ability of thyroid cancer cells. The upper panel shows the representative pictures of colonies in the treated cells, and the statistical data are presented in the below image. (D) The CCK-8 assay also showed its diminished role of METTL7B knockdown on the thyroid cancer cell proliferation. (E and F) METTL7B re-expression in BCPAP, TPC1 and FTC133 cells was validated by qRT-PCR and western blot analysis. (G and H) METTL7B overexpression boosted the proliferation and colony formation of thyroid cancer cells. (P values were calculated by Student’s t-test, *P < 0.05; **P < 0.01; ***P < 0.001). A full colour version of this figure is available at https://doi.org/10.1530/JME-18-0261.

  • View in gallery

    METTL7B facilitates the metastasis of thyroid cancer cells. (A and B) METTL7B knockdown significantly weakened the ability of migration (A) and invasion (B) in BCPAP and TPC1. Inversely, transwell migration (C) and invasion (D) assays were done in BCPAP, TPC1 and FTC133 cells transfected with METTL7B expression plasmid or empty plasmid ***P < 0.001 vs Vector. All data were concluded from three different experiments. Statistical analysis was performed using Student’s t-test. A full colour version of this figure is available at https://doi.org/10.1530/JME-18-0261.

  • View in gallery

    METTL7B facilitates TGF-β1-induced EMT. (A and B) TPC1 and FTC133 cells were incubated with 10 ng/mL TGF-β1 for 3 days. (A) Morphological changes relevant to EMT were observed by the phase contrast microscope. (B) Western blot for E-cadherin and N-cadherin expressions in TPC1 and FTC133 cells. (C) Western blot for E-cadherin and N-cadherin in TPC1 cell, which was transfected with siRNAs and then cultivated with TGF-β1. (D) E-cadherin and N-cadherin levels were detected by western blot analysis in TPC1 and FTC133 cells in which METTL7B was overexpressed and then which were incubated with TGF-β1. (E and F) The expressions of METTL7B was measured in TPC1 and FTC133 cells treated with TGF-β1 for 3 days by qRT-PCR.

  • Abdel-Hameed EA, Ji H, Sherman KE & Shata MT 2014 Epigenetic modification of FOXP3 in patients with chronic HIV infection. Journal of Acquired Immune Deficiency Syndromes 65 1926. (https://doi.org/10.1097/QAI.0b013e3182a1bca4)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Akhurst RJ & Hata A 2012 Targeting the TGFbeta signalling pathway in disease. Nature Reviews: Drug Discovery 11 790811. (https://doi.org/10.1038/nrd3810)

  • Berditchevski F & Odintsova E 1999 Characterization of integrin-tetraspanin adhesion complexes: role of tetraspanins in integrin signaling. Journal of Cell Biology 146 477492. (https://doi.org/10.1083/jcb.146.2.477)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Bommarito A, Richiusa P, Carissimi E, Pizzolanti G, Rodolico V, Zito G, Criscimanna A, Di Blasi F, Pitrone M, Zerilli M, 2011 BRAFV600E mutation, TIMP-1 upregulation, and NF-kappaB activation: closing the loop on the papillary thyroid cancer trilogy. Endocrine-Related Cancer 18 669685. (https://doi.org/10.1530/ERC-11-0076)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Buehler D, Hardin H, Shan W, Montemayor-Garcia C, Rush PS, Asioli S, Chen H & Lloyd RV 2013 Expression of epithelial-mesenchymal transition regulators SNAI2 and TWIST1 in thyroid carcinomas. Modern Pathology 26 5461. (https://doi.org/10.1038/modpathol.2012.137)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Cai WY, Chen X, Chen LP, Li Q, Du XJ & Zhou YY 2018 Role of differentially expressed genes and long non-coding RNAs in papillary thyroid carcinoma diagnosis, progression, and prognosis. Journal of Cellular Biochemistry 119 82498259. (https://doi.org/10.1002/jcb.26836)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Cano A, Perez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, Portillo F & Nieto MA 2000 The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nature Cell Biology 2 7683. (https://doi.org/10.1038/35000025)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, Yu XQ & He J 2016 Cancer statistics in China, 2015. CA: A Cancer Journal for Clinicians 66 115132. (https://doi.org/10.3322/caac.21338)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Davies L & Welch HG 2006 Increasing incidence of thyroid cancer in the United States, 1973–2002. JAMA 295 21642167. (https://doi.org/10.1001/jama.295.18.2164)

  • Donghi R, Longoni A, Pilotti S, Michieli P, Della Porta G & Pierotti MA 1993 Gene p53 mutations are restricted to poorly differentiated and undifferentiated carcinomas of the thyroid gland. Journal of Clinical Investigation 91 17531760. (https://doi.org/10.1172/JCI116385)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Fagin JA, Matsuo K, Karmakar A, Chen DL, Tang SH & Koeffler HP 1993 High prevalence of mutations of the p53 gene in poorly differentiated human thyroid carcinomas. Journal of Clinical Investigation 91 179184. (https://doi.org/10.1172/JCI116168)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Gustafson S, Zbuk KM, Scacheri C & Eng C 2007 Cowden syndrome. Seminars in Oncology 34 428434. (https://doi.org/10.1053/j.seminoncol.2007.07.009)

  • Hardin H, Guo Z, Shan W, Montemayor-Garcia C, Asioli S, Yu XM, Harrison AD, Chen H & Lloyd RV 2014 The roles of the epithelial-mesenchymal transition marker PRRX1 and miR-146b-5p in papillary thyroid carcinoma progression. American Journal of Pathology 184 23422354. (https://doi.org/10.1016/j.ajpath.2014.04.011)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Horn-Ross PL, Lichtensztajn DY, Clarke CA, Dosiou C, Oakley-Girvan I, Reynolds P, Gomez SL & Nelson DO 2014 Continued rapid increase in thyroid cancer incidence in california: trends by patient, tumor, and neighborhood characteristics. Cancer Epidemiology, Biomarkers and Prevention 23 10671079. (https://doi.org/10.1158/1055-9965.EPI-13-1089)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Hou P, Liu D, Shan Y, Hu S, Studeman K, Condouris S, Wang Y, Trink A, El-Naggar AK, Tallini G, 2007 Genetic alterations and their relationship in the phosphatidylinositol 3-kinase/Akt pathway in thyroid cancer. Clinical Cancer Research 13 11611170. (https://doi.org/10.1158/1078-0432.CCR-06-1125)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kalluri R & Neilson EG 2003 Epithelial-mesenchymal transition and its implications for fibrosis. Journal of Clinical Investigation 112 17761784. (https://doi.org/10.1172/JCI20530)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kalluri R & Weinberg RA 2009 The basics of epithelial-mesenchymal transition. Journal of Clinical Investigation 119 14201428. (https://doi.org/10.1172/JCI39104)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kim DW, Walker RL, Meltzer PS & Cheng SY 2013 Complex temporal changes in TGFbeta oncogenic signaling drive thyroid carcinogenesis in a mouse model. Carcinogenesis 34 23892400. (https://doi.org/10.1093/carcin/bgt175)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kim TH, Park YJ, Lim JA, Ahn HY, Lee EK, Lee YJ, Kim KW, Hahn SK, Youn YK, Kim KH, 2012 The association of the BRAF(V600E) mutation with prognostic factors and poor clinical outcome in papillary thyroid cancer: a meta-analysis. Cancer 118 17641773. (https://doi.org/10.1002/cncr.26500)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • La Vecchia C, Malvezzi M, Bosetti C, Garavello W, Bertuccio P, Levi F & Negri E 2015 Thyroid cancer mortality and incidence: a global overview. International Journal of Cancer 136 21872195. (https://doi.org/10.1002/ijc.29251)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Li H, Tian Z, Qu Y, Yang Q, Guan H, Shi B, Ji M & Hou P 2019 SIRT7 promotes thyroid tumorigenesis through phosphorylation and activation of Akt and p70S6K1 via DBC1/SIRT1 axis. Oncogene 38 345359. (https://doi.org/10.1038/s41388-018-0434-6)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu D, Liu Z, Condouris S & Xing M 2007 BRAF V600E maintains proliferation, transformation, and tumorigenicity of BRAF-mutant papillary thyroid cancer cells. Journal of Clinical Endocrinology and Metabolism 92 22642271. (https://doi.org/10.1210/jc.2006-1613)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Liu LK, Jiang XY, Zhou XX, Wang DM, Song XL & Jiang HB 2010 Upregulation of vimentin and aberrant expression of E-cadherin/beta-catenin complex in oral squamous cell carcinomas: correlation with the clinicopathological features and patient outcome. Modern Pathology 23 213224. (https://doi.org/10.1038/modpathol.2009.160)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Liu Z, Kakudo K, Bai Y, Li Y, Ozaki T, Miyauchi A, Taniguchi E & Mori I 2011 Loss of cellular polarity/cohesiveness in the invasive front of papillary thyroid carcinoma, a novel predictor for lymph node metastasis; possible morphological indicator of epithelial mesenchymal transition. Journal of Clinical Pathology 64 325329. (https://doi.org/10.1136/jcp.2010.083956)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu X, Bishop J, Shan Y, Pai S, Liu D, Murugan AK, Sun H, El-Naggar AK & Xing M 2013 Highly prevalent tert promoter mutations in aggressive thyroid cancers. Endocrine-Related Cancer 20 603610. (https://doi.org/10.1530/ERC-13-0210)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • McKinnon CM & Mellor H 2017 The tumor suppressor RhoBTB1 controls Golgi integrity and breast cancer cell invasion through METTL7B. BMC Cancer 17 145. (https://doi.org/10.1186/s12885-017-3138-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Montemayor-Garcia C, Hardin H, Guo Z, Larrain C, Buehler D, Asioli S, Chen H & Lloyd RV 2013 The role of epithelial mesenchymal transition markers in thyroid carcinoma progression. Endocrine Pathology 24 206212. (https://doi.org/10.1007/s12022-013-9272-9)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nawshad A, Lagamba D, Polad A & Hay ED 2005 Transforming growth factor-beta signaling during epithelial-mesenchymal transformation: implications for embryogenesis and tumor metastasis. Cells, Tissues, Organs 179 1123. (https://doi.org/10.1159/000084505)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nevalainen J, Skarp S, Savolainen ER, Ryynanen M & Jarvenpaa J 2017 Intrauterine growth restriction and placental gene expression in severe preeclampsia, comparing early-onset and late-onset forms. Journal of Perinatal Medicine 45 869877. (https://doi.org/10.1515/jpm-2016-0406)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Petrulea MS, Plantinga TS, Smit JW, Georgescu CE & Netea-Maier RT 2015 PI3K/Akt/mTOR: a promising therapeutic target for non-medullary thyroid carcinoma. Cancer Treatment Reviews 41 707713. (https://doi.org/10.1016/j.ctrv.2015.06.005)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Siegel RL, Miller KD & Jemal A 2018 Cancer statistics, 2018. CA: A Cancer Journal for Clinicians 68 730. (https://doi.org/10.3322/caac.21442)

  • Thiery JP 2002 Epithelial-mesenchymal transitions in tumour progression. Nature Reviews: Cancer 2 442454. (https://doi.org/10.1038/nrc822)

  • Thiery JP, Acloque H, Huang RY & Nieto MA 2009 Epithelial-mesenchymal transitions in development and disease. Cell 139 871890. (https://doi.org/10.1016/j.cell.2009.11.007)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Thomas A, Klein MS, Stevens AP, Reinders Y, Hellerbrand C, Dettmer K, Gronwald W, Oefner PJ & Reinders J 2013 Changes in the hepatic mitochondrial and membrane proteome in mice fed a non-alcoholic steatohepatitis inducing diet. Journal of Proteomics 80 107122. (https://doi.org/10.1016/j.jprot.2012.12.027)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Turro S, Ingelmo-Torres M, Estanyol JM, Tebar F, Fernandez MA, Albor CV, Gaus K, Grewal T, Enrich C & Pol A 2006 Identification and characterization of associated with lipid droplet protein 1: a novel membrane-associated protein that resides on hepatic lipid droplets. Traffic 7 12541269. (https://doi.org/10.1111/j.1600-0854.2006.00465.x)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vasko VV & Saji M 2007 Molecular mechanisms involved in differentiated thyroid cancer invasion and metastasis. Current Opinion in Oncology 19 1117. (https://doi.org/10.1097/CCO.0b013e328011ab86)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vasko V, Espinosa AV, Scouten W, He H, Auer H, Liyanarachchi S, Larin A, Savchenko V, Francis GL, de la Chapelle A, 2007 Gene expression and functional evidence of epithelial-to-mesenchymal transition in papillary thyroid carcinoma invasion. PNAS 104 28032808. (https://doi.org/10.1073/pnas.0610733104)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang Q, Acharya N, Liu Z, Zhou X, Cromie M, Zhu J & Gao W 2018 Enhanced anticancer effects of Scutellaria barbata D. Don in combination with traditional Chinese medicine components on non-small cell lung cancer cells. Journal of Ethnopharmacology 217 140151. (https://doi.org/10.1016/j.jep.2018.02.020)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Wu CC, MacCoss MJ, Mardones G, Finnigan C, Mogelsvang S, Yates JR 3rd & Howell KE 2004 Organellar proteomics reveals Golgi arginine dimethylation. Molecular Biology of the Cell 15 29072919. (https://doi.org/10.1091/mbc.e04-02-0101)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Xing M 2007 BRAF mutation in papillary thyroid cancer: pathogenic role, molecular bases, and clinical implications. Endocrine Reviews 28 742762. (https://doi.org/10.1210/er.2007-0007)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Xing M 2013 Molecular pathogenesis and mechanisms of thyroid cancer. Nature Reviews: Cancer 13 184199. (https://doi.org/10.1038/nrc3431)

  • Xing M, Westra WH, Tufano RP, Cohen Y, Rosenbaum E, Rhoden KJ, Carson KA, Vasko V, Larin A, Tallini G, 2005 BRAF mutation predicts a poorer clinical prognosis for papillary thyroid cancer. Journal of Clinical Endocrinology and Metabolism 90 63736379. (https://doi.org/10.1210/jc.2005-0987)

    • Crossref
    • Search Google Scholar
    • Export Citation