Abstract
We hypothesize that cholecystokinin (CCK) and glucagon-like peptide-1 (GLP-1) are involved in the modulation of metabolic regulation of food intake by fatty acids in fish. Therefore, we assessed in rainbow trout (Oncorhynchus mykiss) the effects of intracerebroventricular treatment with 1 ng/g of CCK-8 and with 2 ng/g of GLP-1 on food intake, expression of neuropeptides involved in food intake control and the activity of fatty acid-sensing systems in hypothalamus and hindbrain. Food intake decreased up to 24 h post-treatment to 49.8–72.3% and 3.1–17.8% for CCK-8 and GLP-1, respectively. These anorectic responses are associated with changes in fatty acid metabolism and an activation of fatty acid-sensing mechanisms in the hypothalamus and hindbrain. These changes occurred in parallel with those in the expression of anorexigenic and orexigenic peptides. Moreover, we observed that the activation of fatty acid sensing and the enhanced anorectic potential elicited by CCK-8 and GLP-1 treatments occurred in parallel with the activation of mTOR and FoxO1 and the inhibition of AMPKα, BSX and CREB. The results are discussed in the context of metabolic regulation of food intake in fish.
Introduction
The regulation of food intake is a complex process in which changes in circulating levels of metabolites and hormones as well as nervous signals are integrated in specific brain regions as demonstrated in mammals (Blouet & Schwartz 2010, Efeyan et al. 2015, Bruce et al. 2017) and fish (Soengas 2014, Delgado et al. 2017, Soengas et al. 2018). In previous studies (see reviews by Soengas 2014, Conde-Sieira & Soengas 2016) we demonstrated that fish hypothalamus and hindbrain are able to detect changes in the levels of specific long-chain fatty acids (LCFA) through fatty acid-sensing mechanisms. These are based on carnitine palmitoyl transferase-1 (CPT-1), fatty acid translocase (FAT/CD36), increased capacity of mitochondria to produce reactive oxygen species inhibiting ATP-dependent inward rectified potassium channel (K+ ATP) and lipoprotein lipase (LPL) activity. These mechanisms are, in general, comparable to those described in mammals (Blouet & Schwartz 2010, Morton et al. 2014, Magnan et al. 2015) with the exception of the ability of fish systems for detecting not only changes in the levels of LCFA but also medium-chain fatty acid like octanoate and poly unsaturated fatty acid like α-linolenate (reviewed in Delgado et al. 2017, Soengas et al. 2018). The activation of these systems in fish occur in parallel with decreased activity of the energy sensor 5′-AMP-activated protein kinase (AMPK) and increased activity of mechanistic target of rapamycin (mTOR) (Velasco et al. 2017). The activation of nutrient-sensing systems in fish generally occurred in parallel with increased production of the anorexigenic peptides pro-opio melanocortin (POMC) and cocaine- and amphetamine-related transcript (CART) and decreased production of the orexigenic peptides neuropeptide Y (NPY) and agouti-related peptide (AgRP) (Conde-Sieira & Soengas 2016). These changes ultimately lead to decreased food intake (Soengas et al. 2018) in a way comparable to that observed in mammals (Belgardt et al. 2009, Blouet & Schwartz 2010, Morton et al. 2014). The mechanisms linking the function of nutrient-sensing systems to changes in the expression of neuropeptides are mostly unknown, even in mammals. Changes in the expression of neuropeptides might relate to the modulation of forkhead boxO1 (FoxO1), cAMP response element-binding protein (CREB) and brain homeobox transcription factor (BSX) (Belgardt et al. 2009, Diéguez et al. 2011, Gao et al. 2013, Morton et al. 2014). However, it is not clear how these transcription factors respond to the activity of the different nutrient-sensing systems.
The function of nutrient-sensing systems and their impact on food intake regulation can be modulated by changes in the levels of hormones like glucagon-like peptide 1 (GLP-1), cholecystokinin (CCK), leptin, insulin or ghrelin, as demonstrated in mammals (Blouet & Schwartz 2010, Morton et al. 2014). To date, the information available in fish regarding the endocrine modulation of central fatty acid-sensing systems is scarce and restricted to insulin (Librán-Pérez et al. 2015), ghrelin (Velasco et al. 2016a ), PYY1–36 (Velasco et al. 2018) and nesfatin-1 (Blanco et al. 2018) with no information available regarding other gastrointestinal tract (GIT) hormones like CCK or GLP-1.
CCK belongs to the CCK-gastrin family characterized by an evolutionary conserved C-terminal sequence required for its biological activity (Konturek et al. 2003). In mammals, this peptide once released by endocrine I cells in the GIT (in response to the presence of food) binds to CCKAR receptor in the gut and the signal is transmitted by the vagus nerve to the hindbrain, and then relayed to the hypothalamus (Cheung et al. 2009). The release of CCK is stimulated mainly by the presence of fat and small peptides from digestion (Moran & Kinzig 2004). In addition CCK is also produced directly by the brain acting as a neurohormone with CCK-8 being the most abundant form in this area (Strader & Woods 2005). In fish, CCK and its binding sites have been identified in the brain and GIT of a large number of species, including rainbow trout Oncorhynchus mykiss (Jensen et al. 2001). A differential distribution pattern of CCK receptor subtypes is present in fish, as described in goldfish Carassius auratus (Tinoco et al. 2015), with a high expression of CCK1 subtype in the intestine whereas the CCK2 subtype predominantly expressed in the hypothalamus and vagal lobe. Similar to mammals (Chandra & Liddle 2007), CCK in fish elicits several effects such as decreasing gastric emptying, stimulating gall bladder contraction and gastrointestinal motility (Holmgren & Olsson 2009). CCK also acts as a satiety signal resulting in anorectic effects in several fish species (Delgado et al. 2017, Soengas et al. 2018) including rainbow trout (Gélineau & Boujard 2001, Jönsson et al. 2006).
GLP-1 belongs to the family of glucagon and, in mammals, is mainly secreted by intestinal L cells in response to food, playing an important role in glucose metabolism (Lockie 2013, Andersen et al. 2018). This peptide has been identified in several fish species where is produced by both pancreas and intestine (Silverstein et al. 2001) and receptors are present in brain regions including the hypothalamus and hindbrain (Yeung et al. 2002). The known actions of GLP-1 in fish and mammals for the regulation of glucose metabolism are remarkably different. Thus, in fish, GLP-1 stimulates gluconeogenesis and glycogenolysis (Mommsen et al. 1987, Mojsov 2000, Irwin & Mojsov 2018), thereby increasing glycaemia, whereas in mammals it stimulates insulin release (incretin) and slows gastric emptying reducing glucose availability (Andersen et al. 2018). GLP-1 is also produced by some neurons in brain areas like the hindbrain playing an important role in the regulation of feeding behaviour (Drucker 2002). Both intracerebroventricular (ICV) and peripheral injection of GLP-1 decrease food intake in mammals (Strader & Woods 2005) and in teleost fish species like channel catfish Ictalurus punctatus (Silverstein et al. 2001) and coho salmon Oncorhynchus kisutch (White et al. 2016).
CCK (Polakof et al. 2011a ) or GLP-1 (Polakof et al. 2011b ) treatments activate glucosensing capacity in the hypothalamus and hindbrain of rainbow trout, together with changes in mRNA abundance of several neuropeptides, suggesting that these peptides regulate not only food intake but also glucose homeostasis. Although the role of CCK and GLP-1 on fish appetite regulation has been relatively studied in fish (Delgado et al. 2017, Soengas et al. 2018), their involvement in the regulation of lipid metabolism has received little attention. Therefore, in this study, we aimed to assess in rainbow trout if CCK-8 and GLP-1 central treatment results in decreased food intake as demonstrated in other fish species. Once the anorectic role of these peptides were demonstrated, we evaluated under the same conditions changes in (i) brain expression of mRNAs encoding neuropeptides involved in the metabolic control of food intake such as AgRP, NPY, POMCa1 and CART, (ii) parameters related to fatty acid-sensing systems and (iii) cellular signalling pathways putatively involved in linking changes in nutrient-sensing systems to neuropeptide expression, and ultimately food intake.
Materials and methods
Fish
Immature rainbow trout of both sexes were obtained from a local fish farm (A Estrada, Spain). These fish were maintained for 1 month in 100 L tanks under laboratory conditions and 12L:12D photoperiod (lights on at 08:00, lights off at 20:00) in dechlorinated tap water at 15°C. Fish weight was 98 ± 2 g. Fish were fed once daily (10:00) to satiety with commercial dry fish pellets (Dibaq-Diproteg SA, Spain; proximate food analysis was 48% crude protein, 14% carbohydrates, 25% crude fat and 11.5% ash; 20.2 MJ/kg of feed). The experiments described comply with the Guidelines of the European Union Council (2010/63/UE), and of the Spanish Government (RD 53/2013) for the use of animals in research, and were approved by the Ethics Committee of the Universidade de Vigo.
Experimental design
In a first set of experiments, following 1 month acclimation period, fish were randomly assigned to 100 L experimental tanks following ARRIVE guidelines. On the day of experiment, at 10:00, fish were anaesthetized with 2-phenoxyethanol (Sigma, 0.02% v/v), and weighed to carry out ICV administration as previously described (Polakof & Soengas 2008). Briefly, fish were placed on a plexiglass board with Velcro straps adjusted to hold them in place. A 29½ gauge needle attached through a polyethylene cannula to a 10 µL Hamilton syringe was aligned with the 6th preorbital bone at the rear of the eye socket, and from this point the syringe was moved through the space in the frontal bone into the third ventricle. The plunger of the syringe was slowly depressed to dispense 1 µL × 100/g body mass of saline solution alone (control, n = 10), or containing 1 ng/g of rainbow trout CCK-8 (n = 10) or containing 2 ng/g rainbow trout GLP-1 (n = 10). Both peptides were synthesized by Bachem (Bubendorf, Switzerland) according to rainbow trout sequences published by Jensen et al. (2001) and Irwin and Wong (1995), for CCK-8 and GLP-1, respectively. The doses of CCK-8 and GLP-1 were selected based on studies carried out previously in our laboratory (Polakof et al. 2011a , b ). Food intake was registered for 7 days before treatment (to define basal line data) and then 2, 6 and 24 h after treatment. After feeding, the remaining uneaten food at the bottom (conical tanks) and feed waste were withdrawn, dried and weighed. The amount of food consumed by all fish in each tank was calculated as previously described as the difference from the feed offered (De Pedro et al. 1998, Polakof et al. 2008a , b ). The experiment was repeated three times, and therefore results are shown as the mean + s.e.m. of the data obtained in three different tanks per treatment.
In a second set of experiments, following 1 month acclimation period, fish were randomly assigned to 100 L experimental tanks following ARRIVE guidelines. On the day of experiment, at 10:00, fish were anaesthetized with 2-phenoxyethanol (Sigma, 0.02% v/v), weighed and ICV injected, as described above, with saline alone (control, n = 21 at 2 h, and n = 21 at 6 h) or containing CCK-8 (n = 21 at 2 h, and n = 21 at 6 h) or containing GLP-1 (n = 21 at 2 h, and n = 21 at 6 h) using the same concentrations as described above. After 2 h or 6 h, fish were anaesthetized in tanks with 2-phenoxyethanol (Sigma, 0.02% v/v). Blood was collected by caudal puncture with ammonium-heparinized syringes, and plasma samples were obtained after blood centrifugation, deproteinized immediately (using 0.6 M perchloric acid) and neutralized (using 1 M potassium bicarbonate) before freezing and storage at −80°C until further assay. Fish were killed by decapitation and the hypothalamus and hindbrain were taken, snap-frozen and stored at −80°C. At each time, nine fish per group were used to assess enzyme activities and metabolite levels, six fish per group were used for the assessment of mRNA levels by qRT-PCR, whereas the remaining six fish per group were used to assess by Western blot changes in the levels and phosphorylation status of proteins of interest.
Assessment of metabolite levels and enzyme activities
Levels of fatty acid, total lipid, triglyceride, glucose and lactate in plasma were determined enzymatically using commercial kits (Wako Chemicals, for fatty acid; Spinreact, Barcelona, Spain, for total lipid, triglyceride, glucose and lactate) adapted to a microplate format.
Samples used to assess tissue metabolite levels were homogenized immediately by ultrasonic disruption in 7.5 vols of ice-cooled 0.6 M perchloric acid, and neutralized (using 1 M potassium bicarbonate). The homogenate was centrifuged (10,000 g ), and the supernatant used to assay tissue metabolites. Fatty acid, total lipid and triglyceride levels were determined enzymatically using commercial kits as described above for plasma samples.
Samples for enzyme activities were homogenized by ultrasonic disruption with 9 vols of ice-cold buffer consisting of 50 mM Tris (pH 7.6), 5 mM EDTA, 2 mM 1,4-dithiothreitol and a protease inhibitor cocktail (Sigma). The homogenate was centrifuged (10,000 g ) and the supernatant used immediately for enzyme assays. Enzyme activities were determined using a microplate reader INFINITE 200 Pro (Tecan, Männedorf, Switzerland) and microplates. Reaction rates of enzymes were determined by the increase or decrease in absorbance of NAD(P)H at 340 nm or, in the case of carnitine palmitoyl transferase 1 (CPT-1) activity, of 5,5′-dithiobis(2-nitrobenzoic acid)-CoA complex at 412 nm. The reactions were started by the addition of supernatant (15 µL) at a pre-established protein concentration, omitting the substrate in control wells (final volume 265–295 µL) and allowing the reactions to proceed at 20°C for pre-established times (3–10 min). Enzyme activities are expressed in terms of mg protein. Protein was assayed in triplicates in homogenates using microplates according to the bicinchoninic acid method with bovine serum albumin (Sigma) as standard. Initial rates of enzyme activities were assessed under optimal substrate concentrations (determined in preliminary tests). ATP-citrate lyase (ACLY, EC 4.1.3.8), CPT-1 (EC 2.3.1.21) and fatty acid synthase (FAS, EC 2.3.1.85) activities were determined following available methods (Alvarez et al. 2000, Polakof et al. 2011c , Ditlecadet & Driedzic 2013, respectively).
mRNA abundance analysis by RT-qPCR
Total RNA was extracted using Trizol reagent (Life Technologies) and subsequently treated with RQ1-DNAse (Promega). Two µg total RNA were reverse transcribed using Superscript II reverse transcriptase (Promega) and random hexamers (Promega) to obtain approx. 20 µL. Gene expression levels were determined by RT-qPCR using the iCycler iQ (BIO-RAD). Analyses were performed on 1 µL cDNA using MAXIMA SYBR Green qPCR Mastermix (Life Technologies), in a total PCR assay volume of 15 µL, containing 50–500 nM of each primer. mRNA abundance of transcripts was determined as previously described in the same species (Leder & Silverstein 2006, Ducasse-Cabanot et al. 2007, Kolditz et al. 2008, Conde-Sieira et al. 2010, 2018, Polakof et al. 2010, Figueiredo-Silva et al. 2012, Sanchez-Gurmaches et al. 2012, MacDonald et al. 2014). Sequences of the forward and reverse primers used for each gene expression are shown in Table 1. Relative quantification of the target gene transcript was done using β-actin gene expression as reference, which was stably expressed in this experiment. Thermal cycling was initiated with incubation at 95°C for 90 s using hot-start iTaq DNA polymerase activation followed by 35 cycles, each one consisting of heating at 95°C for 20 s, and specific annealing and extension temperatures for 20 s. Following the final PCR cycle, melting curves were systematically monitored (55°C temperature gradient at 0.5°C/s from 55 to 94°C) to ensure that only one fragment was amplified. Samples without reverse transcriptase and samples without RNA were run for each reaction as negative controls. Relative quantification of the target gene transcript with the β-actin reference gene transcript was made following the Pfaffl method (2001).
Nucleotide sequences of the PCR primers used to evaluate mRNA abundance by RT-qPCR.
| Forward primer | Reverse primer | Annealing temperature (°C) | Database | Accession number | |
|---|---|---|---|---|---|
| β-Actin | GATGGGCCAGAAAGACAGCTA | TCGTCCCAGTTGGTGACGAT | 59 | GenBank | NM_ 001124235.1 |
| acly | CTGAAGCCCAGACAAGGAAG | CAGATTGGAGGCCAAGATGT | 60 | GenBank | CA349411.1 |
| agrp1 | ACCAGCAGTCCTGTCTGGGTAA | AGTAGCAGATGGAGCCGAACA | 60 | GenBank | NM_001146677 |
| bsx | CATCCAGAGTTACCCGGCAAG | TTTTCACCTGGGTTTCCGAGA | 60 | GenBank | MG310161 |
| cart | ACCATGGAGAGCTCCAG | GCGCACTGCTCTCCAA | 60 | GenBank | NM_001124627 |
| cpt1c | CGCTTCAAGAATGGGGTGAT | CAACCACCTGCTGTTTCTCA | 59 | GenBank | AJ619768 |
| creb | CGGATACCAGTTGGAGGAGGA | AGCAGCAGCACTCGTTTAGGC | 60 | GenBank | MG310160 |
| fasn | GAGACCTAGTGGAGGCTGTC | TCTTGTTGATGGTGAGCTGT | 59 | Sigenae | tcab0001c.e.06 5.1.s.om.8 |
| cd36 | CAAGTCAGCGACAAACCAGA | ACTTCTGAGCCTCCACAGGA | 62 | DFCI | AY606034.1 |
| foxo1 | AACTCCCACAGCCACAGCAAT | CGATGTCCTGTTCCAGGAAGG | 60 | GenBank | MG310159 |
| kir6.x-like | TTGGCTCCTCTTCGCCATGT | AAAGCCGATGGTCACCTGGA | 60 | Sigenae | CA346261.1.s.om.8:1:773:1 |
| lpl | TAATTGGCTGCAGAAAACAC | CGTCAGCAAACTCAAAGGT | 59 | GenBank | AJ224693 |
| npy | CTCGTCTGGACCTTTATATGC | GTTCATCATATCTGGACTGTG | 58 | GenBank | NM_001124266 |
| pomca1 | CTCGCTGTCAAGACCTCAACTCT | GAGTTGGGTTGGAGATGGACCTC | 60 | Tigr | TC86162 |
| ppara | CTGGAGCTGGATGACAGTGA | GGCAAGTTTTTGCAGCAGAT | 55 | GenBank | AY494835 |
| pparg | GACGGCGGGTCAGTACTTTA | ATGCTCTTGGCGAACTCTGT | 60 | DFCI | CA345564 |
| srebp1c | GACAAGGTGGTCCAGTTGCT | CACACGTTAGTCCGCATCAC | 60 | GenBank | CA048941.1 |
| ucp2a | TCCGGCTACAGATCCAGG | CTCTCCACAGACCACGCA | 57 | GenBank | DQ295324 |
Western blot
Frozen samples (20 mg) were homogenized in 1 mL of buffer containing 150 mM NaCl, 10 mM Tris–HCl, 1 mM EGTA, 1 mM EDTA (pH 7.4), 100 mM sodium fluoride, 4 mM sodium pyrophosphate, 2 mM sodium orthovanadate, 1% Triton X-100, 0.5% NP40-IGEPAL and 1.02 mg/mL protease inhibitor cocktail (Sigma). Tubes were kept on ice during the whole process to prevent protein denaturation. Homogenates were centrifuged at 1000 g for 15 min at 4°C, and supernatants were again centrifuged at 20,000 g for 30 min. The resulting supernatants were recovered and stored at −80°C. The concentration of protein in each sample was determined using Bradford assay with bovine serum albumin as standard. Hypothalamus protein lysates (10 μg) were used for Western blot with antibodies from (1) Cell Signaling Technology: anti-phospho AMPKα (Thr172) reference #2531, anti-AMPKα reference #2532, anti-phospho CREB (Ser133) reference #9198, anti-CREB reference #9197, anti-phospho-FoxO1 (Thr24) reference #9464, anti-FoxO1 reference #9454, anti-phospho mTOR (Ser2448) reference #5536 and anti-β-tubulin reference #2146; (2) Sigma: anti-mTOR reference #T2949; (3) Abcam: anti-BSX reference #56092. All these antibodies cross-react successfully with rainbow trout proteins of interest (Skiba-Cassy et al. 2009, Kamalam et al. 2012, Velasco et al. 2016a , Conde-Sieira et al. 2018). After washing, membranes were incubated with an IgG-HRP secondary antibody reference #2015718 (Abcam) and bands were quantified by Image Lab software version 5.2.1 (BIO-RAD) in a Chemidoc Touch imaging system (BIO-RAD).
Statistics
Comparisons were carried out with the SigmaStat (v11) statistical package. Comparisons among groups were carried out using a two-way ANOVA with treatments (CCK-8 and GLP-1) and time (2 and 6 h). Where significant effects were obtained from the ANOVA, post-hoc comparisons were carried out using a Student–Newman–Keuls (SNK) test to assess the significance (P < 0.05) of differences among treatments and between sampling times.
Results
The statistical significance of the differences observed in the parameters assessed attributed to the main factors and its interaction in the two-way ANOVA are shown in Table 2 for parameters assessed in the hypothalamus and hindbrain. No significant differences resulted from the two-way ANOVA analysis of parameters assessed in plasma whereas food intake was significantly affected by treatment (P < 0.001) and not by time and treatment × time interaction. Treatment significantly affected food intake and most parameters assessed in the hypothalamus (except mRNA abundance of agrp, cart, fat/cd36 and ppara, and levels of P-Mtor/β-Tubulin) and hindbrain (except levels of fatty acid and total lipid, mRNA abundance of acly, agrp, cpt1c, srebp1c and ucp2a, and protein levels of Bsx/β-Tubulin and P-Foxo1/Foxo1). Several time effects were observed in the hypothalamus for levels of metabolites (fatty acid), enzyme activities (FAS and ACLY), mRNA abundance (acly, bsx, creb, kir6.x-like, pomca1, ppara) and protein levels (P-Aampkα/Ampkα and P-Mtor/β-Tubulin). In the hindbrain, time effects were observed for metabolite levels (triglyceride) and mRNA abundance (cart, creb, fat/cd36, foxo1, kir6.x-like, npy and srebp1c). Finally, a few significant treatment × time interactions were observed in the hypothalamus (total lipid levels, mRNA abundance of bsx, creb, fasn and ucp2a, and protein levels of P-Ampkα/Ampkα) and hindbrain (ACLY activity, mRNA abundance of cart and protein levels of P-AmpkMPKα/Apmpkα).
P-Values obtained after two-way analysis of variance of parameters assessed in the hypothalamus and hindbrain of rainbow trout.
| Parameter | Hypothalamus | Hindbrain | ||||
|---|---|---|---|---|---|---|
| Treatment | Time | Treatment × time | Treatment | Time | Treatment × time | |
| Metabolite levels | ||||||
| Fatty acid | 0.035 | 0.031 | – | – | – | – |
| Triglyceride | 0.033 | – | – | 0.047 | 0.001 | – |
| Total lipid | 0.042 | – | 0.005 | – | – | – |
| Enzyme activities | ||||||
| CPT-1 | 0.041 | – | – | 0.026 | – | – |
| FAS | <0.001 | 0.039 | – | 0.003 | 0.001 | – |
| ACLY | 0.046 | 0.042 | – | 0.047 | – | 0.002 |
| mRNA abundance | ||||||
| acly | 0.015 | 0.002 | – | – | – | – |
| agrp | – | – | – | – | – | – |
| bsx | 0.031 | 0.032 | 0.027 | 0.048 | – | – |
| cart | – | – | – | 0.040 | 0.005 | 0.031 |
| cpt1c | 0.048 | – | – | – | – | – |
| creb | <0.001 | 0.002 | <0.001 | 0.041 | 0.002 | – |
| fasn | 0.021 | – | 0.044 | 0.039 | – | – |
| cd36 | – | – | – | 0.008 | <0.001 | – |
| foxo1 | 0.007 | – | – | 0.031 | <0.001 | – |
| kir6.x-like | 0.036 | 0.016 | – | 0.048 | 0.034 | – |
| lpl | 0.036 | – | – | <0.001 | – | – |
| npy | 0.034 | – | – | 0.044 | 0.010 | – |
| pomca1 | 0.029 | <0.001 | – | 0.021 | – | – |
| ppara | – | 0.015 | – | 0.026 | – | – |
| pparg | 0.034 | – | – | 0.040 | – | – |
| srebp1c | 0.046 | – | – | – | 0.011 | – |
| ucp2a | 0.009 | – | 0.034 | – | – | – |
| Levels or phosphorylation status of signalling proteins | ||||||
| P-Ampkα/Ampkα | 0.038 | 0.040 | 0.019 | 0.006 | – | 0.009 |
| Bsx/β-Tubulin | 0.043 | – | – | – | – | – |
| P-Creb/Creb | 0.039 | – | – | 0.013 | – | – |
| P-Mtorβ-Ttubulin | – | <0.001 | – | 0.002 | – | – |
| P-Foxo/Foxo1 | <0.001 | – | – | – | – | – |
Treatment (control, CCK-8 and GLP-1) and time (2 h and 6 h) were the main factors, and treatment × time is the first-order interaction. All values are significantly different unless noted by a dash.
The significant differences resulting from post-hoc comparisons among treatments and between times are detailed in Figs 1, 2, 3, 4, 5, 6, 7 and Tables 3, 4. For simplicity, we will only describe in the next paragraphs the differences observed among treatments.
Food intake in rainbow trout 2, 6 and 24 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Food intake is displayed as mean + s.e.m. of the percentage of food ingested with respect to baseline levels (calculated as the average of food intake the 7 days prior to experiment). The results are shown as mean + s.e.m. of the results obtained in three different experiments in which 10 fish were used per group in each tank. Different letters indicate significant differences (P < 0.05) from different treatment at the same time.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Food intake in rainbow trout 2, 6 and 24 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Food intake is displayed as mean + s.e.m. of the percentage of food ingested with respect to baseline levels (calculated as the average of food intake the 7 days prior to experiment). The results are shown as mean + s.e.m. of the results obtained in three different experiments in which 10 fish were used per group in each tank. Different letters indicate significant differences (P < 0.05) from different treatment at the same time.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Food intake in rainbow trout 2, 6 and 24 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Food intake is displayed as mean + s.e.m. of the percentage of food ingested with respect to baseline levels (calculated as the average of food intake the 7 days prior to experiment). The results are shown as mean + s.e.m. of the results obtained in three different experiments in which 10 fish were used per group in each tank. Different letters indicate significant differences (P < 0.05) from different treatment at the same time.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Levels of fatty acid (A), triglyceride (B), total lipid (C), glucose (D) and lactate (E) in plasma of rainbow trout 2 h or 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Each value is the mean + s.e.m. of n = 15 fish per treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Levels of fatty acid (A), triglyceride (B), total lipid (C), glucose (D) and lactate (E) in plasma of rainbow trout 2 h or 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Each value is the mean + s.e.m. of n = 15 fish per treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Levels of fatty acid (A), triglyceride (B), total lipid (C), glucose (D) and lactate (E) in plasma of rainbow trout 2 h or 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Each value is the mean + s.e.m. of n = 15 fish per treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Levels of fatty acid (A and D), triglyceride (B and E) and total lipid (C and F) in the hypothalamus (A, B and C) and hindbrain (D, E and F) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Each value is the mean + s.e.m. of n = 9 fish per treatment. Different letters indicate significant differences (P < 0.05) from different treatment at the same time. # indicates significantly different (P < 0.05) from 2 h at the same treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Levels of fatty acid (A and D), triglyceride (B and E) and total lipid (C and F) in the hypothalamus (A, B and C) and hindbrain (D, E and F) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Each value is the mean + s.e.m. of n = 9 fish per treatment. Different letters indicate significant differences (P < 0.05) from different treatment at the same time. # indicates significantly different (P < 0.05) from 2 h at the same treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Levels of fatty acid (A and D), triglyceride (B and E) and total lipid (C and F) in the hypothalamus (A, B and C) and hindbrain (D, E and F) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Each value is the mean + s.e.m. of n = 9 fish per treatment. Different letters indicate significant differences (P < 0.05) from different treatment at the same time. # indicates significantly different (P < 0.05) from 2 h at the same treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Activities of CPT-1 (A and D), FAS (B and E) and ACLY (C and F) in the hypothalamus (A, B and C) and hindbrain (D, E and F) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Each value is the mean + s.e.m. of n = 9 fish per treatment. Different letters indicate significant differences (P < 0.05) from different treatment at the same time. # indicates significantly different (P < 0.05) from 2 h at the same treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Activities of CPT-1 (A and D), FAS (B and E) and ACLY (C and F) in the hypothalamus (A, B and C) and hindbrain (D, E and F) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Each value is the mean + s.e.m. of n = 9 fish per treatment. Different letters indicate significant differences (P < 0.05) from different treatment at the same time. # indicates significantly different (P < 0.05) from 2 h at the same treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Activities of CPT-1 (A and D), FAS (B and E) and ACLY (C and F) in the hypothalamus (A, B and C) and hindbrain (D, E and F) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Each value is the mean + s.e.m. of n = 9 fish per treatment. Different letters indicate significant differences (P < 0.05) from different treatment at the same time. # indicates significantly different (P < 0.05) from 2 h at the same treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
mRNA abundance of npy (A and E), agrp1 (B and F), pomca1 (C and G) and cart (D and H) in the hypothalamus (A, B, C and D) and hindbrain (E, F, G and H) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Each value is the mean + s.e.m. of n = 6 fish per treatment. Gene expression results are referred to control group 2 h after treatment previously normalized by β-actin expression. Different letters indicate significant differences (P < 0.05) from different treatment at the same time. # indicates significantly different (P < 0.05) from 2 h at the same treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
mRNA abundance of npy (A and E), agrp1 (B and F), pomca1 (C and G) and cart (D and H) in the hypothalamus (A, B, C and D) and hindbrain (E, F, G and H) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Each value is the mean + s.e.m. of n = 6 fish per treatment. Gene expression results are referred to control group 2 h after treatment previously normalized by β-actin expression. Different letters indicate significant differences (P < 0.05) from different treatment at the same time. # indicates significantly different (P < 0.05) from 2 h at the same treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
mRNA abundance of npy (A and E), agrp1 (B and F), pomca1 (C and G) and cart (D and H) in the hypothalamus (A, B, C and D) and hindbrain (E, F, G and H) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. Each value is the mean + s.e.m. of n = 6 fish per treatment. Gene expression results are referred to control group 2 h after treatment previously normalized by β-actin expression. Different letters indicate significant differences (P < 0.05) from different treatment at the same time. # indicates significantly different (P < 0.05) from 2 h at the same treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Phosphorylation status of Ampkα (A and C) and Mtor (B and D) in the hypothalamus (A and B) and hindbrain (C and D) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. 20 μg of total protein was loaded on the gel per lane, and results were normalized by β-tubulin abundance. Western blots were performed on six individual samples per treatment and two representative blots per time and treatment are shown here. Graphs represent the ratio between the phosphorylated protein and the total amount of the target protein. Each value is the mean + s.e.m. of n = 6 fish per treatment. Different letters indicate significant differences (P < 0.05) from different treatment at the same time. # indicates significantly different (P < 0.05) from 2 h at the same treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Phosphorylation status of Ampkα (A and C) and Mtor (B and D) in the hypothalamus (A and B) and hindbrain (C and D) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. 20 μg of total protein was loaded on the gel per lane, and results were normalized by β-tubulin abundance. Western blots were performed on six individual samples per treatment and two representative blots per time and treatment are shown here. Graphs represent the ratio between the phosphorylated protein and the total amount of the target protein. Each value is the mean + s.e.m. of n = 6 fish per treatment. Different letters indicate significant differences (P < 0.05) from different treatment at the same time. # indicates significantly different (P < 0.05) from 2 h at the same treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Phosphorylation status of Ampkα (A and C) and Mtor (B and D) in the hypothalamus (A and B) and hindbrain (C and D) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. 20 μg of total protein was loaded on the gel per lane, and results were normalized by β-tubulin abundance. Western blots were performed on six individual samples per treatment and two representative blots per time and treatment are shown here. Graphs represent the ratio between the phosphorylated protein and the total amount of the target protein. Each value is the mean + s.e.m. of n = 6 fish per treatment. Different letters indicate significant differences (P < 0.05) from different treatment at the same time. # indicates significantly different (P < 0.05) from 2 h at the same treatment.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Western blot analysis of Bsx (A and D), and phosphorylation status of Creb (B and E) and Foxo1 (C and F) in the hypothalamus (A, B and C) and hindbrain (D, E and F) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. 20 μg of total protein was loaded on the gel per lane, and results were normalized by β-tubulin abundance. Western blots were performed on six individual samples per treatment and two representative blots per time and treatment are shown here. Graphs of CREB and FoxO1 represent the ratio between the phosphorylated protein and the total amount of the target protein. Each value is the mean + s.e.m. of n = 6 fish per treatment. Different letters indicate significant differences (P < 0.05) from different treatment at the same time.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Western blot analysis of Bsx (A and D), and phosphorylation status of Creb (B and E) and Foxo1 (C and F) in the hypothalamus (A, B and C) and hindbrain (D, E and F) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. 20 μg of total protein was loaded on the gel per lane, and results were normalized by β-tubulin abundance. Western blots were performed on six individual samples per treatment and two representative blots per time and treatment are shown here. Graphs of CREB and FoxO1 represent the ratio between the phosphorylated protein and the total amount of the target protein. Each value is the mean + s.e.m. of n = 6 fish per treatment. Different letters indicate significant differences (P < 0.05) from different treatment at the same time.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Western blot analysis of Bsx (A and D), and phosphorylation status of Creb (B and E) and Foxo1 (C and F) in the hypothalamus (A, B and C) and hindbrain (D, E and F) of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1. 20 μg of total protein was loaded on the gel per lane, and results were normalized by β-tubulin abundance. Western blots were performed on six individual samples per treatment and two representative blots per time and treatment are shown here. Graphs of CREB and FoxO1 represent the ratio between the phosphorylated protein and the total amount of the target protein. Each value is the mean + s.e.m. of n = 6 fish per treatment. Different letters indicate significant differences (P < 0.05) from different treatment at the same time.
Citation: Journal of Molecular Endocrinology 62, 3; 10.1530/JME-18-0212
Changes in mRNA abundance of selected transcripts in hypothalamus of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1.
| 2 h post treatment | 6 h post treatment | |||||
|---|---|---|---|---|---|---|
| CTR | CCK-8 | GLP-1 | CTR | CCK-8 | GLP-1 | |
| Fatty acid sensing | ||||||
| acly | 1.00 ± 0.13 | 0.87 ± 0.07 | 1.14 ± 0.18 | 1.83 ± 0.22a# | 1.02 ± 0.13b | 1.52 ± 0.14a |
| cpt1c | 1.00 ± 0.08a | 1.00 ± 0.07a | 0.73 ± 0.10b | 0.91 ± 0.10 | 0.97 ± 0.09 | 0.79 ± 0.13 |
| fasn | 1.00 ± 0.10a | 1.05 ± 0.08a | 0.75 ± 0.07b | 1.08 ± 0.11a | 0.62 ± 0.14b# | 0.74 ± 0.11b |
| cd36 | 1.00 ± 0.11 | 1.29 ± 0.16 | 1.00 ± 0.14 | 1.09 ± 0.10 | 1.07 ± 0.10 | 1.02 ± 0.04 |
| kir6.x-like | 1.00 ± 0.10 | 0.98 ± 0.21 | 1.07 ± 0.13 | 1.70 ± 0.03a# | 1.35 ± 0.27ab# | 1.02 ± 0.12b |
| lpl | 1.00 ± 0.12a | 1.29 ± 0.21ab | 1.44 ± 0.21b | 1.19 ± 0.17a | 1.67 ± 0.22b | 1.37 ± 0.23ab |
| ppara | 1.00 ± 0.07 | 0.93 ± 0.06 | 0.83 ± 0.15 | 1.34 ± 0.11# | 1.12 ± 0.12 | 1.20 ± 0.06 |
| pparg | 1.00 ± 0.13a | 0.87 ± 0.05ab | 0.69 ± 0.04b | 1.38 ± 0.05a | 1.26 ± 0.20ab | 0.97 ± 0.17b |
| srebp1c | 1.00 ± 0.06a | 1.29 ± 0.13b | 1.00 ± 0.14a | 1.21 ± 0.22 | 0.83 ± 0.12 | 0.90 ± 0.16 |
| ucp2a | 1.00 ± 0.08 | 1.10 ± 0.08 | 0.89 ± 0.07 | 1.45 ± 0.06a | 0.75 ± 0.18b | 1.04 ± 0.11b |
| Transcription factors | ||||||
| bsx | 1.00 ± 0.15 | 1.11 ± 0.13 | 0.84 ± 0.10 | 1.08 ± 0.18a | 0.45 ± 0.13b# | 0.70 ± 0.07b |
| creb | 1.00 ± 0.14 | 1.06 ± 0.10 | 0.82 ± 0.05 | 1.86 ± 0.08a# | 0.92 ± 0.12b | 1.14 ± 0.13b# |
| foxo1 | 1.00 ± 0.15a | 2.09 ± 0.22b | 1.61 ± 0.15b | 1.44 ± 0.20 | 1.71 ± 0.24 | 1.84 ± 0.19 |
Data represent mean ± s.e.m. of n = 6 fish per treatment. Gene expression results are referred to control group 2 h after treatment previously normalized by β-actin expression. Different letters indicate significant differences (P < 0.05) from different treatment at the same time.
#Significantly different (P < 0.05) from 2 h at the same treatment.
Changes in mRNA abundance of selected transcripts in the hindbrain of rainbow trout 2 and 6 h after intracerebroventricular administration of 1 µL × 100/g body mass of saline alone (control, CTR) or containing 1 ng/g of rainbow trout CCK-8 or 2 ng/g rainbow trout GLP-1.
| 2 h post treatment | 6 h post treatment | |||||
|---|---|---|---|---|---|---|
| CTR | CCK-8 | GLP-1 | CTR | CCK-8 | GLP-1 | |
| Fatty acid sensing | ||||||
| acly | 1.00 ± 0.18 | 0.89 ± 0.21 | 0.96 ± 0.17 | 1.01 ± 0.27 | 1.10 ± 0.03 | 1.06 ± 0.14 |
| cpt1c | 1.00 ± 0.22 | 0.62 ± 0.18 | 0.82 ± 0.07 | 0.96 ± 0.11 | 0.94 ± 0.06 | 0.82 ± 0.11 |
| fasn | 1.00 ± 0.24 | 0.92 ± 0.19 | 0.89 ± 0.10 | 0.93 ± 0.10a | 1.38 ± 0.14b | 1.02 ± 0.15a |
| cd36 | 1.00 ± 0.14a | 1.23 ± 0.23ab | 1.55 ± 0.17b | 1.45 ± 0.20a | 2.36 ± 0.21b# | 2.20 ± 0.13b# |
| kir6.x-like | 1.00 ± 0.03a | 0.73 ± 0.16b | 0.80 ± 0.05b | 1.21 ± 0.11a | 1.17 ± 0.13ab# | 0.84 ± 0.09b |
| lpl | 1.00 ± 0.19a | 2.49 ± 0.20b | 1.81 ± 0.17c | 1.33 ± 0.10a | 1.93 ± 0.24b | 2.10 ± 0.15b |
| ppara | 1.00 ± 0.15a | 1.79 ± 0.21b | 2.07 ± 0.33b | 1.54 ± 0.23a | 2.75 ± 0.60b | 1.31 ± 0.08a |
| pparg | 1.00 ± 0.19a | 0.79 ± 0.09a | 1.53 ± 0.13 b | 1.05 ± 0.17 | 1.39 ± 0.19 | 1.31 ± 0.19 |
| srebp1c | 1.00 ± 0.16 | 0.76 ± 0.14 | 0.80 ± 0.16 | 1.00 ± 0.22 | 1.39 ± 0.13# | 1.15 ± 0.22 |
| ucp2a | 1.00 ± 0.21 | 0.76 ± 0.16 | 1.05 ± 0.13 | 1.09 ± 0.03a | 1.37 ± 0.09b | 0.97 ± 0.11a |
| Transcription factors | ||||||
| bsx | 1.00 ± 0.16a | 0.96 ± 0.12a | 0.53 ± 0.03b | 0.69 ± 0.14 | 0.64 ± 0.14 | 0.71 ± 0.09 |
| creb | 1.00 ± 0.15 | 0.81 ± 0.14 | 0.87 ± 0.11 | 1.49 ± 0.13a# | 1.19 ± 0.10b | 1.13 ± 0.12b |
| foxo1 | 1.00 ± 0.13a | 1.19 ± 0.18ab | 1.39 ± 0.05b | 1.62 ± 0.21a# | 2.23 ± 0.19b# | 2.10 ± 0.19b# |
Data represent mean ± s.e.m. of n = 6 fish per treatment. Gene expression results are referred to control group 2 h after treatment previously normalized by β-actin expression. Different letters indicate significant differences (P < 0.05) from different treatment at the same time.
#Significantly different (P < 0.05) from 2 h at the same treatment.
Figure 1 displays the food intake represented as percentage change versus basal levels in each group. Central administration of CCK-8 resulted in a significant decrease of food intake post-treatment after 2 h (55.2%), 6 h (72.3%) and 24 h (49.8%). A larger decrease was observed in fish treated with GLP-1 after 2 h (6.9%), 6 h (3.1%) and 24 h (17.8%).
Levels of plasma metabolites are shown in Fig. 2. Levels of fatty acid (Fig. 2A), triglyceride (Fig. 2B), total lipid (Fig. 2C), glucose (Fig. 2D) and lactate (Fig. 2E) were not affected by treatments.
Levels of metabolites in the hypothalamus and hindbrain are shown in Fig. 3. Levels of fatty acid (Fig. 3A) and triglyceride (Fig. 3B) in the hypothalamus increased after treatment with CCK-8 (6 h) and GLP-1 (2 and 6 h) compared with control group. Total lipid levels in the hypothalamus (Fig. 3C) decreased in fish treated with CCK-8 or GLP-1 (2 h). In the hindbrain, no significant changes occurred in fatty acid (Fig. 3D) and total lipid (Fig. 3F) levels whereas triglyceride levels (Fig. 3E) were higher in fish treated with GLP-1 (2 h) compared with control group.
Enzyme activities are shown in Fig. 4. In the hypothalamus CPT-1 activity (Fig. 4A) decreased after treatment with CCK-8 (2 h) compared with control group. FAS activity in the hypothalamus (Fig. 4B) decreased in both CCK-8 and GLP-1 groups (6 h). ACLY activity in the hypothalamus (Fig. 4C) decreased after GLP-1 treatment (6 h) compared with control group. In the hindbrain, CPT-1 activity (Fig. 4D) decreased after treatment with CCK-8 or GLP-1 (2 and 6 h) compared with control group. FAS activity in the hindbrain decreased after CCK-8 (6 h) or GLP-1 (2 and 6 h) treatments (Fig. 4E). ACLY activity in the hindbrain (Fig. 4F) decreased 6 h after CCK-8 or GLP-1 treatments.
The mRNA abundance of neuropeptides involved in the metabolic regulation of food intake is shown in Fig. 5. npy mRNA abundance decreased after 6 h treatment with CCK-8 in the hypothalamus (Fig. 5A) and after GLP-1 treatment in the hindbrain (Fig. 5E). pomca1 mRNA abundance increased after CCK-8 or GLP-1 treatments (2 h) in the hypothalamus (Fig. 5C) and increased after treatment with CCK-8 (6 h) or GLP-1 (2 and 6 h) in the hindbrain (Fig. 5G) compared with control group. cart mRNA abundance in the hindbrain (Fig. 5H) increased 6 h after CCK-8 treatment compared with control group. No significant differences were observed in agrp1 mRNA abundance (Fig. 5B and F).
The mRNA abundance of parameters related to fatty acid sensing and transcription factors are shown in Table 3 for hypothalamus, and in Table 4 for hindbrain. The value of ACLY decreased in the hypothalamus 6 h after treatment with CCK-8. The value of carnitine palmitoyl transferase type 1c (cpt1c) decreased 2 h after treatment with GLP-1 compared with control group in the hypothalamus, while no changes occurred in the hindbrain. fasn decreased in the hypothalamus and hindbrain after CCK-8 (6 h) treatment and in the hypothalamus after GLP-1 (2 and 6 h) treatment compared with control group. Fatty acid translocase (cd36) increased after CCK-8 (6 h) or GLP-1 (2 and 6 h) treatments compared with control groups in the hindbrain, while no changes occurred in the hypothalamus. Inward rectifier K+ channel pore type 6.x-like (kir6.x-like) decreased in the hypothalamus after treatment with GLP-1 (6 h), whereas in the hindbrain mRNA abundance of kir6.x-like decreased after treatment with CCK-8 (2 h) or GLP-1 (2 and 6 h). lpl in the hypothalamus increased after treatment with CCK-8 (6 h) or GLP-1 (2 h), whereas in the hindbrain both treatments increased mRNA abundance of lpl after 2 and 6 h. Treatment with CCK-8 (2 and 6 h) or GLP-1 (2 h) resulted in a significant increase in values of peroxisome proliferator-activated receptor type α (ppara) compared with control group in the hindbrain, while no changes occurred in the hypothalamus. Peroxisome proliferator-activated receptor type γ (pparg) decreased after treatment with GLP-1 in the hypothalamus (2 and 6 h) or hindbrain (2 h). Sterol regulatory element-binding protein type 1c (srebp1c) increased after treatment with CCK-8 (2 h) in the hypothalamus, while no changes occurred in the hindbrain. The value of mitochondrial uncoupling protein 2a (ucp2a) decreased 6 h after CCK-8 (hypothalamus and hindbrain) or GLP-1 treatments (hindbrain) compared with control group. The treatment with CCK-8 resulted in a significant decrease in mRNA abundance of bsx (hypothalamus) and creb (hypothalamus and hindbrain) after 6 h, and in a significant increase in mRNA abundance of foxo1 after 2 (hypothalamus) and 6 h (hindbrain). The treatment with GLP-1 resulted in a significant decrease in mRNA abundance of bsx after 2 (hindbrain) and 6 h (hypothalamus) and creb after 6 h (hindbrain), and in a significant increase in mRNA abundance of foxo1 after 2 (hypothalamus and hindbrain) and 6 h (hindbrain).
The phosphorylation status of Ampkα in the hypothalamus (Fig. 6A) decreased after CCK-8 (6 h) or GLP-1 (2 h) treatment compared with control group. In the hindbrain, the phosphorylation status of Ampkα (Fig. 6C) decreased after CCK-8 (2 and 6 h) or GLP-1 (2 h) treatments compared with control group. The phosphorylation status of Mtor in the hindbrain (Fig. 6D) increased after CCK-8 or GLP-1 treatment (2 and 6 h), whereas no significant changes occurred in the hypothalamus.
Levels and phosphorylation status of transcription factors are shown in Fig. 7. In the hypothalamus, Bsx protein levels (Fig. 7A) decreased after GLP-1 treatment (2 h), whereas no significant changes occurred in the hindbrain (Fig. 7D). The phosphorylation status of Creb in the hypothalamus (Fig. 7B) decreased after CCK-8 or GLP-1 treatments (2 h) whereas in the hindbrain (Fig. 7E) decreased after CCK-8 (2 and 6 h) or GLP-1 treatments (6 h). The phosphorylation status of Foxo1 (Fig. 7C) increased in the hypothalamus after CCK-8 or GLP-1 treatments (6 h) and no significant changes occurred in the hindbrain (Fig. 7F).
Discussion
The absence of changes in plasma metabolite levels indicates that no major metabolic changes occurred in the periphery after central treatment with CCK-8 and GLP-1. Therefore, in the present study changes observed in parameters assessed in brain areas are due to CCK-8 and GLP-1 direct action, and are not the result of changes induced by altered levels of plasma metabolites.
The few interactions observed from the two-way ANOVA allow us to consider that most effects of treatments were comparable between the two sampling times assessed.
CCK-8 and GLP-1 ICV treatments inhibit food intake in rainbow trout
The central administration of CCK-8 elicited a clear anorectic effect in rainbow trout, which was evident up to 24 h post-treatment in agreement with available evidence in other fish species such as goldfish (Himick & Peter 1994, Kang et al. 2010) and channel catfish (Silverstein & Plisetskaya 2000). In the same way, GLP-1 central treatment resulted in an even more clear inhibition of food intake in agreement with evidence obtained in channel catfish (Silverstein et al. 2001) and coho salmon (White et al. 2016). The effect of GLP-1 was impressive and strongly repetitive as supported by the reduced SEM displayed. The anorectic response after CCK-8 or GLP-1 treatments is also in agreement with that observed in mammals, in which increased levels of both peptides (or agonists) are associated with decreased food intake (Strader & Woods 2005, Burmeister et al. 2017). The mechanisms underlying the anorectic effects of CCK-8 and GLP-1 peptides are still unknown. The anorectic action of these peptides has been suggested to relate to the ileal brake mechanism (the slowing of gastric emptying causes the sensation of satiety) in mammals (Mojsov 2000, Strader & Woods 2005) and fish (Tinoco et al. 2015), but might also be attributed to a modulatory action as a central satiety signal (Strader & Woods 2005, Nogueiras et al. 2010).
In the present study, the anorectic effects of CCK-8 and GLP-1 are consistent with changes observed in the mRNA abundance of some of the anorexigenic and orexigenic peptides involved in the metabolic regulation of food intake in mammals (Blouet & Schwartz 2010) and fish (Soengas 2014, Soengas et al. 2018). Thus, the increase in mRNA abundance of the anorexigens cart and pomc and the decrease in mRNA abundance of the orexigen npy after CCK-8 and GLP-1 treatments agree with prior evidence obtained in rainbow trout hypothalamus and hindbrain (Polakof et al. 2011a ,b ) occurring in parallel with the activation of glucosensing systems. Nevertheless, the effect of GLP-1 is different to that known in mammals where GLP-1 induced in the hypothalamus an increase in mRNA abundance of pomc/cart without changing mRNA abundance of npy/agrp (Martínez de Morentin et al. 2011, Lockie 2013).
CCK-8 and GLP-1 activate fatty acid sensing in the hypothalamus and hindbrain of rainbow trout
The treatment with CCK-8 or GLP-1 induced in general a raise in the levels of fatty acid and triglyceride in the hypothalamus and hindbrain. This raise is comparable to that observed in the same areas of the same species after ICV treatment with oleate or octanoate (Librán-Pérez et al. 2014) also resulting in an anorectic response.
The mechanism related to binding of fatty acid to FAT/CD36 and subsequent modulation of transcription factors was apparently activated in the hindbrain by central administration of CCK-8 and GLP-1, as evidenced by increased mRNA abundance of cd36, ppara and srebp1c, although not significant in the latter case. These results are comparable to those observed at central level after treatment with PYY1–36, another gastrointestinal hormone that similarly plays an anorectic role in fish, including rainbow trout (Velasco et al. 2018). The results are also comparable to those observed in the same species after treatment with enhanced levels of oleate or octanoate (Librán-Pérez et al. 2012, 2013, 2014). Further support to these results come from the fact that central administration of ghrelin, a GIT hormone known for its orexigenic effect both in mammals (López et al. 2008) and fish species like goldfish (Tinoco et al. 2014) and rainbow trout (Velasco et al. 2016b ) elicited opposed responses in parameters. Despite few changes occurred at hypothalamic level, the increase observed in mRNA abundance of srebp1c after CCK-8 treatment and the decrease in pparg mRNA levels after GLP-1 treatment evidence that these peptides also affect this fatty acid mechanism at hypothalamic level.
Another mechanism of fatty acid sensing relates fatty acid abundance to decreased lipogenic potential resulting in CPT-1 inhibition (Soengas 2014). In the present study, many parameters displayed in general changes comparable with those observed when this system is activated by oleate or octanoate in the same species (Librán-Pérez et al. 2012, 2013, 2014), as demonstrated by enhanced levels of fatty acid and triglyceride and inhibition of CPT-1 activity after treatment with both hormones at central level. Thus, treatment with CCK-8 decreased FAS (also mRNA) and ACLY activities in both the hypothalamus and hindbrain; and treatment with GLP-1 decreased ACLY (hindbrain) and FAS (hindbrain and hypothalamus) activity, and mRNA abundance of fasn and cpt1c in the hypothalamus. These changes are similar to those observed in the same groups after central treatment with oleate or octanoate (Librán-Pérez et al. 2014). However, mRNA abundance of a pro-lipogenic factor such as lpl increased in the hypothalamus and hindbrain after treatment with both peptides, which is in contrast with the decrease observed after oleate treatment (Velasco et al. 2016a ). Altogether, it seems that fatty acid metabolism is activated by treatment with CCK-8 and GLP-1 in both the hypothalamus and hindbrain of rainbow trout.
The central detection of fatty acid is also related in fish to mitochondrial activity through enhanced production of reactive oxygen species, resulting in an inhibition of K+ ATP (Soengas 2014). CCK-8 treatment elicited changes in the parameters related to this system including decreased expression of kir6.x-like and ucp2a both in the hypothalamus and hindbrain whereas GLP-1 treatment decreased expression of kir6.x-like in the hypothalamus and hindbrain, and ucp2a in the hypothalamus. These results are, in general, in agreement with those observed when this system is activated in the same species by the presence of oleate or octanoate (Librán-Pérez et al. 2012, 2013, 2014), and are also comparable with the response observed after central treatment with the anorectic peptide PYY1–36 (Velasco et al. 2018).
As a whole the treatment with CCK-8 or GLP-1 activated fatty acid-sensing systems in the hypothalamus and hindbrain of rainbow trout in a way comparable to the effects elicited by the treatment with specific fatty acids in the same species. The anorectic effects of these peptides appear to modulate food intake directly but also indirectly through changes in nutrient-sensing systems.
CCK-8 and GLP-1 treatment elicit changes in integrative pathways and transcription factors
The knowledge regarding central integration of metabolic and endocrine information eliciting changes in neuropeptide expression ultimately regulating food intake is scarce in fish (Delgado et al. 2017, Soengas et al. 2018). Available studies in fish (Dai et al. 2014, Otero-Rodiño et al. 2017, Velasco et al. 2017, Conde-Sieira et al. 2018) pointed to a network comparable to that known in mammals (Diéguez et al. 2011, Martínez de Morentin et al. 2011, Gao et al. 2013). In this network, mTOR and AMPK would operate as mediators between the activation of nutrient-sensing systems and the modulation of the expression of neuropeptides via modulation of the transcription factors FoxO1, CREB and BSX. In this study, we observed in the hypothalamus and hindbrain a significant decrease in the phosphorylation status of Ampkα after treatment with CCK-8 or GLP-1 though the results observed were not exactly the same after 2 h or 6 h of treatment. This central AMPK inhibition is consistent with responses observed after activation of fatty acid-sensing systems in fish (Velasco et al. 2017). Also in mammals, the decrease in AMPKα phosphorylation status in the hypothalamus also inhibits CPT-1 activity (Chari et al. 2010) and leads to decreased fatty acid oxidation and to increased lipogenic potential (Martínez de Morentin et al. 2011), as in the present study. Furthermore, in mammals, the activation of GLP-1 receptors decreased food intake via inhibition of AMPK and activation of mTOR (Burmeister et al. 2017). Mtor signalling at central level plays a main role in modulating energy homeostasis by responding to nutrient availability and hormonal signals in mammals (Blouet & Schwartz 2010). In this study, Mtor phosphorylation status increased significantly in the hindbrain after treatment with both peptides. The changes observed in the hindbrain are consistent with those observed in mammals after central administration of hormones (i.e. leptin) or metabolites (i.e. leucine, α-lipoic acid), which regulate feeding through modulation of mTOR (Martins et al. 2012), in a way that short-term central administration of anorectic factors activate central mTOR signalling (Cota et al. 2008). Moreover, in rainbow trout liver, the activation of Mtor occurs in parallel with increased mRNA abundance of srebp1c (Seiliez et al. 2011), as in the present study. These results allow us to suggest that in rainbow trout CCK-8 and GLP-1 treatment modulates cellular signalling pathways related to Ampkα in the hypothalamus and hindbrain, as well as Mtor in the hindbrain.
Regarding transcription factors, BSX regulates hypothalamic NPY/AgRP expression in mammals in a way that when BSX mRNA levels increase a parallel increase occur in mRNA abundance of both peptides (Nogueiras et al. 2008, Varela et al. 2011). In the present study, mRNA abundance and protein levels of hypothalamic BSX decreased after treatment with CCK-8 and GLP-1 in parallel with decreased npy mRNA and food intake thus supporting a comparable role to that of mammals. This situation is comparable to that observed in the same species after oleate treatment (Conde-Sieira et al. 2018), which makes sense considering that oleate treatment resulted in decreased food intake in rainbow trout (Conde-Sieira & Soengas 2016, Soengas et al. 2018). Moreover, in mammals activation of CPT-1 occurred in parallel with increased values of BSX mRNA in the hypothalamus (Mera et al. 2014), as in the present study. In mammals, although both AgRP and NPY share BSX as a common transcriptional factor, BSX needs to interact with FoxO1 to increase agrp mRNA abundance, and with CREB to increase npy mRNA abundance (Varela et al. 2011). Accordingly, in rainbow trout the phosphorylation status and mRNA abundance of CREB decreased in the hypothalamus and hindbrain after treatment with CCK-8 and GLP-1. This situation is comparable to that observed in mammals under food deprivation (Ren et al. 2013) and in fish under anorexigenic conditions such as those elicited by oleate ICV treatment (Conde-Sieira et al. 2018). Nevertheless, the phosphorylation status (hypothalamus) and mRNA abundance of FoxO1 (hypothalamus and hindbrain) increased after treatment with CCK-8 and GLP-1. These changes are comparable to those observed in mammals after treatment with other anorectic hormones such as leptin or insulin (Diéguez et al. 2011, Varela et al. 2011), and also comparable to that observed in fish under anorexigenic conditions (Velasco et al. 2017). These changes suggest that, in rainbow trout, an inhibition of CREB and an activation of FoxO1 occurred in parallel with decreased npy and increased pomc and cart mRNA abundance.
In summary, we have demonstrated, for the first time in fish, that the anorectic effects of central treatment with CCK and GLP-1 in rainbow trout are associated with changes in fatty acid metabolism and activation of fatty acid-sensing systems in the hypothalamus and hindbrain. Central activation of fatty acid-sensing systems by these peptides occurred in parallel with the inhibition of AMPKα and the activation of mTOR. These changes would relate to neuropeptide expression through changes in the phosphorylation status of transcription factors under their control such as BSX, CREB and FoxO1 finally resulting in changes in neuropeptide mRNA abundance leading to increased anorexigenic potential and a subsequent decrease in food intake. In general, the effects of both peptides on fatty acid metabolism are comparable to those known in mammals. In the case of GLP-1 this is surprising considering that the effects of this peptide in fish are completely different than those in mammals concerning glucose metabolism (Polakof et al. 2011b , Irwin & Mojsov 2018). It seems that in terms of regulation of food intake, the modulatory effects associated with fatty acid are more preserved throughout phylogeny than those related to glucose. This might relate to the reduced importance of glucose metabolism in many teleost fish species (Polakof et al. 2012) and clearly deserves further research.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This study was supported by a research grant from Spanish Agencia Estatal de Investigación and European Fund of Regional Development (AGL2016-74857-C3-1-R and FEDER) to J L S. S C was recipient of a predoctoral fellowships from Spanish Ministerio de Educación, Cultura y Deporte (FPU grant reference FPU16/00045). M C-S was recipient of a postdoctoral fellowship (Programa Postdoctoral modalidade B) from Xunta de Galicia (ED481B2018/018).
Author contribution statement
C V, J M M and J L S conceived and designed the research; C V, S C and M C-S performed the experiments; C V, S C and M C-S analysed the data; all authors interpreted results of the experiments; C V and J L S prepared figures; all authors drafted, edited and revised manuscript; J L S approved the final version of manuscript.
References
Alvarez MJ, Diez A, Lopez Bote C, Gallego M & Bautista JM 2000 Short-term modulation of lipogenesis by macronutrients in rainbow trout (Oncorhynchus mykiss) hepatocytes. British Journal of Nutrition 84 619–628. (https://doi.org/S0007114500001951)
Andersen A, Lund A, Knop FK & Vilsbøll T 2018 Glucagon-like peptide 1 in health and disease. Nature Reviews Endocrinology 14 390–403. (https://doi.org/10.1038/s41574-018-0016-2)
Belgardt BF, Okamura T & Brüning JC 2009 Hormone and glucose signalling in POMC and AgRP neurons. Journal of Physiology 587 5305–5314. (https://doi.org/10.1113/jphysiol.2009.179192)
Blanco AM, Velasco C, Bertucci JI, Soengas JL & Unniappan S 2018 Nesfatin-1 regulates feeding, nutrient sensing and lipid metabolism in rainbow trout. Frontiers in Endocrinology 9 484. (https://doi.org/10.3389/fendo.2018.00484)
Blouet C & Schwartz GJ 2010 Hypothalamic nutrient sensing in the control of energy homeostasis. Behavioural Brain Research 209 1–12. (https://doi.org/10.1016/j.bbr.2009.12.024)
Bruce KD, Zsombok A & Eckel RH 2017 Lipid processing in the brain: a key regulator of systemic metabolism. Frontiers in Endocrinology 8 60. (https://doi.org/10.3389/fendo.2017.00060)
Burmeister MA, Brown JD, Ayala JE, Stoffers DA, Sandoval DA, Seeley RJ & Ayala JE 2017 The glucagon-like peptide-1 receptor in the ventromedial hypothalamus reduces short-term fod intake in male mice by regulating nutrient sensor activity. American Journal of Physiology: Endocrinology and Metabolism 313 E651–E662. (https://doi.org/10.1152/ajpendo.00113.2017)
Chandra R & Liddle RA 2007 Cholecystokinin. Current Opinion in Endocrinology, Diabetes and Obesity 14 63–67. (https://doi.org/10.1097/MED.0b013e3280122850)
Chari M, Lam CKL & Lam TKT 2010 Hypothalamic fatty acid sensing in the normal and disease states. In Fat Detection: Taste, Texture, and Post Ingestive Effects, pp 507–532. Eds Montmayeur J-P & Le Coutre J. Boca Raton: CRC Press.
Cheung GWC, Kokorovic A, Lam CKL, Chari M & Lam TKT 2009 Intestinal cholecystokinin controls glucose production through a neuronal network. Cell Metabolism 10 99–109. (https://doi.org/10.1016/j.cmet.2009.07.005)
Conde-Sieira M & Soengas JL 2016 Nutrient sensing systems in fish: impact on food intake regulation and energy homeostasis. Frontiers in Neuroscience 10 603. (https://doi.org/10.3389/fnins.2016.00603)
Conde-Sieira M, Agulleiro MJ, Aguilar AJ, Miguez JM, Cerda-Reverter JM & Soengas JL 2010 Effect of different glycaemic conditions on gene expression of neuropeptides involved in control of food intake in rainbow trout; interaction with stress. Journal of Experimental Biology 213 3858–3865. (https://doi.org/10.1242/jeb.048439)
Conde-Sieira M, Ceinos RM, Velasco C, Comesaña S, López-Patiño MA, Míguez JM & Soengas JL 2018 Response of rainbow trout’s (Oncorhynchus mykiss) hypothalamus to glucose and oleate assessed through transcription factors BSX, ChREBP, CREB, and FoxO1. Journal of Comparative Physiology A 204 893–904. (https://doi.org/10.1007/s00359-018-1288-7)
Cota D, Matter EK, Woods SC & Seeley RJ 2008 The role of hypothalamic mammalian target of rapamycin complex 1 signaling in diet-induced obesity. Journal of Neuroscience 28 7202–7208. (https://doi.org/10.1523/JNEUROSCI.1389-08.2008)
Dai W, Panserat S, Terrier F, Seiliez I & Skiba-Cassy S 2014 Acute rapamycin treatment improved glucose tolerance through inhibition of hepatic gluconeogenesis in rainbow trout (Oncorhynchus mykiss). American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 307 R1231–R1238. (https://doi.org/10.1152/ajpregu.00166.2014)
De Pedro N, Pinillos ML, Valenciano AI, Alonso-Bedate M & Delgado MJ 1998 Inhibitory effect of serotonin on feeding behavior in goldfish: involvement of CRF. Peptides 19 505–511. (https://doi.org/10.1016/S0196-9781(97)00469-5)
Delgado MJ, Cerdá-Reverter JM & Soengas JL 2017 Hypothalamic integration of metabolic, endocrine, and circadian signals in fish: involvement in the control of food intake. Frontiers in Neuroscience 11 354. (https://doi.org/10.3389/fnins.2017.00354)
Diéguez C, Vázquez MJ, Romero A, López M & Nogueiras R 2011 Hypothalamic control of lipid metabolism: focus on leptin, ghrelin and melanocortins. Neuroendocrinology 94 1–11. (https://doi.org/10.1159/000328122)
Ditlecadet D & Driedzic WR 2013 Glycerol-3-phosphatase and not lipid recycling is the primary pathway in the accumulation of high concentrations of glycerol in rainbow smelt (Osmerus mordax). American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 304 R304–R312. (https://doi.org/10.1152/ajpregu.00468.2012)
Drucker DJ 2002 Biological actions and therapeutic potential of the glucagon-like peptides. Gastroenterology 122 531–544. (https://doi.org/10.1053/gast.2002.31068)
Ducasse-Cabanot S, Zambonino-Infante J, Richard N, Medale F, Corraze G, Mambrini M, Robin J, Cahu C, Kaushik S & Panserat S 2007 Reduced lipid intake leads to changes in digestive enzymes in the intestine but has minor effects on key enzymes of hepatic intermediary metabolism in rainbow trout (Oncorhynchus mykiss). Animal 1 1272–1282. (https://doi.org/10.1017/S1751731107000596)
Efeyan A, Comb WC & Sabatini DM 2015 Nutrient-sensing mechanisms and pathways. Nature 517 302–310. (https://doi.org/10.1038/nature14190)
Figueiredo-Silva AC, Saravanan S, Schrama JW, Kaushik S & Geurden I 2012 Macronutrient-induced differences in food intake relate with hepatic oxidative metabolism and hypothalamic regulatory neuropeptides in rainbow trout (Oncorhynchus mykiss). Physiology and Behavior 106 499–505. (https://doi.org/10.1016/j.physbeh.2012.03.027)
Gao S, Moran TH, Lopaschuk GD & Butler AA 2013 Hypothalamic malonyl-CoA and the control of food intake. Physiology and Behavior 122 17–24. (https://doi.org/10.1016/j.physbeh.2013.07.014)
Gélineau A & Boujard T 2001 Oral administration of cholecystokinin receptor antagonists increase feed intake in rainbow trout. Journal of Fish Biology 58 716–724. (https://doi.org/10.1111/j.1095-8649.2001.tb00524.x)
Himick BA & Peter RE 1994 CCK/gastrin-like immunoreactivity in brain and gut, and CCK suppression of feeding in goldfish. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 267 R841–R851. (https://doi.org/10.1152/ajpregu.1994.267.3.R841)
Holmgren S & Olsson C 2009 The neuronal and endocrine regulation of gut function. In Fish Neuroendocrinology, pp 468–499. Eds Farrell AP & Brauner CJ. Amsterdam: Academic Press.
Irwin DM & Mojsov S 2018 Diversification of the functions of proglucagon and glucagon receptor genes in fish. General and Comparative Endocrinology 261 148–165 (https://doi.org/10.1016/j.ygcen.2018.03.003)
Irwin DM & Wong J 1995 Trout and chicken proglucagon: alternative splicing generates mRNA transcripts encoding glucagon-like peptide 2. Molecular Endocrinology 9 267–277. (https://doi.org/10.1210/mend.9.3.7776976)
Jensen H, Rourke IJ, Møller M, Jønson L & Johnsen AH 2001 Identification and distribution of CCK-related peptides and mRNAs in the rainbow trout Oncorhynchus mykiss. Biochimica et Biophysica Acta 1517 190–201. (https://doi.org/10.1016/S0167-4781(00)00263-3)
Jönsson E, Forsman A, Einarsdottir IE, Egnér B, Ruohonen K & Björnsson BT 2006 Circulating levels of cholecystokinin and gastrin-releasing peptide in rainbow trout fed different diets. General and Comparative Endocrinology 148 187–194. (https://doi.org/10.1016/j.ygcen.2006.02.016)
Kamalam BS, Medale F, Kaushik S, Polakof S, Skiba-Cassy S & Panserat S 2012 Regulation of metabolism by dietary carbohydrates in two lines of rainbow trout divergently selected for muscle fat content. Journal of Experimental Biology 215 2567–2578. (https://doi.org/10.1242/jeb.070581)
Kang KS, Yahashi S, Azuma M & Matsuda K 2010 The anorexigenic effect of cholecystokinin octapeptide in a goldfish model is mediated by the vagal afferent and subsequently through the melanocortin- and corticotropin-releasing hormone-signaling pathways. Peptides 31 2130–2134. (https://doi.org/10.1016/j.peptides.2010.07.019)
Kolditz C, Borthaire M, Richard N, Corraze G, Panserat S, Vachot C, Lefèvre F & Médale F 2008 Liver and muscle metabolic changes induced by dietary energy content and genetic selection in rainbow trout (Oncorhynchus mykiss). American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 294 R1154–R1164. (https://doi.org/10.1152/ajpregu.00766.2007)
Konturek SJ, Zabielski R, Konturek JW & Czarnecki J 2003 Neuroendocrinology of the pancreas; role of brain-gut axis in pancreatic secretion. European Journal of Pharmacology 481 1–14. (https://doi.org/10.1016/j.ejphar.2003.08.042)
Kwon O, Kim KW & Kim MS 2016 Leptin signalling pathways in hypothalamic neurons. Cellular and Molecular Life Sciences 73 1457–1477. (https://doi.org/10.1007/s00018-016-2133-1)
Leder EH & Silverstein JT 2006 The pro-opiomelanocortin genes in rainbow trout (Oncorhynchus mykiss): duplications, splice variants, and differential expression. Journal of Endocrinology 188 355–363. (https://doi.org/10.1677/joe.1.06283)
Librán-Pérez M, Polakof S, López-Patiño MA, Míguez JM & Soengas JL 2012 Evidence of a metabolic fatty acid-sensing system in the hypothalamus and Brockmann bodies of rainbow trout: implications in food intake regulation. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 302 R1340–R1350. (https://doi.org/10.1152/ajpregu.00070.2012)
Librán-Pérez M, López-Patiño MA, Míguez JM & Soengas JL 2013 Oleic acid and octanoic acid sensing capacity in rainbow trout Oncorhynchus mykiss is direct in hypothalamus and Brockmann bodies. PLoS ONE 8 e59507. (https://doi.org/10.1371/journal.pone.0059507)
Librán-Pérez M, Otero-Rodiño C, López-Patiño MA, Míguez JM & Soengas JL 2014 Central administration of oleate or octanoate activates hypothalamic fatty acid sensing and inhibits food intake in rainbow trout. Physiology and Behavior 129 272–279. (https://doi.org/10.1016/j.physbeh.2014.02.061)
Librán-Pérez M, Velasco C, Otero-Rodiño C, López-Patiño MA, Míguez JM & Soengas JL 2015 Effects of insulin treatment on the response to oleate and octanoate of food intake and fatty acid-sensing systems in rainbow trout. Domestic Animal Endocrinology 53 124–135. (https://doi.org/10.1016/j.domaniend.2015.06.004)
Lockie SH 2013 Glucagon-like peptide-1 in the brain: role in neuroendocrine control of energy metabolism and treatment target for obesity. Journal of Neuroendocrinology 25 597–604. (https://doi.org/10.1111/jne.12039)
López M, Lage R, Saha AK, Pérez-Tilve D, Vázquez MJ, Varela L, Sangiao-Alvarellos S, Tovar S, Raghay K, Rodríguez-Cuenca S, et al. 2008 Hypothalamic fatty acid metabolism mediates the orexigenic action of ghrelin. Cell Metabolism 7 389–399. (https://doi.org/10.1016/j.cmet.2008.03.006)
MacDonald LE, Alderman SL, Kramer S, Woo PTK & Bernier NJ 2014 Hypoxemia-induced leptin secretion: a mechanism for the control of food intake in diseased fish. Journal of Endocrinology 221 441–455. (https://doi.org/10.1530/JOE-13-0615)
Magnan C, Levin BE & Luquet S 2015 Brain lipid sensing and the neural control of energy balance. Molecular and Cellular Endocrinology 418 3–8. (https://doi.org/10.1016/j.mce.2015.09.019)
Martínez de Morentin PB, González CR, Saha AK, Martins L, Diéguez C, Vidal-Puig A, Tena-Sempere M & López M 2011 Hypothalamic AMP-activated protein kinase as a mediator of whole body energy balance. Reviews in Endocrinology and Metabolic Disorders 12 127–140. (https://doi.org/10.1007/s11154-011-9165-5)
Martins L, Fernández-Mallo D, Novelle MG, Vázquez MJ, Tena-Sempere M, Nogueiras R, López M & Diéguez C 2012 Hypothalamic mTOR signaling mediates the orexigenic action of ghrelin. PLoS ONE 7 e46923. (https://doi.org/10.1371/journal.pone.0046923)
Mera P, Mir JF, Fabriàs G, Casas J, Costa ASH, Malandrino MI, Fernández-López JA, Remesar X, Gao S, Chohnan S, et al. 2014 Long-term increased carnitine palmitoyltransferase 1A expression in ventromedial hypotalamus causes hyperphagia and alters the hypothalamic lipidomic profile. PLoS ONE 9 e97195. (https://doi.org/10.1371/journal.pone.0097195)
Mojsov S 2000 Glucagon-like peptide-1 (GLP-1) and the control of glucose metabolism in mammals and teleost fish. American Zoologists 40 246–258. (https://doi.org/10.1093/icb/40.2.246)
Mommsen TP, Andrews PC & Plisetskaya EM 1987 Glucagon-like peptides activate hepatic gluconeogenesis. FEBS Letters 219 227–232. (https://doi.org/10.1016/0014-5793(87)81222-X)
Moran TH & Kinzig KP 2004 Gastrointestinal satiety signals II. Cholecystokinin. American Journal of Physiology: Gastrointestinal and Liver Physiology 286 G183–G188. (https://doi.org/10.1152/ajpgi.00434.2003)
Morton GJ, Meek TH & Schwartz MW 2014 Neurobiology of food intake in health and disease. Nature Reviews Neuroscience 15 367–378. (https://doi.org/10.1038/nrn3745)
Nogueiras R, López M, Lage R, Pérez-Tilve D, Pfluger P, Mendieta-Zerón H, Sakkou M, Wiedmer P, Benoit SC, Datta R, et al. 2008 Bsx, a novel hypothalamic factor linking feeding with locomotor activity, is regulated by energy availability. Endocrinology 149 3009–3015. (https://doi.org/10.1210/en.2007-1684)
Nogueiras R, López M & Diéguez C 2010 Regulation of lipid metabolism by energy availability: a role for the central nervous system. Obesity Reviews 11 185–201. (https://doi.org/10.1111/j.1467-789X.2009.00669.x)
Otero-Rodiño C, Velasco C, Álvarez-Otero R, López-Patiño MA, Míguez JM & Soengas JL 2017 Changes in the levels and phosphorylation status of Akt, AMPK, CREB and FoxO1 in hypothalamus of rainbow trout under conditions of enhanced glucosensing activity. Journal of Experimental Biology 220 4410–4417. (https://doi.org/10.1242/jeb.165159)
Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 e45. (https://doi.org/10.1093/nar/29.9.e45)
Polakof S & Soengas JL 2008 Involvement of lactate in glucose metabolism and glucosensing function in selected tissues of rainbow trout. Journal of Experimental Biology 211 1075–1086. (https://doi.org/10.1242/jeb.014050)
Polakof S, Míguez JM & Soengas JL 2008a Dietary carbohydrates induce changes in glucosensing capacity and food intake of rainbow trout. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 295 R478–R489. (https://doi.org/10.1152/ajpregu.00176.2008)
Polakof S, Panserat S, Plagnes-Juan E & Soengas JL 2008b Altered dietary carbohydrates significantly affect gene expression of the major glucosensing components in Brockmann bodies and hypothalamus of rainbow trout. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 295 R1077–R1088. (https://doi.org/10.1152/ajpregu.90476.2008)
Polakof S, Médale F, Skiba-Cassy S, Corraze G & Panserat S 2010 Molecular regulation of lipid metabolism in liver and muscle of rainbow trout subjected to acute and chronic insulin treatments. Domestic Animal Endocrinology 39 26–33. (https://doi.org/10.1016/j.domaniend.2010.01.003)
Polakof S, Míguez JM & Soengas JL 2011a Cholecystokinin impact on rainbow trout glucose homeostasis: possible involvement of central glucosensors. Regulatory Peptides 172 23–29. (https://doi.org/10.1016/j.regpep.2011.08.002)
Polakof S, Míguez JM & Soengas JL 2011b Evidence for a gut-brain axis used by glucagon-like peptide-1 to elicit hyperglycaemia in fish. Journal of Neuroendocrinology 23 508–518. (https://doi.org/10.1111/j.1365-2826.2011.02137.x)
Polakof S, Médale F, Larroquet L, Vachot C, Corraze G & Panserat S 2011c Insulin stimulates lipogenesis and attenuates beta-oxidation in white adipose tissue of fed rainbow trout. Lipids 46 189–199. (https://doi.org/10.1007/s11745-010-3521-1)
Polakof S, Panserat S, Soengas JL & Moon TW 2012 Glucose metabolism in fish: a review. Journal of Comparative Physiology: B, Biochemical, Systemic, and Environmental Physiology 182 1015–1045. (https://doi.org/10.1007/s00360-012-0658-7)
Ren X, Lutfy K, Mangubat M, Ferrini MG, Lee ML, Liu Y & Friedman TC 2013 Alterations in phosphorylated CREB expression in different brain regions following short- and long-term morphine exposure: relationship to food intake. Journal of Obesity 2013 1–11. (https://doi.org/10.1155/2013/764742)
Sanchez-Gurmaches J, Cruz-Garcia L, Gutierrez J & Navarro I 2012 Adiponectin effects and gene expression in rainbow trout: an in vivo and in vitro approach. Journal of Experimental Biology 215 1373–1383. (https://doi.org/10.1242/jeb.061697)
Seiliez I, Panserat S, Lansard M, Polakof S, Plagnes-Juan E, Surget A, Dias K, Larquier M, Kaushik S & Skiba-Cassy S 2011 Dietary carbohydrate-to-protein ratio affects TOR signaling and metabolism-related gene expression in the liver and muscle of rainbow trout after a single meal. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 300 R733–R743. (https://doi.org/10.1152/ajpregu.00579.2010)
Silverstein JT & Plisetskaya EM 2000 The effects of NPY and insulin on food intake regulation in fish. American Zoologists 40 296–308. (https://doi.org/10.1093/icb/40.2.296)
Silverstein JT, Bondareva VM, Leonard JBK & Plisetskaya EM 2001 Neuropeptide regulation of feeding in catfish, Ictalurus punctatus: a role for glucagon-like peptide-1 (GLP-1)? Comparative Biochemistry and Physiology: Part B, Biochemistry and Molecular Biology 129 623–631. (https://doi.org/10.1016/S1096-4959(01)00357-8)
Skiba-Cassy S, Lansard M, Panserat S & Medale F 2009 Rainbow trout genetically selected for greater muscle fat content display increased activation of liver TOR signaling and lipogenic gene expression. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 297 R1421–R1429. (https://doi.org/10.1152/ajpregu.00312.2009)
Soengas JL 2014 Contribution of glucose- and fatty acid sensing systems to the regulation of food intake in fish: a review. General and Comparative Endocrinology 205 36–48. (https://doi.org/10.1016/j.ygcen.2014.01.015)
Soengas JL, Cerdá-Reverter JM & Delgado MJ 2018 Central regulation of food intake in fish: an evolutionary perspective. Journal of Molecular Endocrinology 60 R171–R199. (https://doi.org/10.1530/JME-17-0320)
Strader AD & Woods SC 2005 Gastrointestinal hormones and food intake. Gastroenterology 128 175–191. (https://doi.org/10.1053/j.gastro.2004.10.043)
Tinoco AB, Näslund J, Delgado MJ, de Pedro N, Johnsson JI & Jönsson E 2014 Ghrelin increases food intake, swimming activity and growth in juvenile brown trout (Salmo trutta). Physiology and Behavior 124 15–22. (https://doi.org/10.1016/j.physbeh.2013.10.034)
Tinoco AB, Valenciano AI, Gómez-Boronat M, Blanco AM, Nisembaum LG, De Pedro N & Delgado MJ 2015 Two cholecystokinin receptor subtypes are identified in goldfish, being the CCKAR involved in the regulation of intestinal motility. Comparative Biochemistry and Physiology: Part A, Molecular and Integrative Physiology 187 193–201. (https://doi.org/10.1016/j.cbpa.2015.05.027)
Varela L, Vázquez MJ, Cordido F, Nogueiras R, Vidal-Puig A, Diéguez C & López M 2011 Ghrelin and lipid metabolism: key partners in energy balance. Journal of Molecular Endocrinology 46 R43–R63. (https://doi.org/10.1677/JME-10-0068)
Velasco C, Librán-Pérez M, Otero-Rodiño C, López-Patiño MA, Míguez JM, Cerdá-Reverter JM & Soengas JL 2016a Ghrelin modulates hypothalamic fatty acid-sensing and control of food intake in rainbow trout. Journal of Endocrinology 228 25–37. (https://doi.org/10.1530/JOE-15-0391)
Velasco C, Librán-Pérez M, Otero-Rodiño C, López-Patiño MA, Míguez JM & Soengas JL 2016b Intracerebroventricular ghrelin treatment affects lipid metabolism in liver of rainbow trout (Oncorhynchus mykiss). General and Comparative Endocrinology 228 33–39. (https://doi.org/10.1016/j.ygcen.2016.01.016)
Velasco C, Otero-Rodiño C, Comesaña S, Míguez JM & Soengas JL 2017 Hypothalamic mechanisms linking fatty acid sensing and food intake regulation in rainbow trout. Journal of Molecular Endocrinology 59 377–390. (https://doi.org/10.1530/JME-17-0148)
Velasco C, Blanco AM, Unniappan S & Soengas JL 2018 The anorectic effect of central PYY1–36 treatment in rainbow trout (Oncorhynchus mykiss) is associated with changes in mRNAs encoding neuropeptides and parameters related to fatty acid sensing and metabolism. General and Comparative Endocrinology 267 137–145. (doi:10.1016/j.ygcen.2018.06.015)
White SL, Volkoff H & Devlin RH 2016 Regulation of feeding behavior and food intake by appetite-regulating peptides in wild-type and growth hormone-transgenic coho salmon. Hormones and Behavior 84 18–28. (https://doi.org/10.1016/j.yhbeh.2016.04.005)
Yeung CM, Mojsov S, Mok PY & Chow BK 2002 Isolation and structure-function studies of a glucagon-like peptide 1 receptor from goldfish Carassius auratus: identification of three charged residues in extracellular domains critical for receptor function. Endocrinology 143 4646–4654. (https://doi.org/10.1210/en.2002-220694)
