Hypothalamic mechanisms linking fatty acid sensing and food intake regulation in rainbow trout

in Journal of Molecular Endocrinology
View More View Less
  • 1 Laboratorio de Fisioloxía Animal, Departamento de Bioloxía Funcional e Ciencias da Saúde, Facultade de Bioloxía and Centro Singular de Investigación Mariña-ECIMAT, Universidade de Vigo, Vigo, Spain

We assessed in rainbow trout hypothalamus the effects of oleate and octanoate on levels and phosphorylation status of two transcription factors, FoxO1 and CREB, possibly involved in linking activation of fatty acid sensing with modulation of food intake through the expression of brain neuropeptides. Moreover, we assessed changes in the phosphorylation status of three proteins possibly involved in modulation of these transcription factors such as Akt, AMPK and mTOR. In a first experiment, we evaluated, in pools of hypothalamus incubated for 3 h and 6 h at 15°C in a modified Hanks’ medium containing 100 or 500 µM oleate or octanoate, the response of fatty acid sensing, neuropeptide expression and phosphorylation status of proteins of interest. The activation of fatty acid sensing and enhanced anorectic potential occurred in parallel with the activation of Akt and mTOR, and the inhibition of AMPK. The changes in these proteins would relate to a neuropeptide expression through changes in the phosphorylation status of transcription factors under their control, such as CREB and FoxO1, which displayed inhibitory (CREB) or activatory (FoxO1) responses when tissues were incubated with oleate or octanoate. In a second experiment, we incubated hypothalamus for 6 h with 500 µM oleate or octanoate alone or in the presence of specific inhibitors of Akt, AMPK, mTOR, CREB or FoxO1. The presence of inhibitors counteracted the effects of oleate or octanoate on the phosphorylation status of the proteins of interest. The results support, for the first time in fish, the involvement of these proteins in the regulation of food intake by fatty acids.

Abstract

We assessed in rainbow trout hypothalamus the effects of oleate and octanoate on levels and phosphorylation status of two transcription factors, FoxO1 and CREB, possibly involved in linking activation of fatty acid sensing with modulation of food intake through the expression of brain neuropeptides. Moreover, we assessed changes in the phosphorylation status of three proteins possibly involved in modulation of these transcription factors such as Akt, AMPK and mTOR. In a first experiment, we evaluated, in pools of hypothalamus incubated for 3 h and 6 h at 15°C in a modified Hanks’ medium containing 100 or 500 µM oleate or octanoate, the response of fatty acid sensing, neuropeptide expression and phosphorylation status of proteins of interest. The activation of fatty acid sensing and enhanced anorectic potential occurred in parallel with the activation of Akt and mTOR, and the inhibition of AMPK. The changes in these proteins would relate to a neuropeptide expression through changes in the phosphorylation status of transcription factors under their control, such as CREB and FoxO1, which displayed inhibitory (CREB) or activatory (FoxO1) responses when tissues were incubated with oleate or octanoate. In a second experiment, we incubated hypothalamus for 6 h with 500 µM oleate or octanoate alone or in the presence of specific inhibitors of Akt, AMPK, mTOR, CREB or FoxO1. The presence of inhibitors counteracted the effects of oleate or octanoate on the phosphorylation status of the proteins of interest. The results support, for the first time in fish, the involvement of these proteins in the regulation of food intake by fatty acids.

Introduction

The detection of changes in nutrient levels in vertebrate brain is an essential process involved in the regulation of food intake and energy expenditure as demonstrated in mammals (Blouet & Schwartz 2010, Morton et al. 2014) and fish (Delgado et al. 2017). Accordingly, several mechanisms are present in brain areas, especially hypothalamus, detecting changes in the levels of glucose, fatty acids and amino acids as demonstrated in mammals (Efeyan et al. 2015, Bruce et al. 2017) and fish (Soengas 2014, Conde-Sieira & Soengas 2017). In previous studies in fish, we demonstrated that in rainbow trout (Librán-Pérez et al. 2012, 2013, 2014, 2015, Velasco et al. 2016a) and Senegalese sole (Conde-Sieira et al. 2015), the hypothalamus detects changes in the levels of specific long-chain fatty acids (LCFA) through fatty acid sensing mechanisms based on carnitine palmitoyl transferase-1 (CPT-1), fatty acid translocase (FAT/CD36), increased capacity of mitochondria to produce ROS inhibiting K+ ATP and lipoprotein lipase (LPL) activity. There is evidence for these mechanisms in other fish species like grass carp (Li et al. 2016). These mechanisms are, in general, comparable to those described in mammals (Blouet & Schwartz 2010, Lipina et al. 2014, Morton et al. 2014, Magnan et al. 2015) with the notable exception of the ability of fish systems for detecting not only changes in the levels of LCFA but also medium-chain fatty acid like octanoate (rainbow trout) and polyunsaturated fatty acid like α-linolenate (Senegalese sole). The activation of these systems results in an increase in the anorexigenic potential (balance between mRNA abundance of anorexigenic and orexigenic neuropeptides) through increased production of the anorexigenic peptides’ pro-opio melanocortin (POMC) and cocaine- and amphetamine-related transcript (CART), and decreased production of the orexigenic peptides’ neuropeptide Y (NPY) and agouti-related peptide (AgRP) ultimately leading to decreased food intake (Librán-Pérez et al. 2012, 2014, Velasco et al. 2016a). Evidence of changes in the neuropeptide expression after treating fish with fatty acids or feeding fish with lipid-enriched diets has been also observed in other species (Tang et al. 2013, Li et al. 2016).

The mechanisms linking the function of fatty acid sensing systems with changes in the expression of neuropeptides, which ultimately regulate food intake, are mostly unknown even in mammals. Changes in the expression of neuropeptides might relate to modulation of forkhead box01 (FoxO1), cAMP response element binding protein (CREB) and/or brain homeobox transcription factor (BSX) (Diéguez et al. 2011). However, it is not clear how these transcription factors relate to the activity of the different nutrient sensing systems. Several possibilities have been suggested in mammals (Diéguez et al. 2011, Gao et al. 2013, Morton et al. 2014) including modulation by AMP-activated protein kinase (AMPK), mechanistic target of rapamycin (mTOR) and protein kinase B (Akt). There are very few studies addressing the effects in mammalian hypothalamus of raised levels of LCFA in the amount and/or phosphorylation status of these proteins (Mayer & Belsham 2010). The available studies in fish hypothalamus demonstrated a decrease in phosphorylation status of AMPK, and an increase in those of Akt, and mTOR in hypothalamus of rainbow trout fed a lipid-enriched diet (Librán-Pérez et al. 2015) or increased Akt protein levels in isolated rainbow trout hypothalamic cells incubated with leptin (Gong et al. 2016).

Therefore, we aimed to assess in rainbow trout hypothalamus the effects of raised levels of oleate or octanoate on the phosphorylation status of two of the transcription factors, CREB and FoxO1, possibly involved in linking the activation of fatty acid sensing systems with the modulation of food intake through the expression of brain neuropeptides. Moreover, we also assessed the changes in the phosphorylation status of three proteins, Akt, AMPK and mTOR possibly involved in the modulation of these transcription factors. Since we observed changes in these proteins, we assessed in a second experiment the specificity of the responses using appropriate inhibitors.

Materials and methods

Fish

Rainbow trout were obtained from a local fish farm (Javier de la Calle, A Estrada, Spain). Fish were maintained for 1 month in 100 L tanks under laboratory conditions and 12L:12D photoperiod (lights on at 08:00 h, lights off at 20:00 h) in dechlorinated tap water at 15°C. Fish weight was 98 ± 2 g. Fish were fed once daily (10:00 h) to satiety with commercial dry fish pellets (Dibaq-Diproteg SA, Segovia, Spain; proximate food analysis was 48% crude protein, 14% carbohydrates, 25% crude fat and 11.5% ash; 20.2 MJ/kg of feed). The experiments described comply with the Guidelines of the European Union Council (2010/63/UE), and of the Spanish Government (RD 55/2013) for the use of animals in research, and were approved by the Ethics Committee of the Universidade de Vigo.

Experimental design

Experiment 1: in vitro incubation with increased concentrations of oleate or octanoate

Freshly obtained tissues were incubated as previously described (Polakof et al. 2007). Fish were fasted for 24 h before treatment to ensure that basal hormone levels were achieved. Every morning of an experiment, fish were dipnetted from the tank, anaesthesized with 2-phenoxyethanol (Sigma; 0.2% v/v), killed by decapitation and weighed. The hypothalamus (approx. 20 mg) was removed as described by Doyon et al. (2003), rinsed with a modified Hanks’ medium (136.9 mM NaCl; 5.4 mM KCl, 5 mM NaHCO3, 1.5 mM CaCl2, 0.81 mM MgSO4, 0.44 mM KH2PO4, 0.33 mM Na2HPO4, 2 mM glucose, 10 mM HEPES, 50 U/mL penicillin and 50 µg/mL streptomycin sulphate, pH 7.4; referred to a basal medium), sliced (approximately 300 µm) on chilled Petri dishes and placed in a chilled Petri dish containing 100 mL of modified Hanks’ medium/g tissue that was gassed with 0.5% CO2/99.5% O2. To ensure adequate mass, tissues were combined from different fish resulting in pools of 3–4 hypothalami. Tissues were incubated in 48-well culture plates at 15°C for 3–6 h containing per well 25 mg of tissue and 250 µL of modified Hanks’ medium alone (control) or containing (final concentration) 100 or 500 µM oleate or octanoate directly dissolved into the medium. The wells were gassed with a 0.5% CO2/99.5% O2 mixture. After 3 or 6 h of incubation, tissues were quickly removed, rinsed, frozen in liquid nitrogen and stored at −80°C until assayed. Fatty acid concentrations were selected based on previous in vitro studies in rainbow trout (Sánchez-Gurmaches et al. 2010, Librán-Pérez et al. 2013). In each experiment, one set of 4 tissue pools was assessed for the assay of mRNA levels, and another set of 4 tissue pools was assessed for the assay by Western blot of changes in the levels of proteins. The number of independent experiments (one set of 4 tissue pools each) carried out was 6 (N = 6).

Experiment 2: in vitro incubation with oleate or octanoate alone or in the presence of inhibitors of proteins of interest

Tissues were incubated for 6 h as described in experiment 1 in the modified Hanks’ medium alone (C, control), or containing 500 µM oleate (OL), or containing 500 µM octanoate (OC), or containing 500 µM oleate and selected inhibitors of proteins of interest, or containing 500 µM octanoate and selected inhibitors of proteins of interest. The inhibitors used are 1 mM perifosine (Akt inhibitor; 1 4-[[hydroxy(octadecyloxy)phosphinyl]oxy]-1,1-dimethyl-piperidinium inner salt), 10 µM compound C (AMPK inhibitor; 6-[4-(2-piperidin-1-ylethoxy)phenyl]-3-pyridin-4-ylpyrazolo[1,5-a]pyrimidine), 100 nM rapamycin (mTOR inhibitor; 23,27-epoxy-3H-pyrido[2,1-c][1,4]oxaazacyclohentriacontine), 5 µM CBP–CREB interaction inhibitor (CREB inhibitor; N-(4-chlorophenyl)-3-hydroxy-2-naphthamide) and AS1842856 (FoxO1 inhibitor; 5-amino-7-(cyclohexylamino)-1-ethyl-6-fluoro-4-oxo-1,4-dihydroquinoline-3-carboxylic acid). Inhibitors were purchased from Sigma (perifosine, compound C and rapamycin) and Calbiochem (CBP–CREB interaction inhibitor and AS1842856). The inhibitors were previously dissolved in DMSO; no effects were observed due to the vehicle alone (data not shown). The concentrations of inhibitors was selected based on previous studies in rainbow trout for rapamycin (Lansard et al. 2010) and compound C (Magnoni et al. 2012), and in mammals for perifosine (Li et al. 2010), CBP–CREB interaction inhibitor (Corsini et al. 2014) and AS1842856 (Nagashima et al. 2010). Compound C besides inhibiting AMPK has some unspecific actions (Bain et al. 2007, López et al. 2008). Therefore, its inhibitory effects have to be taken with caution. After 6 h incubation, tissues were quickly removed, rinsed, frozen and stored at −80°C until assayed. In each experiment, one set of 4 tissue pools was assessed for the assay by Western blot of changes in the levels of proteins. The number of independent experiments (one set of 4 tissue pools each) carried out was 6 (N = 6).

mRNA abundance analysis by RT-qPCR

Total RNA was extracted using Trizol reagent (Life Technologies) and subsequently treated with RQ1-DNAse (Promega). Two micrograms of total RNA were reverse-transcribed using Superscript II reverse transcriptase (Promega) and random hexamers (Promega) to obtain approx. 20 µL. Gene expression levels were determined by RT-qPCR using the iCycler iQ (BIO-RAD). Analyses were performed on 1 µL cDNA using MAXIMA SYBR Green qPCR Mastermix (Life Technologies), in a total PCR reaction volume of 15 µL, containing 50–500 nM of each primer. mRNA abundance of transcripts was determined as previously described in the same species by Craig & Moon (2013) (AMPKα1), Sánchez-Gurmaches et al. (2012) (FAT/CD36, PPARγ), Kolditz et al. (2008) (FAS, LPL, PPARα), Polakof et al. (2008) (Kir6.x-like; 2011a, CPT1c), Rolland et al. (2015) (mTOR), Figueiredo-Silva et al. (2012) (UCP2a), Leder & Silverstein (2006) (POMCa1), Conde-Sieira et al. (2010) (CART, NPY) and MacDonald et al. (2014) (AgRP). Sequences of the forward and reverse primers used for each gene expression are shown in Table 1. Relative quantification of the target gene transcript was done using β-actin gene expression as reference, which was stably expressed in this experiment. Thermal cycling was initiated with incubation at 95°C for 90 s using hot-start iTaq DNA polymerase activation followed by 35 cycles, each one consisting of heating at 95°C for 20 s, and specific annealing and extension temperatures for 20 s. Following the final PCR cycle, melting curves were systematically monitored (55°C temperature gradient at 0.5°C/s from 55 to 94°C) to ensure that only one fragment was amplified. Samples without reverse transcriptase and samples without RNA were run for each reaction as negative controls. Relative quantification of the target gene transcript with the β-actin reference gene transcript was made following the Pfaffl method (Pfaffl 2001).

Table 1

Nucleotide sequences of the PCR primers used to evaluate mRNA abundance by RT-qPCR.

Forward primerReverse primerAnnealing temperature (°C)Data baseAccession number
β-actinGATGGGCCAGAAAGACAGCTATCGTCCCAGTTGGTGACGAT59GenBankNM_ 001124235.1
AgRPACCAGCAGTCCTGTCTGGGTAAAGTAGCAGATGGAGCCGAACA60GenBankCR376289
AMPKα1ATCTTCTTCACGCCCCAGTAGGGAGCTCATCTTTGAACCA60GenBankHQ40367
CARTACCATGGAGAGCTCCAGGCGCACTGCTCTCCAA60GenBankNM_001124627
CPT1cCGCTTCAAGAATGGGGTGATCAACCACCTGCTGTTTCTCA59GenBankAJ619768
FASGAGACCTAGTGGAGGCTGTCTCTTGTTGATGGTGAGCTGT59Sigenaetcab0001c.e.06 5.1.s.om.8
FAT/CD36CAAGTCAGCGACAAACCAGAACTTCTGAGCCTCCACAGGA62DFCIAY606034.1
Kir6.x-likeTTGGCTCCTCTTCGCCATGTAAAGCCGATGGTCACCTGGA60SigenaeCA346261.1.s.om.8:1:773:1
LPLTAATTGGCTGCAGAAAACACCGTCAGCAAACTCAAAGGT59GenBankAJ224693
mTORATGGTTCGATCACTGGTCATCATCCACTCTTGCCACAGAGAC60GenBankEU179853
NPYCTCGTCTGGACCTTTATATGCGTTCATCATATCTGGACTGTG58GenBankNM_001124266
POMCa1CTCGCTGTCAAGACCTCAACTCTGAGTTGGGTTGGAGATGGACCTC60TigrTC86162
PPARαCTGGAGCTGGATGACAGTGAGGCAAGTTTTTGCAGCAGAT55GenBankAY494835
PPARγGACGGCGGGTCAGTACTTTAATGCTCTTGGCGAACTCTGT60DFCICA345564
SIRT-1GCTACTTGGGGACTGTGACGCTCAAAGTCTCCGCCCAAC60GenBankEZ774344.1
SREBP1cGACAAGGTGGTCCAGTTGCTCACACGTTAGTCCGCATCAC60GenBankCA048941.1
UCP2aTCCGGCTACAGATCCAGGCTCTCCACAGACCACGCA57GenBankDQ295324

AgRP, agouti-related peptide; AMPKα1, AMP-activated protein kinase subunit α1; CART, cocaine- and amphetamine-related transcript; CPT1c, carnitine palmitoyl transferase type 1c; FAS, fatty acid synthase; FAT/CD36, fatty acid translocase; Kir6.x-like, inward rectifier K+ channel pore type 6.x-like; LPL, Lipoprotein lipase; mTOR, mechanistic target of rapamycin; NPY, neuropeptide Y; POMCa1, pro-opio melanocortin a1; PPARα, peroxisome proliferator-activated receptor type α; PPARγ, peroxisome proliferator-activated receptor type γ; SIRT1, sirtuin 1; SREBP1c, sterol regulatory element-binding protein type 1c; UCP2a, mitochondrial uncoupling protein 2a.

Western blot analysis

Frozen samples (20 mg) were homogenized in 1 mL of buffer containing 150 mM NaCl, 10 mM Tris–HCl, 1 mM EGTA, 1 mM EDTA (pH 7.4), 100 mM sodium fluoride, 4 mM sodium pyrophosphate, 2 mM sodium orthovanadate, 1% Triton X-100, 0.5% NP40-IGEPAL and 1.02 mg/mL protease inhibitor cocktail (Sigma). Tubes were kept on ice during the whole process to prevent protein denaturation. Homogenates were centrifuged at 1000 g for 15 min at 4°C, and supernatants were again centrifuged at 20,000 g for 30 min. The resulting supernatants were recovered and stored at −80°C. The concentration of protein in each sample was determined using Bradford assay with bovine serum albumin as standard. Hypothalamus protein lysates (20 μg) were Western blotted using appropriate antibodies from Cell Signaling Technology: anti-phospho Akt (Ser473), anti-carboxyl terminal Akt, anti-phospho AMPKα (Thr172), anti-AMPKα, anti-phospho CREB (Ser133), anti-CREB (48h2), anti-phospho-FoxO1 (Thr24), anti-FoxO1 (L27), anti-phospho-mTOR (Ser2448) and anti-β-tubulin. All these antibodies cross-react successfully with rainbow trout proteins of interest (Skiba-Cassy et al. 2009, Kamalam et al. 2012, Velasco et al. 2016b). After washing, membranes were incubated with an IgG-HRP secondary antibody (BIO-RAD) and spots were quantified by Image Lab software version 5.2.1 (BIO-RAD).

Statistics

In the first experiment, comparisons among groups were carried out using two-way ANOVA with fatty acid concentration (100 and 500 µM) and time (3 and 6 h) as main factors. In the second experiment, comparisons among groups were carried out using one-way ANOVA. The normal distribution of variables and homoscedasticity were analysed by Kolmogorov–Smirnov and Levene tests, respectively. In those cases where a significant effect was observed for a factor, comparisons were carried out by a Student Newman–Keuls test. Differences were considered statistically significant at P < 0.05. Comparisons were carried out with the SigmaStat statistical package.

Results

Experiment 1

The mRNA abundance of parameters related to metabolic control of food intake after oleate treatment is shown in Table 2. Changes described represent the comparison of treated groups vs controls; the remaining comparisons are shown in the table. The values of CPT1c decreased 3 and 6 h after treatment with oleate at both concentrations assessed. The values of FAS decreased 3 h after treatment with 500 µM oleate and after 6 h with both concentrations. Values of FAT/C36 decreased 3 h after treatment with 100 and 500 µM oleate, and after 6 h with 500 µM. The values of Kir6.x-like decreased after treatment with oleate with both concentrations after 3 h, and after 6 h with 100 µM oleate. Values of LPL decreased 3 h after treatment with both concentrations of oleate and 6 h after treatment with 100 µM oleate. The values of PPARα increased after 3 h of treatment with 500 µM oleate. The values of PPARγ decreased after treatment for 3 h with 500 µM oleate or after 6 h for 100 µM oleate. Values of SREBP1c increased after oleate at both times assessed with the increase after 3 h being dose-dependent. The values of UCP2a decreased for oleate treatments after 3 and 6 h. The values of AMPKα1 increased 6 h after 100 µM oleate treatment. The values of mTOR increased for oleate for both concentrations after 3 h and for 500 µM after 6 h. Values of SIRT-1 increased 3 h after 100 µM oleate and for both concentrations after 6 h. Values of AgRP decreased after 3 h treatment with 500 µM oleate. CART values increased 3 or 6 h after treatment with 500 µM oleate. The values of NPY displayed in the oleate-treated group a dose-dependent decrease after 3 h and a decrease after 6 h for the 500 µM dose. POMCa1 values increased after 3 or 6 h treatment with both concentrations of oleate.

Table 2

Changes in mRNA abundance of selected transcripts in hypothalamus of rainbow trout incubated in vitro for 3 or 6 h at 15°C in the modified Hanks’ medium alone (control) or containing 100 or 500 µM oleate.

3 h incubation6 h incubation
Control100 µM oleate500 µM oleateControl100 µM oleate500 µM oleate
Fatty acid sensing
 CPT1c1.00 ± 0.08a0.63 ± 0.12b0.65 ± 0.05b1.01 ± 0.12a0.68 ± 0.06b0.52 ± 0.10b
 FAS1.00 ± 0.07a0.75 ± 0.12a,b0.70 ± 0.09b0.95 ± 0.11a0.56 ± 0.09b0.53 ± 0.07b
 FAT/CD361.00 ± 0.07a0.76 ± 0.02b0.79 ± 0.08b0.93 ± 0.12a0.74 ± 0.02a0.60 ± 0.10b
 Kir6.x-like1.00 ± 0.12a0.55 ± 0.07b0.66 ± 0.09b1.00 ± 0.11a0.68 ± 0.09b0.88 ± 0.07a,b,#
 LPL1.00 ± 0.19a0.35 ± 0.08b0.21 ± 0.04b0.79 ± 0.15a0.40 ± 0.04b0.51 ± 0.07a,b,#
 PPARα1.00 ± 0.08a1.32 ± 0.18a,b1.41 ± 0.06b1.08 ± 0.061.27 ± 0.111.18 ± 0.05
 PPARγ1.00 ± 0.04a0.83 ± 0.11a,b0.57 ± 0.10b1.09 ± 0.11a0.47 ± 0.08b0.80 ± 0.01a,b,#
 SREBP1c1.00 ± 0.06a1.46 ± 0.19b2.14 ± 0.14c1.17 ± 0.07a1.69 ± 0.01b1.89 ± 0.17b
 UCP2a1.00 ± 0.09a0.46 ± 0.10b0.50 ± 0.10b1.16 ± 0.05a0.46 ± 0.15b0.42 ± 0.15b
Sensors
 AMPKα11.00 ± 0.101.37 ± 0.101.00 ± 0.111.34 ± 0.17a1.88 ± 0.16b,#1.75 ± 0.18a,b,#
 mTOR1.00 ± 0.10a1.53 ± 0.13b1.62 ± 0.06b1.13 ± 0.14a1.06 ± 0.06a,#1.41 ± 0.04b,#
 SIRT-11.00 ± 0.08a1.35 ± 0.06b1.03 ± 0.09a1.26 ± 0.15a2.01 ± 0.13b,#2.43 ± 0.19b,#
Neuropeptides
 AgRP1.00 ± 0.04a0.81 ± 0.16a,b0.58 ± 0.06b0.89 ± 0.120.81 ± 0.150.90 ± 0.13
 CART1.00 ± 0.18a1.34 ± 0.11a1.57 ± 0.16b1.02 ± 0.04a1.40 ± 0.13a,b1.68 ± 0.15b
 NPY1.00 ± 0.11a0.57 ± 0.06b0.31 ± 0.09c0.93 ± 0.14a0.75 ± 0.13a,b0.34 ± 0.11b
 POMCa11.00 ± 0.03a1.58 ± 0.09b1.60 ± 0.21b1.23 ± 0.11a2.30 ± 0.18b2.16 ± 0.08b

Data represent mean ± s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Data are referred to the control group incubated for 3 h (results were previously normalized by β-actin mRNA levels, which did not show changes among groups). Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same treatment (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

The mRNA abundance of parameters related to metabolic control of food intake after octanoate treatment is shown in Table 3. Changes described represent the comparison of treated groups vs controls; the remaining comparisons are shown in the table. The values of CPT1c decreased 3 h after treatment with octanoate at both concentrations assessed, whereas after 6 h, a decrease occurred with 500 µM octanoate. The values of FAS decreased after treatment with octanoate for both concentrations after 3 h and 100 µM after 6 h. Values of FAT/C36 decreased 6 h after treatment with 500 µM octanoate. The values of Kir6.x-like decreased after treatment with both concentrations of octanoate after 3 h and after 6 h for 500 µM octanoate. Values of LPL decreased 3 and 6 h after treatment with both concentrations of octanoate The values of PPARα displayed a dose-dependent increase after 3 h of treatment with octanoate. The values of PPARγ decreased after 3 h treatment with 100 µM octanoate, and after 6 h treatment at both concentrations. Values of SREBP1c increased 3 h after octanoate treatment with both concentrations, and 6 h after 500 µM octanoate treatment. The values of UCP2a decreased for both octanoate treatment after 3 and 6 h. The values of AMPKα1 increased after octanoate treatment for 3 h (500 µM) and 6 h (both concentrations). The values of mTOR increased in treated groups at all concentrations and times. Values of SIRT-1 increased after 3 h and 6 h of 500 µM octanoate treatment. Values of AgRP decreased after 3 h treatment with 100 µM octanoate. CART values increased after 3 or 6 h treatment with all concentrations of octanoate. The values of NPY displayed a decrease after 3 or 6 h of treatment with octanoate with the decrease after 3 h being dose-dependent. POMCa1 values increased 3 or 6 h after treatment with both concentrations of octanoate with the increase after 3 h being dose-dependent.

Table 3

Changes in mRNA abundance of selected transcripts in hypothalamus of rainbow trout incubated in vitro for 3 or 6 h at 15°C in the modified Hanks’ medium alone (control) or containing 100 or 500 µM octanoate.

3 h incubation6 h incubation
Control100 µM octanoate500 µM octanoateControl100 µM octanoate500 µM octanoate
Fatty acid sensing
 CPT1c1.00 ± 0.08a0.54 ± 0.10b0.68 ± 0.06b1.01 ± 0.12a0.72 ± 0.13a,b0.66 ± 0.04b
 FAS1.00 ± 0.07a0.65 ± 0.17b0.76 ± 0.11b0.95 ± 0.11a0.56 ± 0.06b0.64 ± 0.13a,b
 FAT/CD361.00 ± 0.070.69 ± 0.140.88 ± 0.100.93 ± 0.12a0.72 ± 0.07a0.58 ± 0.03b,#
 Kir6.x-like1.00 ± 0.12a0.47 ± 0.08b0.78 ± 0.09b1.00 ± 0.11a0.80 ± 0.10a,b,#0.77 ± 0.04b
 LPL1.00 ± 0.19a0.32 ± 0.06b0.24 ± 0.06b0.79 ± 0.15a0.44 ± 0.09b,#0.49 ± 0.05b,#
 PPARα1.00 ± 0.08a1.27 ± 0.06b2.24 ± 0.22c1.08 ± 0.061.19 ± 0.111.13 ± 0.10#
 PPARγ1.00 ± 0.04a0.59 ± 0.14b1.02 ± 0.08a1.09 ± 0.11a0.63 ± 0.11b0.69 ± 0.07b,#
 SREBP1c1.00 ± 0.06a2.06 ± 0.10c1.74 ± 0.14b1.17 ± 0.07a1.53 ± 0.15a2.21 ± 0.17b,#
 UCP2a1.00 ± 0.09a0.56 ± 0.05b0.71 ± 0.06b1.16 ± 0.05a0.28 ± 0.02b,#0.27 ± 0.04b,#
Sensors
 AMPKα11.00 ± 0.10a1.35 ± 0.14a,b1.41 ± 0.14b1.34 ± 0.17a2.22 ± 0.21b,#2.44 ± 0.21b,#
 Mtor1.00 ± 0.10a1.43 ± 0.17b1.81 ± 0.22b1.13 ± 0.14a1.62 ± 0.20b1.99 ± 0.20b
 SIRT-11.00 ± 0.08a1.01 ± 0.13a1.48 ± 0.15b1.26 ± 0.15a1.41 ± 0.12a2.20 ± 0.07b,#
Neuropeptides
 AgRP1.00 ± 0.04a0.64 ± 0.13b0.89 ± 0.07a,b0.89 ± 0.120.95 ± 0.05#0.92 ± 0.04
 CART1.00 ± 0.18a1.67 ± 0.13b1.76 ± 0.12b1.02 ± 0.04a1.84 ± 0.19b1.96 ± 0.07b
 NPY1.00 ± 0.11a0.72 ± 0.09b0.27 ± 0.01c0.93 ± 0.14a0.55 ± 0.10b0.71 ± 0.01b,#
 POMCa11.00 ± 0.03a1.51 ± 0.15b2.42 ± 0.26c1.23 ± 0.11a2.81 ± 0.26b,#2.44 ± 0.18b

Data represent mean ± s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Data are referred to the control group incubated for 3 h (results were previously normalized by β-actin mRNA levels, which did not show changes among groups). Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same treatment (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

The phosphorylation status of Akt is shown in Fig. 1. The treatment with 500 µM oleate resulted in increased values after 6 h in comparison with the control group. 500 µM octanoate treatment increased values after 3 h and 6 h compared with control group.

Figure 1
Figure 1

Western blot analysis of Akt phosphorylation status in hypothalamus of rainbow trout incubated in vitro for 3 or 6 h at 15°C in modified Hanks’ medium alone (control, C) or containing 100 or 500 µM oleate (OL) or octanoate (OC). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to total amount of the target protein. Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

Citation: Journal of Molecular Endocrinology 59, 4; 10.1530/JME-17-0148

The phosphorylation status of AMPKα is shown in Fig. 2. Values decreased after 6 h of 100 µM or 500 µM oleate treatment in comparison with the control group. The treatment with octanoate decreased values after 3 h (500 µM) and 6 h (both 100 and 500 µM) compared with controls.

Figure 2
Figure 2

Western blot analysis of AMPKα phosphorylation status in hypothalamus of rainbow trout incubated in vitro for 3 or 6 h at 15°C in the modified Hanks’ medium alone (control, C) or containing 100 or 500 µM oleate (OL) or octanoate (OC). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to total amount of the target protein. Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

Citation: Journal of Molecular Endocrinology 59, 4; 10.1530/JME-17-0148

The phosphorylation status of mTOR is shown in Fig. 3. The treatment with oleate increased values after 3 h (100 µM) or 6 h (500 µM) compared with controls. The treatment with 500 µM octanoate raised values after 6 h of incubation.

Figure 3
Figure 3

Western blot analysis of mTOR phosphorylation status in hypothalamus of rainbow trout incubated in vitro for 3 or 6 h at 15°C in the modified Hanks’ medium alone (control, C) or containing 100 or 500 µM oleate (OL) or octanoate (OC). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to β-tubulin. Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

Citation: Journal of Molecular Endocrinology 59, 4; 10.1530/JME-17-0148

The phosphorylation status of CREB is shown in Fig. 4. The treatment with 100 µM oleate decreased values after 3 h in comparison with the control group. The treatment with octanoate (both 100 and 500 µM) decreased values after 6 h compared with controls.

Figure 4
Figure 4

Western blot analysis of CREB phosphorylation status in hypothalamus of rainbow trout incubated in vitro for 3 or 6 h at 15°C in the modified Hanks’ medium alone (control, C) or containing 100 or 500 µM oleate (OL) or octanoate (OC). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to total amount of the target protein. Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

Citation: Journal of Molecular Endocrinology 59, 4; 10.1530/JME-17-0148

The phosphorylation status of FoxO1 is shown in Fig. 5. The treatment with 500 µM oleate raised values compared with controls after 6 h of incubation. The treatment with 500 µM octanoate increased values in comparison with the control group both after 3 and 6 h.

Figure 5
Figure 5

Western blot analysis of FoxO1 phosphorylation status in hypothalamus of rainbow trout incubated in vitro for 3 or 6 h at 15°C in the modified Hanks’ medium alone (control, C) or containing 100 or 500 µM oleate (OL) or octanoate (OC). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to total amount of the target protein. Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

Citation: Journal of Molecular Endocrinology 59, 4; 10.1530/JME-17-0148

Experiment 2

The response of phosphorylation status of proteins of interest to 6 h treatment with 500 µM oleate alone or in combination with specific inhibitors is shown in Fig. 6. The increase in Akt values elicited by the presence of oleate was counteracted in the presence of perifosine (Fig. 6A). AMPKα values that decreased in the presence of oleate did not show significant differences when compared with the control group in the oleate-compound C treated group (Fig. 6B). The increased values of mTOR observed in the group treated with oleate disappeared in the group treated with oleate and rapamycin (Fig. 6C). The values of CREB that decreased in the presence of oleate alone did not show differences with the control group after joint treatment of oleate and CBP–CREB interaction inhibitor (Fig. 6D). The values of FoxO1 increased in the presence of oleate and this effect was counteracted in the additional presence of AS1842856 (Fig. 6E).

Figure 6
Figure 6

Western blot analysis of phosphorylation status of Akt (A), AMPKα (B), mTOR (C), CREB (D) and FoxO1 (E) in hypothalamus of rainbow trout incubated in vitro for 6 h at 15°C in the modified Hanks’ medium alone (C, control) or containing 500 µM oleate (OL) or containing 500 µM oleate and selected inhibitors of proteins of interest. These included 1 mM perifosine (OL + P, Akt inhibitor), 10 µM compound C (OL + C, AMPK inhibitor), 100 nM rapamycin (OL + R, mTOR inhibitor), 5 µM CBP–CREB interaction inhibitor (OL + CB, CREB inhibitor) and AS1842856 (OL + A, FoxO1 inhibitor). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to total amount of the target protein (except mTOR for which β-tubulin was used as a reference). Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

Citation: Journal of Molecular Endocrinology 59, 4; 10.1530/JME-17-0148

The response of phosphorylation status of proteins of interest to 6 h treatment with 500 µM octanoate alone or in combination with specific inhibitors is shown in Fig. 7. The increase in Akt values elicited by the presence of octanoate was counteracted in the presence of perifosine (Fig. 7A). No significant changes were observed in AMPKα values (Fig. 7B). The increased values of mTOR observed in the group treated with octanoate disappeared in the group treated with octanoate and rapamycin (Fig. 7C). The values of CREB that decreased in the presence of octanoate alone did not show differences with the control group after joint treatment of octanoate and CBP–CREB interaction inhibitor (Fig. 7D). The values of FoxO1 increased in the presence of octanoate and this effect was counteracted in the additional presence of AS1842856 (Fig. 7E).

Figure 7
Figure 7

Western blot analysis of phosphorylation status of Akt (A), AMPKα (B), mTOR (C), CREB (D) and FoxO1 (E) in hypothalamus of rainbow trout incubated in vitro for 6 h at 15°C in the modified Hanks’ medium alone (C, control) or containing 500 µM octanoate (OC) or containing 500 µM octanoate and selected inhibitors of proteins of interest. These included 1 mM perifosine (OC + P, Akt inhibitor), 10 µM compound C (OC + C, AMPK inhibitor), 100 nM rapamycin (OC + R, mTOR inhibitor), 5 µM CBP–CREB interaction inhibitor (OC + CB, CREB inhibitor) and AS1842856 (OC + A, FoxO1 inhibitor). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to total amount of the target protein (except mTOR for which β-tubulin was used as a reference). Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

Citation: Journal of Molecular Endocrinology 59, 4; 10.1530/JME-17-0148

Discussion

Oleate and octanoate treatments activate fatty acid sensing systems and modulate neuropeptide expression

The exposure to raised levels of oleate or octanoate induced changes in mRNA abundance of several parameters related to fatty acid sensing mechanisms present in rainbow trout hypothalamus (Conde-Sieira & Soengas 2017). These include the increase in mRNA levels of SREBP1c, SIRT-1 and PPARα, as well as the decrease in mRNA levels of FAT/CD36, CPT1c, FAS, Kir6.x-like, LPL, PPARγ and UCP2a. These changes were comparable to those previously observed in hypothalamus of the same species under comparable experimental conditions (Librán-Pérez et al. 2013), thus validating the experimental design. It is important to remember that these results are comparable in general to those described in mammals for oleate (Morton et al. 2014, Magnan et al. 2015) but not for octanoate, whose responses appear to be specific of fish (Conde-Sieira & Soengas 2017, Delgado et al. 2017). As for neuropeptides involved in the control of food intake, a sharp increase occurred in the mRNA abundance of anorexigenic neuropeptides POMCa1 and CART, whereas a decrease occurred in the mRNA abundance of orexigenic neuropeptides AgRP and NPY with the increase of oleate or octanoate levels in the medium. These results agree with prior evidence obtained in rainbow trout hypothalamus exposed to oleate or octanoate (Librán-Pérez et al. 2012, 2013, 2014), again supporting the experimental design. The increased anorexigenic potential is also in agreement with decreased food intake observed in vivo in the same species when subjected to raised levels of oleate or octanoate (Librán-Pérez et al. 2012, 2014). Therefore, we aimed to evaluate if under those conditions of activation of fatty acid sensing systems (eliciting changes in the expression of neuropeptides) changes occurred in the phosphorylation status of several proteins that are putatively involved in linking those processes.

Oleate and octanoate treatments affect the phosphorylation status of the transcription factors CREB and FoxO1

CREB is one of the molecules hypothesized to be connecting changes in brain metabolism with the expression of neuropeptides. Thus, in mammals, decreased CREB levels resulted in decreased mRNA abundance of AgRP and NPY, thus favouring decreased food intake (Belgardt et al. 2009, Blanco de Morentín et al. 2011). Accordingly, in the present study, the phosphorylation status of CREB clearly decreased with the increase of oleate or octanoate in the medium. The specificity of the response is further supported by the findings of experiment 2 in which the response of CREB to the presence of fatty acids disappeared in the presence of CBP–CREB interaction inhibitor. This is the first time in which changes in CREB abundance have been assessed in fish hypothalamus after treatment with fatty acids. In other fish tissues, the presence of CREB had been characterized in liver of goldfish (Yan et al. 2016) while in zebrafish, liver (Craig & Moon 2011) food deprivation (situation opposed to the raised levels of nutrients of the present study) resulted in increased mRNA levels of CREB. Even in mammals, as far as we are aware, there are no comparable studies available regarding the effects of fatty acids on the levels and/or phosphorylation status of this protein. However, the abundance of this protein is known to decrease under conditions in which food intake is inhibited resulting in decreased expression of NPY/AgrP and thus inducing anorexigenic potential, such as after leptin treatment (Blanco de Morentín et al. 2011, Diéguez et al. 2011, Kwon et al. 2016).

Fox01 is another molecule hypothesized to be connecting changes in brain nutrient sensing with the expression of neuropeptides (Gross et al. 2009). Thus, increased Fox01 resulted in increased mRNA abundance of POMC and CART, thus favouring decreased food intake (Belgardt et al. 2009, Blanco de Morentín et al. 2011). In the present study, the treatment with oleate or octanoate increased the phosphorylation status of FoxO1, and this effect disappeared in the presence of the inhibitor AS1842856, thus giving further support to the specificity of the response. The only available studies regarding this protein in fish hypothalamus demonstrated a decrease in its phosphorylation status in rainbow trout treated with the orexigenic hormone ghrelin (Velasco et al. 2017), i.e., an opposed response to the anorexigenic effects of oleate or octanoate observed in the present study. In other tissues like liver, a decrease in the abundance of phosphorylated FoxO1 also occurred under refeeding conditions (Dai et al. 2013). In other fish species such as grass carp, increased FoxO1 occurred in adipocytes during adipogenesis, i.e., a situation also reflecting lipid abundance (Sun et al. 2017). The increased FoxO1 phosphorylation would be in agreement with the increased phosphorylation status observed in mammalian hypothalamus under anorexigenic conditions eliciting an increased expression of POMC and CART, such as after leptin treatment (Diéguez et al. 2011, Kwon et al. 2016).

It is not clear, not even in mammals, how changes in these transcription factors relate to the activity of nutrient sensing systems. Of the different possibilities suggested in mammals (Diéguez et al. 2011, Gao et al. 2013, Morton et al. 2014), we have evaluated the possible roles of Akt, AMPK and mTOR.

The phosphorylation status of the cellular signalling proteins Akt, AMPK and mTOR changed after oleate or octanoate treatments

In a previous study, we demonstrated that feeding rainbow trout with a lipid-enriched diet resulted in increased phosphorylation status of Akt (Librán-Pérez et al. 2015). Now, we demonstrate the effects of raised levels of oleate or octanoate on Akt phosphorylation status in fish hypothalamus, with the ratio displaying an increase in parallel with the increase of fatty acid concentration in the medium. The specificity of the response is supported by the fact that the increase disappeared in the presence of the Akt inhibitor perifosine. The increased phosphorylation status of Akt is comparable to that observed in hypothalamus under treatments resulting in raised POMC mRNA abundance and therefore decreased food intake, such as leptin as demonstrated both in mammals (Kwon et al. 2016) and in rainbow trout hypothalamic neurons (Gong et al. 2016). In this way, it is interesting that ICV treatment in rainbow trout with the orexigenic peptide ghrelin resulted in a decreased phosphorylation ratio of Akt (Velasco et al. 2017), i.e., the converse response to that herein observed under an anorexigenic situation. Furthermore, in other situations in which levels of nutrients increase, such as under refeeding conditions, increased phosphorylation status of Akt also occurred in peripheral tissues of fish as demonstrated in livers of rainbow trout (Lansard et al. 2009, Seiliez et al. 2011) and barramundi (Wade et al. 2014). The activation of Akt induces FoxO1 phosphorylation (Gross et al. 2009). Then, those situations, like the present study, in which Akt is activated could presumably result in increased FoxO1 phosphorylation (Belgardt et al. 2009), which, on the other hand, is known to promote expressions of POMC and CART (Diéguez et al. 2011, Kwon et al. 2016). Then, a possible relationship may exist between Akt and FoxO1 activations ultimately resulting in changes in the neuropeptide expression.

AMPK allows detection of lowered cell energy status with coupling to intrinsic cell mechanisms designed to restore energy balance (López 2017). In rainbow trout fed a lipid-enriched diet a decrease occurred in phosphorylation status of AMPKα (Librán-Pérez et al. 2015). In the present study, while mRNA abundance of AMPKα1 increased in the presence of oleate or octanoate, a clear decrease in the phosphorylation status of AMPKα occurred in the presence of both fatty acids. In mammalian hypothalamus, no comparable experimental approaches have been carried out, though anorectic situations induced by leptin treatment also resulted in decreased levels of phosphorylated AMPK and phosphorylation status (López 2017). These results are also comparable to the effect of refeeding resulting in a decreased ratio in mammalian hypothalamus (Gao et al. 2013). In fish, these results are also comparable to those obtained in liver exposed to situations such as refeeding in rainbow trout (Polakof et al. 2011b), while under food deprivation conditions, an increase in ratio is known to occur as demonstrated in zebrafish (Craig & Moon 2011). As a whole, the changes displayed in hypothalamus fit with the role of AMPK as an energy gauge, thus decreasing values under situations of enhanced energy availability, which usually result in decreased food intake (López 2017).

Hypothalamic mTOR responded with a rise to the presence of oleate or octanoate in the medium, and this was reflected by the changes in mRNA abundance and the phosphorylation status of the protein. These results are comparable to the rise in the mTOR phosphorylation status observed in hypothalamus of the same species after feeding a lipid-enriched diet (Librán-Pérez et al. 2015). The presence of rapamycin in the medium blocked the hypothalamic response to fatty acids, thus giving further support to the response since this molecule is known to inhibit mTOR in peripheral tissues of rainbow trout (Dai et al. 2013, 2014). Little is known on the mechanisms engaged by fatty acids to modulate mTOR (André & Cota 2012), though the phosphorylation status of mTOR is known to increase under anorectic conditions, like those induced by leptin treatment, and to increase under orexigenic conditions, like those induced by ghrelin treatment (Diéguez et al. 2011, André & Cota 2012). In other fish tissues like liver, increased mTOR phosphorylation status occurred after feeding fish with lipid-enriched diets (Librán-Pérez et al. 2015, Zeng et al. 2016) or after refeeding (Lansard et al. 2009, Wade et al. 2014), while a decrease occurred under food deprivation (Craig & Moon 2011).

In summary, we have demonstrated for the first time in fish that the activation of fatty acid sensing systems in hypothalamus by oleate or octanoate, resulting in increased anorectic potential, occurs in parallel with changes in the phosphorylation status of proteins that may be involved in linking both processes. Thus, the activation of fatty acid sensing systems induces changes in cellular metabolism presumably resulting in the activation of Akt and mTOR, and the inhibition of AMPK. The changes in these proteins would relate to a neuropeptide expression through changes in the phosphorylation status of transcription factors under their control such as CREB and FoxO1. Knowing the precise mechanisms involved in these mechanisms, as well as the role of other components not assessed yet such as BSX, still needs evaluation. However, these results provide for the first time in fish evidence for all the steps involved in the hypothalamic regulation of food intake by fatty acids, from the detection of the raised levels of the metabolite to the changes in neuropeptide expression ultimately leading to the regulation of food intake. Main results are comparable to those suggested in mammals for oleate but not for octanoate, suggesting again that in fish, the latter fatty acid is particularly important in the metabolic regulation of food intake.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This study was supported by a research grant from Spanish Agencia Estatal de Investigación (AEI) and European Fund of Regional Development (AGL2016-74857-C3-1-R and FEDER). C V and C O-R were recipients of predoctoral fellowship from Universidade de Vigo and AEI (BES‐2014‐068040), respectively.

References

  • André C & Cota D 2012 Coupling nutrient sensing to metabolic homeostasis: the role of the mammalian target of rapamycin complex 1 pathway. Proceedings of the Nutrition Society 71 502510. (doi:10.1017/S0029665112000754)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Bain J, Plater L, Elliott M, Shapiro N, Hastie CJ, McLauchlan H, Klevernic I, Arthur JS, Alessi DR & Cohen P 2007 The selectivity of protein kinase inhibitors: a further update. Biochemical Journal 408 297315. (doi:10.1042/BJ20070797)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Belgardt BF, Okamura T & Brüning JC 2009 Hormone and glucose signalling in POMC and AgRP neurons. Journal of Physiology 587 53055314. (doi:10.1113/jphysiol.2009.179192)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Blanco de Morentin P, González CR, Saha AK, Martins L, Diéguez C, Vidal-Puig A, Tena-Sempere M & López M 2011 Hypothalamic AMP-activated protein kinase as a mediator of whole body energy balance. Reviews in Endocrinology and Metabolic Disorders 12 127140. (doi:10.1007/s11154-011-9165-5)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Blouet C & Schwartz GJ 2010 Hypothalamic nutrient sensing in the control of energy homeostasis. Behavioral Brain Research 209 112. (doi:10.1016/j.bbr.2009.12.024)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Bruce KD, Zsombok A & Eckel RH 2017 Lipid processing in the brain: a key regulator of systemic metabolism. Frontiers in Endocrinology 8 60. (doi:10.3389/fendo.2017.00060)

    • Search Google Scholar
    • Export Citation
  • Conde-Sieira M & Soengas JL 2017 Nutrient sensing systems in fish: impact on food intake regulation and energy homeostasis. Frontiers in Neuroscience 10 603. (doi:10.3389/fnins.2016.00603)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Conde-Sieira M, Agulleiro MJ, Aguilar AJ, Míguez JM, Cerdá-Reverter JM & Soengas JL 2010. Effect of different glycaemic conditions on gene expression of neuropeptides involved in control of food intake in rainbow trout; interaction with stress. Journal of Experimental Biology 213 38583865. (doi:10.1242/jeb.048439)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Conde-Sieira M, Bonacic K, Velasco C, Valente LMP, Morais S & Soengas JL 2015 Hypothalamic fatty acid sensing in Senegalese sole (Solea senegalensis): response to long-chain saturated, monounsaturated, and polyunsaturated (n-3) fatty acids. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 309 R1521R1531. (doi:10.1152/ajpregu.00386.2015)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Corsini M, Moroni E, Ravelli C, Andrés G, Grillo E, Ali IH, Brazil DP & Presta M 2014 Cyclic adenosine monophosphate-response element-binding protein mediates the proangiogenic or proinflammatory activity of gremlin. Arteriosclerosis, Thrombosis, and Vascular Biology 34 136145. (doi:10.1161/ATVBAHA.113.302517)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Craig PM & Moon TW 2011 Fasted zebrafish mimic genetic and physiological responses in mammals: a model for obesity and diabetes? Zebrafish 8 109117. (doi:10.1089/zeb.2011.0702)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Craig PM & Moon TW 2013 Methionine restriction affects the phenotypic and transcriptional response of rainbow trout (Oncorhynchus mykiss) to carbohydrate-enriched diets. British Journal of Nutrition 109 402412. (doi:10.1017/S0007114512001663)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Dai W, Panserat S, Mennigen JA, Terrier F, Dias K, Seiliez I & Skiba-Cassy S 2013 Post-prandial regulation of hepatic glucokinase and lipogenesis requires the activation of TORC1 signaling in rainbow trout (Oncorhynchus mykiss). Journal of Experimental Biology 216 44834492. (doi:10.1242/jeb.091157)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Dai W, Panserat S, Terrier F, Seiliez I & Skiba-Cassy S 2014 Acute rapamycin treatment improved glucose tolerance through inhibition of hepatic gluconeogenesis in rainbow trout (Oncorhynchus mykiss). American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 307 R1231R1238. (doi:10.1152/ajpregu.00166.2014)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Delgado MJ, Cerdá-Reverter JM & Soengas JL 2017 Hypothalamic integration of metabolic, endocrine, and circadian signals in fish: involvement in the control of food intake. Frontiers in Neuroscience 11 354. (doi:10.3389/fnins.2017.00354)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Diéguez C, Vazquez MJ, Romero A, López M & Nogueiras R 2011 Hypothalamic control of lipid metabolism: focus on leptin, ghrelin and melanocortins. Neuroendocrinology 94 111. (doi:10.1159/000328122)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Doyon C, Gilmour KM, Trudeau VL & Moon TW 2003 Corticotropin releasing factor and neuropeptide Y mRNA levels are elevated in the preoptic area of socially subordinate rainbow trout. General and Comparative Endocrinology 133 260271. (doi:10.1016/S0016-6480(03)00195-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Efeyan A, Comb WC & Sabatini DM 2015 Nutrient sensing mechanisms and pathways. Nature 517 302310. (doi:10.1038/nature14190)

  • Figueiredo-Silva AC, Saravanan S, Schrama JW, Kaushik S & Geurden I 2012 Macronutrient-induced differences in food intake relate with hepatic oxidative metabolism and hypothalamic regulatory neuropeptides in rainbow trout (Oncorhynchus mykiss). Physiology and Behavior 106 499505. (doi:10.1016/j.physbeh.2012.03.027)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Gao S, Moran TH, Lopaschuk GD & Butler AA 2013 Hypothalamic malonyl-CoA and the control of food intake. Physiology and Behavior 122 1724. (doi:10.1016/j.physbeh.2013.07.014)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Gong N, Jönsson E & Björnsson BT 2016 Acute anorexigenic action of leptin in rainbow trout is mediated by the hypothalamic Pi3k pathway. Journal of Molecular Endocrinology 56 227238. (doi:10.1530/JME-15-0279)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gross DN, Wan M & Birnbaum MJ 2009 The role of FOXO in the regulation of metabolism. Current Diabetes Reports 9 208214. (doi:10.1007/s11892-009-0034-5)

  • Kamalam BS, Medale F, Kaushik S, Polakof S, Skiba-Cassy S & Panserat S 2012 Regulation of metabolism by dietary carbohydrate in two lines of rainbow trout divergently selected for muscle fat content. Journal of Experimental Biology 215 25672578. (doi:10.1242/jeb.070581)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kolditz C, Borthaire M, Richard N, Corraze G, Panserat S, Vachot C, Lefevre F & Médale F 2008 Liver and muscle metabolic changes induced by dietary energy content and genetic selection in rainbow trout (Oncorhynchus mykiss). American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 294 R1154R1164. (doi:10.1152/ajpregu.00766.2007)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kwon O, Kim KW & Kim M-S 2016 Leptin signalling pathways in hypothalamic neurons. Cellular and Molecular Life Sciences 73 14571477. (doi:10.1007/s00018-016-2133-1)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lansard M, Panserat S, Seiliez I, Polakof S, Plagnes-Juan E, Geurden I, Médale F, Kaushik S. & Corraze G 2009 Hepatic protein kinase B (Akt)-target of rapamycin (TOR)-signalling pathways and intermediary metabolism in rainbow trout (Oncorhynchus mykiss) are not significantly affected by feeding plant-based diets. British Journal of Nutrition 102 15641573. (doi:10.1017/S000711450999095X)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lansard M, Panserat S, Plagnes-Juan E, Seiliez I & Skiba-Cassy S 2010 Integration of insulin and amino acid signals that regulate hepatic metabolism-related gene expression in rainbow trout: role of TOR. Amino Acids 39 801810. (doi:10.1007/s00726-010-0533-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Leder EH & Silverstein JT 2006 The pro-opiomelanocortin genes in rainbow trout (Oncorhynchus mykiss): duplications, splice variants, and differential expression. Journal of Endocrinology 188 355363. (doi:10.1677/joe.1.06283)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Li Z, Tan F, Liewehr DJ, Steinberg SM & Thiele CJ 2010 In vitro and in vivo inhibition of neuroblastoma tumor cell growth by Akt inhibitor perifosine. Journal of National Cancer Institute 102 758770. (doi:10.1093/jnci/djq125)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Li A, Yuan X, Liang XF, Liu L, Li J, Li B, Fang J, Li J, He S, Xue M, Wang J & Tao YX 2016 Adaptations of lipid metabolism and food intake in response to low and high fat diets in juvenile grass carp (Ctenopharyngodon idellus). Aquaculture 457 4349. (doi:10.1016/j.aquaculture.2016.01.014)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Librán-Pérez M, Polakof S, López-Patiño MA, Míguez JM & Soengas JL 2012 Evidence of a metabolic fatty-acid sensing system in the hypothalamus and Brockmann bodies of rainbow trout: implications in food intake regulation. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 302 R1340R1350. (doi:10.1152/ajpregu.00070.2012)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Librán-Pérez M, López-Patiño MA, Míguez JM & Soengas JL 2013 Oleic acid and octanoic acid sensing capacity in rainbow trout Oncorhynchus mykiss is direct in hypothalamus and Brockmann bodies. PLoS ONE 8 e59507. (doi:10.1371/journal.pone.0059507)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Librán-Pérez M, Otero-Rodiño C, López-Patiño MA, Míguez JM & Soengas JL 2014 Central administration of oleate or octanoate activates hypothalamic fatty acid sensing and inhibits food intake in rainbow trout. Physiology and Behavior 129 272279. (doi:10.1016/j.physbeh.2014.02.061)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Librán-Pérez M, Geurden I, Dias K, Corraze G, Panserat S & Soengas JL 2015 Feeding rainbow trout with a lipid-enriched diet: effects on fatty acid sensing, regulation of food intake and cellular signaling pathways. Journal of Experimental Biology 218 26102619. (doi:10.1242/jeb.123802)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lipina C, Irving AJ & Hundal HS 2014 Mitochondria: a possible nexus for the regulation of energy homeostasis by the endocannabinoid system? American Journal of Physiology: Endocrinology and Metabolism 307 E1E13. (doi:10.1152/ajpendo.00100.2014)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • López M 2017 Hypothalamic AMPK: a golden target against obesity? European Journal of Endocrinology 176 R235R246. (doi:10.1530/EJE-16-0927)

  • López M, Lage R, Saha AK, Pérez-Tilve D, Vázquez MJ, Varela L, Sangiao-Alvarellos S, Tovar S, Raghay K & Rodríguez-Cuenca S 2008 Hypothalamic fatty acid metabolism mediates the orexigenic action of ghrelin. Cell Metabolism 7 389399. (doi:10.1016/j.cmet.2008.03.006)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • MacDonald LE, Alderman SL, Kramer S, Woo PTK & Bernier NJ 2014 Hypoxemia-induced leptin secretion: a mechanism for the control of food intake in diseased fish. Journal of Endocrinology 221 441445. (doi:10.1530/JOE-13-0615)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Magnan C, Levin BE & Luquet S 2015 Brain lipid sensing and the neural control of energy balance. Molecular and Cellular Endocrinology 418 38. (doi:10.1016/j.mce.2015.09.019)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Magnoni LJ, Vraskou Y, Palstra A & Planas JV 2012 AMP-activated protein kinase plays an important evolutionary conserved role in the regulation of glucose metabolism in fish skeletal muscle cells. PLoS ONE 7 e31219. (doi:10.1371/journal.pone.0031219)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mayer CD & Belsham DD 2010 Palmitate attenuates insulin signaling and induces endoplasmic reticulum stress and apoptosis in hypothalamic neurons: rescue of resistance and apoptosis through adenosine 5´monophosphate-activated protein kinase activation. Endocrinology 151 576585. (doi:10.1210/en.2009-1122)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Morton GJ, Meek TH & Schwartz MW 2014 Neurobiology of food intake in health and disease. Nature Reviews Neuroscience 15 367378. (doi:10.1038/nrn3745)

  • Nagashima T, Shigematsu N, Maruki R, Urano Y, Tanaka H, Shimaya A, Shimokawa T & Shibasaki M 2010 Discovery of novel forkhead box O1 inhibitors for treating type 2 diabetes: improvement of fasting glycemia in diabetic db/db mice. Molecular Pharmacology 78 961970. (doi:10.1124/mol.110.065714)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 e45. (doi:10.1093/nar/29.9.e45)

  • Polakof S, Míguez JM & Soengas JL 2007 In vitro evidences for glucosensing capacity and mechanisms in hypothalamus, hindbrain, and Brockmann bodies of rainbow trout. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 293 R1410R1420. (doi:10.1152/ajpregu.00283.2007)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Polakof S, Panserat S, Plagnes-Juan E & Soengas JL 2008 Altered dietary carbohydrates significantly affect gene expression of the major glucosensing components in Brockmannn bodies and hypothalamus of rainbow trout. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 295 R1077R1088. (doi:10.1152/ajpregu.90476.2008)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Polakof S, Médale F, Larroquet L, Vachot C, Corraze G & Panserat S 2011a Insulin stimulates lipogenesis and attenuates beta-oxidation in white adipose tissue of fed rainbow trout. Lipids 46 189199. (doi:10.1007/s11745-010-3521-1)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Polakof S, Panserat S, Craig PM, Martyres DJ, Plagnes-Juan E, Savari S, Aris-Brosou S & Moon TW 2011b The metabolic consequences of hepatic AMP-kinase phosphorylation in rainbow trout. PLoS ONE 6 e20228. (doi:10.1371/journal.pone.0020228)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Rolland M, Dalsgaard J, Holm J, Gómez-Requeni P & Skov PV 2015 Dietary methionine level affects growth performance and hepatic gene expression of GH-IGF system and protein turnover regulators in rainbow trout (Oncorhynchus mykiss) fed plant protein-based diets. Comparative Biochemistry and Physiology B 181 3341. (doi:10.1016/j.cbpb.2014.11.009)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Sánchez-Gurmaches J, Cruz-Garcia L, Gutiérrez J & Navarro I 2010 Endocrine control of oleic acid and glucose metabolism in rainbow trout (Oncorhynchus mykiss) muscle cells in culture. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 299 R562R572. (doi:10.1152/ajpregu.00696.2009)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Sánchez-Gurmaches J, Cruz-Garcia L, Gutiérrez J & Navarro I 2012 Adiponectin effects and gene expression in rainbow trout: an in vivo and in vitro approach. Journal of Experimental Biology 215 13731383. (doi:10.1242/jeb.061697)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Seiliez I, Panserat S, Lansard M, Polakof S, Plagnes-Juan E, Surget A, Dias K, Larquier M, Kaushik S & Skiba-Cassy S 2011 Dietary carbohydrate-to-protein ratio affects TOR signaling and metabolism-related gene expression in the liver and muscle of rainbow trout after a single meal. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 300 R733R743. (doi:10.1152/ajpregu.00579.2010)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Skiba-Cassy S, Lansard M, Panserat S & Médale F 2009. Rainbow trout genetically selected for greater muscle fat content display increased activation of liver TOR signaling and lipogenic gene expression. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 297 R1421R1429. (doi:10.1152/ajpregu.00312.2009)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Soengas JL 2014 Contribution of glucose- and fatty acid sensing systems to the regulation of food intake in fish. A review. General and Comparative Endocrinology 205 3648. (doi:10.1016/j.ygcen.2014.01.015)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Sun J, Xiao P, Chang ZG, Ji H, Du ZY & Chen LQ 2017 Forkhead box 01 in grass carp Ctenopharyngodon idella: molecular characterization, gene structure, tissue distribution and mRNA expression in insulin-inhibited adipocyte lipolysis. Comparative Biochemistry and Physiology A 204 7684. (doi:10.1016/j.cbpa.2016.11.011)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Tang Z, Sun C, Yan A, Wu S, Qin C, Zhang Y & Li W 2013 Genes involved in fatty acid metabolism: molecular characterization and hypothalamic mRNA response to energy status and neuropeptide Y treatment in the orange-spotted grouper Epinephelus coioides. Molecular and Cellular Endocrinology 376 114124. (doi:10.1016/j.mce.2013.06.020)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Velasco C, Librán-Pérez M, Otero-Rodiño C, López-Patiño MA, Míguez JM, Cerdá-Reverter JM & Soengas JL 2016a Ghrelin modulates hypothalamic fatty acid-sensing and control of food intake in rainbow trout. Journal of Endocrinology 228 2537. (doi:10.1530/JOE-15-0391)

    • Search Google Scholar
    • Export Citation
  • Velasco C, Librán-Pérez M, Otero-Rodiño C, López-Patiño MA, Míguez JM & Soengas JL 2016b Ceramides are involved in the regulation of food intake in rainbow trout (Oncorhynchus mykiss). American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 311 R658R668. (doi:10.1152/ajpregu.00201.2016)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Velasco C, Moreiras G, Conde-Sieira M, Leao JM, Míguez JM & Soengas JL 2017 Ceramide counteracts the effects of ghrelin on the metabolic control of food intake in rainbow trout. Journal of Experimental Biology 220 25632576. (doi:10.1242/jeb.159871)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Wade NM, Skiba-Cassy S, Dias K & Glencross BD 2014 Postprandial molecular responses in the liver of the barramundi, Lates calcarifer. Fish Physiology and Biochemistry 40 427443. (doi:10.1007/s10695-013-9854-y)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yan AF, Chen T, Chen S, Tang DS, Liu F, Jiang X, Huang W, Ren CH & Hu C-Q 2016 Signal transduction mechanism for glucagon-induced leptin gene expression in goldfish liver. International Journal of Biological Sciences 12 15441554. (doi:10.7150/ijbs.16612)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zeng YY, Jiang WD, Liu Y, Wu P, Zhao J, Jiang J, Kuang SY, Tang L, Tang WN & Zhang YA 2016 Optimal dietary alpha-linolenic acid/linoleic acid ratio improved digestive and absorptive capacities and target of rapamycin gene expression of juvenile grass carp (Ctenopharyngodon idellus). Aquaculture Nutrition 22 12511266. (doi:10.1111/anu.12337)

    • Crossref
    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 687 130 10
PDF Downloads 230 84 8
  • View in gallery

    Western blot analysis of Akt phosphorylation status in hypothalamus of rainbow trout incubated in vitro for 3 or 6 h at 15°C in modified Hanks’ medium alone (control, C) or containing 100 or 500 µM oleate (OL) or octanoate (OC). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to total amount of the target protein. Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

  • View in gallery

    Western blot analysis of AMPKα phosphorylation status in hypothalamus of rainbow trout incubated in vitro for 3 or 6 h at 15°C in the modified Hanks’ medium alone (control, C) or containing 100 or 500 µM oleate (OL) or octanoate (OC). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to total amount of the target protein. Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

  • View in gallery

    Western blot analysis of mTOR phosphorylation status in hypothalamus of rainbow trout incubated in vitro for 3 or 6 h at 15°C in the modified Hanks’ medium alone (control, C) or containing 100 or 500 µM oleate (OL) or octanoate (OC). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to β-tubulin. Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

  • View in gallery

    Western blot analysis of CREB phosphorylation status in hypothalamus of rainbow trout incubated in vitro for 3 or 6 h at 15°C in the modified Hanks’ medium alone (control, C) or containing 100 or 500 µM oleate (OL) or octanoate (OC). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to total amount of the target protein. Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

  • View in gallery

    Western blot analysis of FoxO1 phosphorylation status in hypothalamus of rainbow trout incubated in vitro for 3 or 6 h at 15°C in the modified Hanks’ medium alone (control, C) or containing 100 or 500 µM oleate (OL) or octanoate (OC). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to total amount of the target protein. Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

  • View in gallery

    Western blot analysis of phosphorylation status of Akt (A), AMPKα (B), mTOR (C), CREB (D) and FoxO1 (E) in hypothalamus of rainbow trout incubated in vitro for 6 h at 15°C in the modified Hanks’ medium alone (C, control) or containing 500 µM oleate (OL) or containing 500 µM oleate and selected inhibitors of proteins of interest. These included 1 mM perifosine (OL + P, Akt inhibitor), 10 µM compound C (OL + C, AMPK inhibitor), 100 nM rapamycin (OL + R, mTOR inhibitor), 5 µM CBP–CREB interaction inhibitor (OL + CB, CREB inhibitor) and AS1842856 (OL + A, FoxO1 inhibitor). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to total amount of the target protein (except mTOR for which β-tubulin was used as a reference). Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

  • View in gallery

    Western blot analysis of phosphorylation status of Akt (A), AMPKα (B), mTOR (C), CREB (D) and FoxO1 (E) in hypothalamus of rainbow trout incubated in vitro for 6 h at 15°C in the modified Hanks’ medium alone (C, control) or containing 500 µM octanoate (OC) or containing 500 µM octanoate and selected inhibitors of proteins of interest. These included 1 mM perifosine (OC + P, Akt inhibitor), 10 µM compound C (OC + C, AMPK inhibitor), 100 nM rapamycin (OC + R, mTOR inhibitor), 5 µM CBP–CREB interaction inhibitor (OC + CB, CREB inhibitor) and AS1842856 (OC + A, FoxO1 inhibitor). 20 μg of total protein was loaded on the gel per lane. Western blots were performed on 6 individual samples per treatment and one representative blot per treatment is shown here. Graphs represent the ratio of phosphorylated protein to total amount of the target protein (except mTOR for which β-tubulin was used as a reference). Each value denotes the mean + s.e.m. of 6 independent experiments carried out with pools of hypothalamus from 3 to 4 different fish. Different letters indicate significant differences from different treatments at the same time (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05) #, significantly different (P < 0.05) from 3 h at the same glucose concentration (two-way ANOVA P < 0.05, post hoc SNK test P < 0.05).

  • André C & Cota D 2012 Coupling nutrient sensing to metabolic homeostasis: the role of the mammalian target of rapamycin complex 1 pathway. Proceedings of the Nutrition Society 71 502510. (doi:10.1017/S0029665112000754)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Bain J, Plater L, Elliott M, Shapiro N, Hastie CJ, McLauchlan H, Klevernic I, Arthur JS, Alessi DR & Cohen P 2007 The selectivity of protein kinase inhibitors: a further update. Biochemical Journal 408 297315. (doi:10.1042/BJ20070797)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Belgardt BF, Okamura T & Brüning JC 2009 Hormone and glucose signalling in POMC and AgRP neurons. Journal of Physiology 587 53055314. (doi:10.1113/jphysiol.2009.179192)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Blanco de Morentin P, González CR, Saha AK, Martins L, Diéguez C, Vidal-Puig A, Tena-Sempere M & López M 2011 Hypothalamic AMP-activated protein kinase as a mediator of whole body energy balance. Reviews in Endocrinology and Metabolic Disorders 12 127140. (doi:10.1007/s11154-011-9165-5)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Blouet C & Schwartz GJ 2010 Hypothalamic nutrient sensing in the control of energy homeostasis. Behavioral Brain Research 209 112. (doi:10.1016/j.bbr.2009.12.024)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Bruce KD, Zsombok A & Eckel RH 2017 Lipid processing in the brain: a key regulator of systemic metabolism. Frontiers in Endocrinology 8 60. (doi:10.3389/fendo.2017.00060)

    • Search Google Scholar
    • Export Citation
  • Conde-Sieira M & Soengas JL 2017 Nutrient sensing systems in fish: impact on food intake regulation and energy homeostasis. Frontiers in Neuroscience 10 603. (doi:10.3389/fnins.2016.00603)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Conde-Sieira M, Agulleiro MJ, Aguilar AJ, Míguez JM, Cerdá-Reverter JM & Soengas JL 2010. Effect of different glycaemic conditions on gene expression of neuropeptides involved in control of food intake in rainbow trout; interaction with stress. Journal of Experimental Biology 213 38583865. (doi:10.1242/jeb.048439)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Conde-Sieira M, Bonacic K, Velasco C, Valente LMP, Morais S & Soengas JL 2015 Hypothalamic fatty acid sensing in Senegalese sole (Solea senegalensis): response to long-chain saturated, monounsaturated, and polyunsaturated (n-3) fatty acids. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 309 R1521R1531. (doi:10.1152/ajpregu.00386.2015)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Corsini M, Moroni E, Ravelli C, Andrés G, Grillo E, Ali IH, Brazil DP & Presta M 2014 Cyclic adenosine monophosphate-response element-binding protein mediates the proangiogenic or proinflammatory activity of gremlin. Arteriosclerosis, Thrombosis, and Vascular Biology 34 136145. (doi:10.1161/ATVBAHA.113.302517)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Craig PM & Moon TW 2011 Fasted zebrafish mimic genetic and physiological responses in mammals: a model for obesity and diabetes? Zebrafish 8 109117. (doi:10.1089/zeb.2011.0702)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Craig PM & Moon TW 2013 Methionine restriction affects the phenotypic and transcriptional response of rainbow trout (Oncorhynchus mykiss) to carbohydrate-enriched diets. British Journal of Nutrition 109 402412. (doi:10.1017/S0007114512001663)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Dai W, Panserat S, Mennigen JA, Terrier F, Dias K, Seiliez I & Skiba-Cassy S 2013 Post-prandial regulation of hepatic glucokinase and lipogenesis requires the activation of TORC1 signaling in rainbow trout (Oncorhynchus mykiss). Journal of Experimental Biology 216 44834492. (doi:10.1242/jeb.091157)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Dai W, Panserat S, Terrier F, Seiliez I & Skiba-Cassy S 2014 Acute rapamycin treatment improved glucose tolerance through inhibition of hepatic gluconeogenesis in rainbow trout (Oncorhynchus mykiss). American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 307 R1231R1238. (doi:10.1152/ajpregu.00166.2014)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Delgado MJ, Cerdá-Reverter JM & Soengas JL 2017 Hypothalamic integration of metabolic, endocrine, and circadian signals in fish: involvement in the control of food intake. Frontiers in Neuroscience 11 354. (doi:10.3389/fnins.2017.00354)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Diéguez C, Vazquez MJ, Romero A, López M & Nogueiras R 2011 Hypothalamic control of lipid metabolism: focus on leptin, ghrelin and melanocortins. Neuroendocrinology 94 111. (doi:10.1159/000328122)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Doyon C, Gilmour KM, Trudeau VL & Moon TW 2003 Corticotropin releasing factor and neuropeptide Y mRNA levels are elevated in the preoptic area of socially subordinate rainbow trout. General and Comparative Endocrinology 133 260271. (doi:10.1016/S0016-6480(03)00195-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Efeyan A, Comb WC & Sabatini DM 2015 Nutrient sensing mechanisms and pathways. Nature 517 302310. (doi:10.1038/nature14190)

  • Figueiredo-Silva AC, Saravanan S, Schrama JW, Kaushik S & Geurden I 2012 Macronutrient-induced differences in food intake relate with hepatic oxidative metabolism and hypothalamic regulatory neuropeptides in rainbow trout (Oncorhynchus mykiss). Physiology and Behavior 106 499505. (doi:10.1016/j.physbeh.2012.03.027)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Gao S, Moran TH, Lopaschuk GD & Butler AA 2013 Hypothalamic malonyl-CoA and the control of food intake. Physiology and Behavior 122 1724. (doi:10.1016/j.physbeh.2013.07.014)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Gong N, Jönsson E & Björnsson BT 2016 Acute anorexigenic action of leptin in rainbow trout is mediated by the hypothalamic Pi3k pathway. Journal of Molecular Endocrinology 56 227238. (doi:10.1530/JME-15-0279)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gross DN, Wan M & Birnbaum MJ 2009 The role of FOXO in the regulation of metabolism. Current Diabetes Reports 9 208214. (doi:10.1007/s11892-009-0034-5)

  • Kamalam BS, Medale F, Kaushik S, Polakof S, Skiba-Cassy S & Panserat S 2012 Regulation of metabolism by dietary carbohydrate in two lines of rainbow trout divergently selected for muscle fat content. Journal of Experimental Biology 215 25672578. (doi:10.1242/jeb.070581)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kolditz C, Borthaire M, Richard N, Corraze G, Panserat S, Vachot C, Lefevre F & Médale F 2008 Liver and muscle metabolic changes induced by dietary energy content and genetic selection in rainbow trout (Oncorhynchus mykiss). American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 294 R1154R1164. (doi:10.1152/ajpregu.00766.2007)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kwon O, Kim KW & Kim M-S 2016 Leptin signalling pathways in hypothalamic neurons. Cellular and Molecular Life Sciences 73 14571477. (doi:10.1007/s00018-016-2133-1)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lansard M, Panserat S, Seiliez I, Polakof S, Plagnes-Juan E, Geurden I, Médale F, Kaushik S. & Corraze G 2009 Hepatic protein kinase B (Akt)-target of rapamycin (TOR)-signalling pathways and intermediary metabolism in rainbow trout (Oncorhynchus mykiss) are not significantly affected by feeding plant-based diets. British Journal of Nutrition 102 15641573. (doi:10.1017/S000711450999095X)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lansard M, Panserat S, Plagnes-Juan E, Seiliez I & Skiba-Cassy S 2010 Integration of insulin and amino acid signals that regulate hepatic metabolism-related gene expression in rainbow trout: role of TOR. Amino Acids 39 801810. (doi:10.1007/s00726-010-0533-3)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Leder EH & Silverstein JT 2006 The pro-opiomelanocortin genes in rainbow trout (Oncorhynchus mykiss): duplications, splice variants, and differential expression. Journal of Endocrinology 188 355363. (doi:10.1677/joe.1.06283)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Li Z, Tan F, Liewehr DJ, Steinberg SM & Thiele CJ 2010 In vitro and in vivo inhibition of neuroblastoma tumor cell growth by Akt inhibitor perifosine. Journal of National Cancer Institute 102 758770. (doi:10.1093/jnci/djq125)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Li A, Yuan X, Liang XF, Liu L, Li J, Li B, Fang J, Li J, He S, Xue M, Wang J & Tao YX 2016 Adaptations of lipid metabolism and food intake in response to low and high fat diets in juvenile grass carp (Ctenopharyngodon idellus). Aquaculture 457 4349. (doi:10.1016/j.aquaculture.2016.01.014)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Librán-Pérez M, Polakof S, López-Patiño MA, Míguez JM & Soengas JL 2012 Evidence of a metabolic fatty-acid sensing system in the hypothalamus and Brockmann bodies of rainbow trout: implications in food intake regulation. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 302 R1340R1350. (doi:10.1152/ajpregu.00070.2012)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Librán-Pérez M, López-Patiño MA, Míguez JM & Soengas JL 2013 Oleic acid and octanoic acid sensing capacity in rainbow trout Oncorhynchus mykiss is direct in hypothalamus and Brockmann bodies. PLoS ONE 8 e59507. (doi:10.1371/journal.pone.0059507)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Librán-Pérez M, Otero-Rodiño C, López-Patiño MA, Míguez JM & Soengas JL 2014 Central administration of oleate or octanoate activates hypothalamic fatty acid sensing and inhibits food intake in rainbow trout. Physiology and Behavior 129 272279. (doi:10.1016/j.physbeh.2014.02.061)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Librán-Pérez M, Geurden I, Dias K, Corraze G, Panserat S & Soengas JL 2015 Feeding rainbow trout with a lipid-enriched diet: effects on fatty acid sensing, regulation of food intake and cellular signaling pathways. Journal of Experimental Biology 218 26102619. (doi:10.1242/jeb.123802)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lipina C, Irving AJ & Hundal HS 2014 Mitochondria: a possible nexus for the regulation of energy homeostasis by the endocannabinoid system? American Journal of Physiology: Endocrinology and Metabolism 307 E1E13. (doi:10.1152/ajpendo.00100.2014)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • López M 2017 Hypothalamic AMPK: a golden target against obesity? European Journal of Endocrinology 176 R235R246. (doi:10.1530/EJE-16-0927)

  • López M, Lage R, Saha AK, Pérez-Tilve D, Vázquez MJ, Varela L, Sangiao-Alvarellos S, Tovar S, Raghay K & Rodríguez-Cuenca S 2008 Hypothalamic fatty acid metabolism mediates the orexigenic action of ghrelin. Cell Metabolism 7 389399. (doi:10.1016/j.cmet.2008.03.006)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • MacDonald LE, Alderman SL, Kramer S, Woo PTK & Bernier NJ 2014 Hypoxemia-induced leptin secretion: a mechanism for the control of food intake in diseased fish. Journal of Endocrinology 221 441445. (doi:10.1530/JOE-13-0615)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Magnan C, Levin BE & Luquet S 2015 Brain lipid sensing and the neural control of energy balance. Molecular and Cellular Endocrinology 418 38. (doi:10.1016/j.mce.2015.09.019)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Magnoni LJ, Vraskou Y, Palstra A & Planas JV 2012 AMP-activated protein kinase plays an important evolutionary conserved role in the regulation of glucose metabolism in fish skeletal muscle cells. PLoS ONE 7 e31219. (doi:10.1371/journal.pone.0031219)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mayer CD & Belsham DD 2010 Palmitate attenuates insulin signaling and induces endoplasmic reticulum stress and apoptosis in hypothalamic neurons: rescue of resistance and apoptosis through adenosine 5´monophosphate-activated protein kinase activation. Endocrinology 151 576585. (doi:10.1210/en.2009-1122)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Morton GJ, Meek TH & Schwartz MW 2014 Neurobiology of food intake in health and disease. Nature Reviews Neuroscience 15 367378. (doi:10.1038/nrn3745)

  • Nagashima T, Shigematsu N, Maruki R, Urano Y, Tanaka H, Shimaya A, Shimokawa T & Shibasaki M 2010 Discovery of novel forkhead box O1 inhibitors for treating type 2 diabetes: improvement of fasting glycemia in diabetic db/db mice. Molecular Pharmacology 78 961970. (doi:10.1124/mol.110.065714)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 e45. (doi:10.1093/nar/29.9.e45)

  • Polakof S, Míguez JM & Soengas JL 2007 In vitro evidences for glucosensing capacity and mechanisms in hypothalamus, hindbrain, and Brockmann bodies of rainbow trout. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 293 R1410R1420. (doi:10.1152/ajpregu.00283.2007)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Polakof S, Panserat S, Plagnes-Juan E & Soengas JL 2008 Altered dietary carbohydrates significantly affect gene expression of the major glucosensing components in Brockmannn bodies and hypothalamus of rainbow trout. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 295 R1077R1088. (doi:10.1152/ajpregu.90476.2008)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Polakof S, Médale F, Larroquet L, Vachot C, Corraze G & Panserat S 2011a Insulin stimulates lipogenesis and attenuates beta-oxidation in white adipose tissue of fed rainbow trout. Lipids 46 189199. (doi:10.1007/s11745-010-3521-1)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Polakof S, Panserat S, Craig PM, Martyres DJ, Plagnes-Juan E, Savari S, Aris-Brosou S & Moon TW 2011b The metabolic consequences of hepatic AMP-kinase phosphorylation in rainbow trout. PLoS ONE 6 e20228. (doi:10.1371/journal.pone.0020228)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Rolland M, Dalsgaard J, Holm J, Gómez-Requeni P & Skov PV 2015 Dietary methionine level affects growth performance and hepatic gene expression of GH-IGF system and protein turnover regulators in rainbow trout (Oncorhynchus mykiss) fed plant protein-based diets. Comparative Biochemistry and Physiology B 181 3341. (doi:10.1016/j.cbpb.2014.11.009)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Sánchez-Gurmaches J, Cruz-Garcia L, Gutiérrez J & Navarro I 2010 Endocrine control of oleic acid and glucose metabolism in rainbow trout (Oncorhynchus mykiss) muscle cells in culture. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 299 R562R572. (doi:10.1152/ajpregu.00696.2009)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Sánchez-Gurmaches J, Cruz-Garcia L, Gutiérrez J & Navarro I 2012 Adiponectin effects and gene expression in rainbow trout: an in vivo and in vitro approach. Journal of Experimental Biology 215 13731383. (doi:10.1242/jeb.061697)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Seiliez I, Panserat S, Lansard M, Polakof S, Plagnes-Juan E, Surget A, Dias K, Larquier M, Kaushik S & Skiba-Cassy S 2011 Dietary carbohydrate-to-protein ratio affects TOR signaling and metabolism-related gene expression in the liver and muscle of rainbow trout after a single meal. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 300 R733R743. (doi:10.1152/ajpregu.00579.2010)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Skiba-Cassy S, Lansard M, Panserat S & Médale F 2009. Rainbow trout genetically selected for greater muscle fat content display increased activation of liver TOR signaling and lipogenic gene expression. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 297 R1421R1429. (doi:10.1152/ajpregu.00312.2009)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Soengas JL 2014 Contribution of glucose- and fatty acid sensing systems to the regulation of food intake in fish. A review. General and Comparative Endocrinology 205 3648. (doi:10.1016/j.ygcen.2014.01.015)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Sun J, Xiao P, Chang ZG, Ji H, Du ZY & Chen LQ 2017 Forkhead box 01 in grass carp Ctenopharyngodon idella: molecular characterization, gene structure, tissue distribution and mRNA expression in insulin-inhibited adipocyte lipolysis. Comparative Biochemistry and Physiology A 204 7684. (doi:10.1016/j.cbpa.2016.11.011)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Tang Z, Sun C, Yan A, Wu S, Qin C, Zhang Y & Li W 2013 Genes involved in fatty acid metabolism: molecular characterization and hypothalamic mRNA response to energy status and neuropeptide Y treatment in the orange-spotted grouper Epinephelus coioides. Molecular and Cellular Endocrinology 376 114124. (doi:10.1016/j.mce.2013.06.020)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Velasco C, Librán-Pérez M, Otero-Rodiño C, López-Patiño MA, Míguez JM, Cerdá-Reverter JM & Soengas JL 2016a Ghrelin modulates hypothalamic fatty acid-sensing and control of food intake in rainbow trout. Journal of Endocrinology 228 2537. (doi:10.1530/JOE-15-0391)

    • Search Google Scholar
    • Export Citation
  • Velasco C, Librán-Pérez M, Otero-Rodiño C, López-Patiño MA, Míguez JM & Soengas JL 2016b Ceramides are involved in the regulation of food intake in rainbow trout (Oncorhynchus mykiss). American Journal of Physiology: Regulatory, Integrative and Comparative Physiology 311 R658R668. (doi:10.1152/ajpregu.00201.2016)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Velasco C, Moreiras G, Conde-Sieira M, Leao JM, Míguez JM & Soengas JL 2017 Ceramide counteracts the effects of ghrelin on the metabolic control of food intake in rainbow trout. Journal of Experimental Biology 220 25632576. (doi:10.1242/jeb.159871)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Wade NM, Skiba-Cassy S, Dias K & Glencross BD 2014 Postprandial molecular responses in the liver of the barramundi, Lates calcarifer. Fish Physiology and Biochemistry 40 427443. (doi:10.1007/s10695-013-9854-y)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yan AF, Chen T, Chen S, Tang DS, Liu F, Jiang X, Huang W, Ren CH & Hu C-Q 2016 Signal transduction mechanism for glucagon-induced leptin gene expression in goldfish liver. International Journal of Biological Sciences 12 15441554. (doi:10.7150/ijbs.16612)

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zeng YY, Jiang WD, Liu Y, Wu P, Zhao J, Jiang J, Kuang SY, Tang L, Tang WN & Zhang YA 2016 Optimal dietary alpha-linolenic acid/linoleic acid ratio improved digestive and absorptive capacities and target of rapamycin gene expression of juvenile grass carp (Ctenopharyngodon idellus). Aquaculture Nutrition 22 12511266. (doi:10.1111/anu.12337)

    • Crossref
    • Search Google Scholar
    • Export Citation