Expression and functional studies of the GDNF family receptor alpha 3 in the pancreas

in Journal of Molecular Endocrinology
View More View Less
  • 1 Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC), Institut National de la Santé et de la Recherche Médicale (INSERM) U964, Centre National de Recherche Scientifique (CNRS) UMR 7104, Université de Strasbourg (UdS), 1 Rue Laurent Fries, 67404 Illkirch, France

The generation of therapeutic β-cells from human pluripotent stem cells relies on the identification of growth factors that faithfully mimic pancreatic β-cell development in vitro. In this context, the aim of the study was to determine the expression and function of the glial cell line derived neurotrophic factor receptor alpha 3 (GFRα3) and its ligand artemin (Artn) in islet cell development and function. GFRα3 and Artn expression were characterized by in situ hybridization, immunochemistry, and qRT-PCR. We used GFRα3-deficient mice to study GFRα3 function and generated transgenic mice overexpressing Artn in the embryonic pancreas to study Artn function. We found that GFRα3 is expressed at the surface of a subset of Ngn3-positive endocrine progenitors as well as of embryonic α- and β-cells, while Artn is found in the pancreatic mesenchyme. Adult β-cells lack GFRα3 but α-cells express the receptor. GFRα3 was also found in parasympathetic and sympathetic intra-islet neurons as well as in glial cells in the embryonic and adult pancreas. The loss of GFRα3 or overexpression of Artn has no impact on Ngn3 and islet cell formation and maintenance in the embryo. Islet organization and innervation as well as glucose homeostasis is normal in GFRα3-deficient mice suggesting functional redundancy.

Abstract

The generation of therapeutic β-cells from human pluripotent stem cells relies on the identification of growth factors that faithfully mimic pancreatic β-cell development in vitro. In this context, the aim of the study was to determine the expression and function of the glial cell line derived neurotrophic factor receptor alpha 3 (GFRα3) and its ligand artemin (Artn) in islet cell development and function. GFRα3 and Artn expression were characterized by in situ hybridization, immunochemistry, and qRT-PCR. We used GFRα3-deficient mice to study GFRα3 function and generated transgenic mice overexpressing Artn in the embryonic pancreas to study Artn function. We found that GFRα3 is expressed at the surface of a subset of Ngn3-positive endocrine progenitors as well as of embryonic α- and β-cells, while Artn is found in the pancreatic mesenchyme. Adult β-cells lack GFRα3 but α-cells express the receptor. GFRα3 was also found in parasympathetic and sympathetic intra-islet neurons as well as in glial cells in the embryonic and adult pancreas. The loss of GFRα3 or overexpression of Artn has no impact on Ngn3 and islet cell formation and maintenance in the embryo. Islet organization and innervation as well as glucose homeostasis is normal in GFRα3-deficient mice suggesting functional redundancy.

Introduction

A network of transcription factors controls the differentiation of islet cells during pancreas organogenesis (for a review, see Cano et al. (2013)). Neurog3 is central in this process as this gene is essential for determining the fate of endocrine cells and the initiation of islet differentiation programs resulting in different pancreatic endocrine cell types including insulin-secreting β-cells (Gradwohl et al. 2000, Gu et al. 2002, Desgraz & Herrera 2009). While a series of growth factors controlling early steps of pancreas organogenesis have been identified (see for a review Mastracci & Sussel (2012) and Lodh et al. (2014)) we currently lack information on the nature of signals that would eventually control later steps of islet differentiation including endocrine cell fate decision, survival of endocrine progenitors, islet subtype specification, and maturation. This knowledge could be instrumental to improve the generation of glucose responsive β-cells in vitro. To that effect, we searched for endocrine progenitor cell surface receptors. Gene expression profiling in sorted Neurog3-positive cells from Ngn3EYFP/+ E15.5 embryonic pancreas (Soyer et al. 2010) revealed an enrichment of the Glial cell line derived neurotrophic factor receptor alpha 3 (GFRα3) mRNA suggesting that GFRα3 and its ligand artemin (Artn) would control the biology of endocrine progenitor cells. GFRα3 belongs to the glial cell line derived neurotrophic factor (GDNF) family of receptors which contains four members (GFRα1–4). GDNF family of ligands (GFLs) GDNF, Neurturin (Nrtn), Artn, and Persephin (Pspn) bind to co-receptors GFRα1–4 and activate RET receptor tyrosine kinase (Airaksinen & Saarma 2002).

GFLs are mainly known for their role in the development and function of the nervous system (Airaksinen & Saarma 2002) but GDNF is also important for the growth of the ureteric bud during kidney development (Costantini & Shakya 2006) or spermatogonial stem cell renewal (Hofmann 2008). In the embryonic pancreas, Gdnf expression has been described in the pancreatic epithelium acting as a neurotrophic factor promoting the differentiation and migration of neural progenitors. Pancreatic inactivation of Gdnf leads to reduced parasympathetic innervation in the pancreas (Munoz-Bravo et al. 2013). Other studies demonstrated that GFRα2 signaling is required for parasympathetic islet innervation (Rossi et al. 2005). More surprisingly, exogeneous GDNF induced the proliferation of pancreatic progenitors in pancreas explant cultures (Munoz-Bravo et al. 2013), and the overexpression of Gdnf in transgenic mice increased pancreatic β-cell mass (Rossi et al. 2005). Altogether, these data suggest a role of GFLs and receptors in pancreatic innervation and endocrine cell differentiation. However, pancreatic expression and function of GFRα3 has not been explored yet. To assess the role of GFRα3 and of its ligand Artn in the pancreas we determined their expression. We show that GFRα3 is expressed in subsets of endocrine progenitors and developing, but not adult, islet cells, except alpha cells. GFRα3 is also expressed in the embryonic and adult pancreatic neurons and glial cells. Analysis of the phenotype of GFRα3 KO mice as well as of transgenic mice overexpressing Artn revealed that Artn/GFRα3 signaling pathway is not essential for islet formation, innervation, and function.

Materials and methods

Mouse strains and genotyping

Ngn3eYFP/+ mice were described previously (Mellitzer et al. 2004). GFRα3tLacZ/+ mice were generously provided by Dr Jeffrey Milbrandt and have been described previously (Honma et al. 2002). The promPdx1-Artn-2A-mCherry (PAM) transgenic mouse line was generated in collaboration with the Mouse Clinical Institute (ICS; Illkirch). The Artn-2A-mCherry sequence was synthesized by GenScript and cloned downstream of a 5.15-kb DNA fragment containing the mouse Pdx1 promoter and a heat shock protein minimal promoter (hsp68) (Johansson et al. 2007). All mouse lines were kept on CD1 or C56BL/6 backgrounds and experiments supervised by G Gradwohl (agreement N° C67-59 by the Direction des Services Vétérinaires, Strasbourg, France). PAM mice were genotyped by using 5′ GCCACTGCCTGCGGCTGTCT 3′ and 5′ CTTGGCGGTCTGGGTGCCCT 3′ primers.

Real-time PCR

Total RNA was isolated from pancreatic buds at E15.5 using Tri Reagent (Invitrogen). In total, 1 μg of RNA was used for DNaseI (Roche) treatment and cDNA synthesis with the Transcriptor Reverse Transcriptase (Roche). RNA from Ngn3 sorted cells was isolated by using the RNeasy Micro kit (Qiagen). cDNA was synthesized using the Transcriptor Reverse Transcriptase (Roche) and 200 ng of RNA were used for DNaseI treatment. Quantitative PCR were performed using Taqman probes.

In situ hybridization

E15.5 embryos were fixed in 4% paraformaldehyde in 1× PBS without Ca2+ and Mg2+ overnight at 4 °C, transferred in 20% sucrose in PBS overnight at 4 °C, embedded in Cryomatrix (Thermo Scientific, Waltham, MA, USA), and frozen on dry ice. Sections of 10 μm were cut with a Leica cryostat CM3050S. Briefly, slides were incubated overnight at 65 °C with hybridization buffer (NaCl 11.4 g/l; Tris HCl pH 7.5 1.404 g/l; Tris base 0.134 g/l; Na2PO4 2H2O 0.78 g/l; Na2HPO4 0.71 g/l; 0.05 M EDTA; 50% formamide; 10% dextran sulfate; 1 mg/ml tRNA; 0.02% BSA; 0.02% Ficoll; 0.02% PVP) containing the Digoxigenin (DIG) labeled Gfrα3 cRNA probe. Sections were washed in 1× SSC, 50% formamide, 0.1% tween at 65 °C, and then equilibrated in MABT solution (Maleic Acid 100 mM pH 7.5; NaCl 150 mM; Tween 0.1%) and incubated in blocking solution (MABT, Tween; Boehringer Blocking Reagent (BM 1096176) 2%; heat inactivated goat serum 20%) at room temperature. Slides were then incubated with anti-DIG antibody coupled with alkaline phosphatase diluted in blocking solution overnight at room temperature. Samples were then washed in MABT solution, equilibrated in staining buffer (NaCl 100 mM; MgCl2 50 mM; Tris pH9.5 100 mM; Tween 0.1%; Levamisole 0.5 mg/ml), and revealed in the same solution containing 3.5 μl/ml NBT and 3.5 μl/ml BCIP.

If followed by immunohistochemistry, slides were washed in PBS and incubated with blocking solution (PBS; Triton 0.1%; normal goat serum (NGS) 20%) containing anti-Ngn3 antibody (Guinea Pig, IGBMC, 1/500). Endogenous peroxydases were inactivated by incubating slides in 0.5% H2O2 in methanol. After washes in PBS; Triton 0.1%, sections were incubated with secondary antibody coupled to HRP diluted in PBS; Triton 0.1% and staining revealed using the DAB Peroxydase substrate kit (Vector Laboratories, Burlingame, CA, USA).

Immunohistofluorescence

Embryos or dissected adult pancreas were harvested, fixed, embedded, and sectioned as described above. Primary antibodies were diluted in PBS; Triton 0.1%; NDS 5–20%:GFRα3 (goat, R&D Systems, Abingdon, Oxfordshire, UK, 1/500), Pdx1 (rabbit, Chris Wright, Vanderbilt University, USA, 1/2000), Ngn3 (Guinea Pig, IGBMC, 1/500), insulin (Guinea Pig, Linco, St. Charles, MO, USA, 1/1000 or mouse, Sigma, 1/1000), glucagon (Guinea Pig, Linco, 1/2000 or mouse, Sigma, 1/2000), Artn (goat, R&D Systems, 1/100), Somatostatin (Rabbit, Dako, Glostrup, Denmark, 1/200), PP (Guinea Pig, Linco 1/1000), tyrosine hydroxylase (TH; rabbit, Merck Millipore, Darmstadt, Germany, 1/500), VIP (rabbit, Phoenix Pharmaceuticals, Burlingame, CA, USA, 1/500), S100beta (rabbit, Merck Millipore, 1/500), TUJ1 (mouse, Covance, Rueil-Malmaison, France, 1/500) and Nkx6.1 (DSHB, F55A10 1/200). Appropriate secondary antibodies conjugated to DyLight488, DyLight 549, or DyLight 649 (Jackson ImmunoResearch, West Grove, PA, USA, 1/500).

Quantitative analysis

To quantify the number of Ngn3 cells and insulin/glucagon areas, 7-μm cryosections were cut and each fifth section was immunostained for Ngn3, insulin, or glucagon. Ngn3 quantification is expressed as the number of Ngn3 cells per pancreas. Insulin and glucagon areas were normalised to the pancreatic area (DAPI staining). Analyses were performed using ImageJ Software.

Innervation was measured as described previously (Munoz-Bravo et al. 2013). Briefly at P0, one section every 60 μm was stained for hormones and TUJ1. Pictures were taken using a slide scanner Nanozoomer 2.OHT (Hamamatsu, Hamamatsu City, Japan) and analyzed with the Image J software. Tubeness plugin was used to detect neurites, then skeletonized to obtain neurites length. Results are expressed as total innervation length normalized to endocrine area.

For measurement of endocrine innervation at P21, one section every 60 μm was stained for hormones and tyrosine hydroxylase (TH) or vasoactive intestinal peptide (VIP). Randomly chosen 50 islets from each pancreas were analyzed. Islets area were defined manually and thresholded using Image J software. Sympathetic innervation (TH) is expressed as TH+ area vs endocrine area and parasympathetic innervation is expressed as VIP+ puncta vs endocrine area.

Metabolic studies

Mice of more than 10 weeks were made to fast for 16 h. For Oral Glucose Tolerance Test (OGTT), mice received glucose by intragastric gavage (1 g/kg body weight). For Intraperitoneal Glucose Tolerance Test (IPGTT), mice received glucose by i.p. injection (2 g/kg body weight). Circulating blood glucose was measured in tail blood at 0, 15, 30, 45, 60, 90, and 120 min using Glucofix Sensor (A.Menarini Diagnostics, Firenze, Italy).

Preparation of single cell suspension for FACS sorting

Pancreas from E15.5 pancreas were dissected, mechanically and enzymatically dissociated by a trypsin treatment (0.05%) 5–10 min at 37 °C. Trypsin action was stopped by adding DMEM/F12; FCS10%; 3.15 g/l glucose; gentamycine. Cells were filtered the first time on an 80-μm Nylon Mesh (SEFAR, 3A03-0080-102-11), spinned 5 min at 90 g, resuspended in DMEM/F12; FCS10%; 3.15 g/l glucose; gentamycine and filtered a second time on a 50-μm Nylon Mesh (Wipak Medical R40, 050-47S) before FACS sorting. Cells were sorted by using an FACS Vantage SE (Becton Dickinson, San Jose, CA, USA), with a Diva 5.0.3 software. Once sorted, cells were spinned for 5 min at 90 g and RNA extraction performed.

Statistical analysis

Values are presented as mean of s.d. or s.e.m. The P values were determined using the two-tailed Student's t test with unequal variance. The P<0.05 was accepted as statistically significant.

Results

GFRα3 is expressed in subsets of Ngn3-positive endocrine progenitors

Gene expression profiling revealed that the mRNA of GFRα3 was strongly and specifically enriched in eYFP+ endocrine progenitors vs eYFP cells (fold change (FC)=33.25; false discovery rate (FDR)=0.02) (Supplementary Table 1, see section on supplementary data given at the end of this article) purified from Ngn3eYFP/+ embryonic (E15.5) pancreas (Soyer et al. 2010). RT-QPCR experiments confirmed this strong enrichment of GFRα3 in the islet lineage (Fig. 1a). Artemin, a secreted peptide of the GDNF ligand family, binds to the co-receptor GFRα3 and thereby activates the receptor tyrosine kinase RET. We thus examined whether Artn, as well as other members of the GDNF receptor (GFRs) and ligand (GFLs) families are expressed in the embryonic pancreas. We found that Artn and GFRα2 are specifically enriched in the non-endocrine (eYFP) cell population (Fig. 1b and d) while Gdnf is enriched in the endocrine compartment (Fig. 1c).

Figure 1
Figure 1

GFRα3 receptor is expressed in a subset of endocrine progenitors. (a, b, c and d) RT-qPCR on purified EYFP+ and EYFP cells from E15.5 Ngn3eYFP/+ pancreas showing that (a) GFRα3 expression is enriched in EYFP+ cells and (b) Artn is significantly enriched in the EYFP cell population. (c) GFRα2 expression is enriched in the EYFP cell population while (d) Gdnf is strongly expressed in EYFP+ cells. (e) In situ hybridization for GFRα3 (blue) and immunostaining for NGN3 (brown) on cryosections of WT E15.5 pancreas showing expression of GFRα3 in some islet progenitor cells (dark arrows). (f) Immunostaining for GFRα3 (red) and NGN3 (green) on cryosections of WT E15.5 pancreas showing that some Ngn3-positive cells express GFRα3 at the cell membrane (yellow arrows). Data are summarized as mean±s.e.m.; n≥4 for each conditions; **P≤0.01, ***P≤0.001. In f yellow, green and red arrows point to GFRα3+/NGN3+; NGN3+/GFRα3 and NGN3/GFRα3+ cells respectively. In e, dark, blue and brow arrows point to GFRα3+/NGN3+, GFRα3+/NGN3, GFRα3/NGN3+ respectively.

Citation: Journal of Molecular Endocrinology 56, 2; 10.1530/JME-15-0213

We next performed in situ hybridization and immunofluorescence experiments on pancreas cryosections to more precisely determine GFRα3 expression during pancreas development. We found that not only GFRα3 mRNA (Fig. 1e), but importantly also GFRα3 protein are expressed in Ngn3-positive pancreatic cells at E12.5 (Supplementary Figure 1, see section on supplementary data given at the end of this article) and E15.5 (Fig. 1f, yellow arrows). GFRα3 immunosignal is concentrated at the cell periphery suggesting cytoplasmic membrane localization as expected. However, only a subset of Ngn3 cells expresses GFRα3 (Fig. 1f green arrows point to GFRα3/Ngn3+ cells).

GFRα3 persists in developing islet cells but in the adult pancreas only α-cells express the receptor

Interestingly, not all GFRα3-positive cells express Ngn3 (Fig. 1f red arrows). Double immunostainings for insulin or glucagon suggest that GFRα3-positive/Ngn3-negative cells represent developing α- and β-cells (Fig. 2a and b white arrows). Accordingly, we found that the transcription factor Nkx6.1, which becomes restricted to the β-cell lineage (Henseleit et al. 2005), is expressed in double positive GFRα3/insulin cells (Supplementary Figure 2A, see section on supplementary data given at the end of this article). Similarly δ and PP-cells express GFRα3 in the embryonic pancreas (Fig. 3a and d). After E15.5, GFRα3 labeling is maintained in embryonic islet cells (not shown), and many islet cells remain positive for GFRα3 at P0 (white arrows in Figs 2c, d and 3b, e). In sharp contrast, in the adult pancreas, β-cells are devoid of GFRα3 (Fig. 2e), as well as δ and PP-cells (Fig. 3c and f), while only α-cells are GFRα3 positive (Fig. 2f and Supplementary Figure 2B). Of note, we observed that adult islets are always surrounded by GFRα3-positive cells (Figs 2e, f and 3c, f) in a pattern, different from α-cells, but reminiscent of glial cells (see below). Thus, GFRα3 is found at the surface of a subset of islet progenitors and persists in embryonic islet cells suggesting these endocrine cells can receive and integrate Artn signals during pancreas ontogenesis. In contrast among adult islet cells, only α-cells express GFRα3.

Figure 2
Figure 2

GFRα3 receptor is expressed in insulin- and glucagon-positive cells in the embryo and at birth but in adult islets, only α-cells are GFRα3-positive. (a, b, c, d, e and f) Immunofluorescence on cryosections of E15.5 embryonic (a and b), newborn (c and d) or adult pancreas (e and f) for GFRα3 (red) insulin (green) and glucagon (green) expressing cells. (c and d) At P0, GFRα3 (red) expression decreases in (c) insulin+ cells (green) and (d) is maintained in glucagon+ cells (green). (e and f) In the adult pancreas, GFRα3(red) is (e) not expressed by insulin+ cells (green) but (f) glucagon+ cells (green) express the receptor. White arrows point to hormone+/GFRα3+ cells and red arrows point to GFRα3+/hormone cells.

Citation: Journal of Molecular Endocrinology 56, 2; 10.1530/JME-15-0213

Figure 3
Figure 3

GFRα3 is expressed in developing and newborn but not adult somatostatin- and PP-cells. (a, b, c, d, e and f) Immunolocalisations on cryosections of WT pancreas for GFRα3 (red) and Somatostatin (SST, green, a, b and c), or Pancreatic Polypeptide (PP, green, d, e and f) at E15.5, P0 and in the adult mice. In the embryo at E15.5 and in newborn mice (P0) GFRα3 is expressed by Somatostatin+ cells and PP+ cells but not in the adult pancreas. White arrows point to hormone+/Gfrα3+ cells, red arrows point to the same double positive cells on picture where the green layer has been removed for a better appreciation of GFRα3 staining.

Citation: Journal of Molecular Endocrinology 56, 2; 10.1530/JME-15-0213

Artn transcripts are detected in the pancreatic mesenchyme

To further characterize Artn/GFRα3 signaling in the embryonic pancreas, we next decided to identify the cellular origin of Artn ligand. Unfortunately, in situ hybridization as well as immunofluorescence experiments fail to detect any expression in the pancreas of mouse embryos (data not shown). We then thought to take advantage of the ArtnLacZ/+ mouse (Honma et al. 2002) to reveal β-galactosidase activity in Artn-expressing cells in whole mount embryos. Again, we could not observe any staining in the embryonic pancreas although labeled cells were readily detected in sclerotomes as expected (data not shown). We concluded that Artn expression must be too low to be detected with the above tools. However, RT-PCR clearly indicated an enrichment of Artn transcripts in non-endocrine cells (Fig. 1b) suggesting pancreatic expression of Artn ligand. To determine whether Artn is expressed by other non-endocrine, pancreatic epithelial, or mesenchymal cells, we performed RT-PCR at E12.5 (a stage when many GFRα3-cells are detected; Supplementary Figure 1) in pancreatic epithelia and their surrounding mesenchyme that were enzymatically dissociated. Significant enrichment of Pdx1 expression in epithelia confirmed the purity of our samples (Fig. 4). Similarly GFRα3 and Ret are found in the epithelium fraction in agreement with the Affymetrix and/or expression data. Importantly, Artn transcripts were five times higher in the mesenchymal tissue. Of note is that GFRα2 is mesenchymal as well, while GFRα1 expression was observed in both epithelia and mesenchyme. Gdnf expression was enriched in epithelia, which is coherent with published data (Munoz-Bravo et al. 2013). Together, our results suggest that mesenchymal Artn signals to GFRα3-positive developing endocrine cells located in the epithelium at E12.5.

Figure 4
Figure 4

Expression of GFRs and GFLs in embryonic pancreatic epithelial or mesenchymal cells. RT-qPCR on E12.5 pancreatic epithelium and mesenchyme revealed significant enrichments of Pdx1 (control), Ret, GFRα3, and Gdnf in the epithelium and of GFRα2 and Artn in mesenchyme. GFRα1 and Pspn are expressed at the same level both in the epithelium and the mesenchyme. Data are summarized as mean±s.e.m.; n≥10 for each tissue; *P≤0.05, **P≤0.01, ***P≤0.001.

Citation: Journal of Molecular Endocrinology 56, 2; 10.1530/JME-15-0213

GFRα3 is expressed in pancreatic neuronal and glial cells

RT-qPCR analysis (Supplementary Figure 3a, see section on supplementary data given at the end of this article) revealed that while GFRα3 transcripts were reduced by 70% in Ngn3−/− E15.5 pancreata (due to the absence of the endocrine cells), a significant level of GFRα3 mRNA persists suggesting expression outside the endocrine lineage. We thus performed immunofluorescence experiments to identify GFRα3-positive cells in Ngn3-deficient pancreas. As expected, GFRα3-immunostaining could not be detected in the pancreatic epithelium (Pdx1+ cells) of Ngn3-deficient pancreas in contrast to WT (Supplementary Figure 3b and c), confirming GFRα3 expression in developing endocrine cells. However, GFRα3-positive cells were found embedded in the exocrine tissue, sometimes surrounding acini (Supplementary Figure 3e) and co-stained for the neuronal marker TUJ1 suggesting that GFRα3 is expressed in developing intra-pancreatic neurons. GFRα3/TUJ1 double positive neuronal fibers (Fig. 5a, white arrows) are also found close to clusters of GFRα3-positive/TUJ1-negative cells (likely developing islet cells) suggesting that GFRα3 also marks neurons innervating endocrine cells.

Figure 5
Figure 5

Localization of GFRα3 in developing and adult neuronal and glial cells. (a, b, c, d, e and f) Immunofluorescence on pancreatic cryosections at E15.5 (a), and at adult stage (b, c, d, e and f) for GFRα3 (red), neuron-specific class III beta tubulin Tuj1 (Tuj1, green), tyrosine hydroxylase (TH, green), vasoactive intestinal peptide (VIP, green), and calcium binding protein S100β (S100β, green). GFRα3 is expressed by neuronal cells (Tuj1+, green) in the embryonic pancreas. (b, c, d, e and f) In the adult pancreas, GFRα3 (red) is expressed by sympathetic neuronal cells (TH+, green) in both endocrine (b) and acinar (c) tissues, as well as by parasympathetic neuronal cells (VIP+, green) in both endocrine (d) and acinar (e) tissues, and by glial (f) cells (S100β+, green). White arrows point to neuronal cells expressing GFRα3+/neurons+ or Glial+ cells. Islets (i) are delimited by dashed lines. *cluster of developing islet cells. a, acinar tissue; v, blood vessel; i, islet. Nuclei are labeled with DAPI (blue). White arrows point to double labeled cells.

Citation: Journal of Molecular Endocrinology 56, 2; 10.1530/JME-15-0213

Different types of neuronal cells innervate the adult pancreas including neurons of the parasympathetic and sympathetic system acting antagonistically on pancreatic hormone secretion (Ahren 2000). Stimulation of parasympathetic neurons will promote insulin secretion, while sympathetic neurons activate glucagon secretion and inhibit insulin secretion (Ahren 2000). We observed GFRα3-positive sympathetic neurons (labeled by the enzyme tyrosine hydroxylase (TH)) both in the endocrine (Fig. 5b, white arrows) and exocrine tissues (Fig. 5c, white arrows). GFRα3 labeling was rather surrounding the islets while intra-islet TH-positive clusters were GFRα3-negative (Fig. 5b). Regarding parasympathetic neurons (labeled by the vasoactive intestinal peptide (VIP)), we observed punctuated VIP signal within the islets (Fig. 5d, white arrows) as well as in the acinar tissue along blood vessels (Fig. 5e, white arrows) which frequently overlapped with GFRα3 immunostaining. Finally, GFRα3 also marks peri-insular and intra-islet Schwann cells (labeled by the calcium binding protein S100β) (Fig. 5f, white arrows). Altogether we found that GFRα3 is expressed in developing pancreatic neurons and persists in the adult where both the sympathetic and parasympathetic are labeled as well as glial cells.

GFRα3-deficient mice do not present any defect in islet cell development and glucose homeostasis

To decipher the role of Artn/GFRα3 pathway in the embryonic and adult pancreas, we studied GFRαa3-deficient mice (Honma et al. 2002). GFRα3tLacZ/tLacZ mice are viable and fertile and blood glucose analysis did not reveal overt diabetes in adult mice. As expected, GFRα3 immunostaining is lost in knock out mice (Supplementary Figure 4 compare a and b panels, see section on supplementary data given at the end of this article) confirming that signaling through this receptor is impaired. We could not detect any difference in Ngn3 expression pattern when comparing GFRα3tLacZtLac/Z and control WT fetal pancreas (Supplementary Figure 4a and b). Furthermore, quantification of Ngn3 cell number did not reveal any significant variation between these two genotypes (Fig. 6a). Thus, GFRα3 is not essential for the generation and/or maintenance of islet progenitor cells. Likewise, immunofluorescence analyses (Supplementary Figure 3c and d) and quantification of glucagon and insulin hormones areas (Fig. 6b) did not reveal any significant defect in α- or β-cell development suggesting that GFRα3 is not essential for α/β subtype specification or maintenance. To reveal any effect of the loss of GFRα3-signaling on gene expression, we performed Agilent microarrays on WT and GFRα3-deficient embryonic pancreas. We found that the expressions of only three genes were mildly affected by the absence of GFRα3 (see discussion): Nphp3 (FC=−1.43, t test=0.047); Pkd2l2 (FC=−1.89, t test=0.000378), and Pou3f2 (FC=1.56, Ttest=0.030803). Because the loss of GFRα3 could impair pancreatic innervation which has been shown to impact islet architecture and function (Borden et al. 2013), we next examined adult mice. GFRα3-deficient mice did not present any obvious defect in islet organization (Supplementary Figure 4i and j), with insulin-positive β-cells properly surrounded by glucagon-positive α-cells. Furthermore, both oral (Fig. 6d) and intraperitoneal (Fig. 6e) glucose tolerance tests were normal demonstrating that glucose clearance was not affected. Taken together, our loss of function studies demonstrate that GFRα3 signaling is not essential for endocrine cell differentiation, islet cells formation, and function.

Figure 6
Figure 6

Islet cell differentiation and function as well as endocrine innervation are not impacted in GFRα3-deficient mice. (a) Quantification of Ngn3 cell number (immunofluorescence) in WT and GFRα3tLacZ/tLacZ (named GKO) pancreas at E15.5. (b and c) Quantifications of insulin and glucagon areas (immunofluorescence) in pancreas from WT and GFRα3tLacZ/tLacZ embryos at E15.5 normalized to DAPI area at E15.5 (b) and P0 (c). In c, hormone area represents glucagon+insulin immune-positive areas. Black and white bars represent WT and GFRα3tLacZ/tLacZ pancreas in b. (d) Intraperitoneal and (e) oral glucose tolerance tests performed on WT (black line) and GFRα3tLacZ/tLacZ (dashed line) adult mice. (f) Quantification of the length of Tuj1+ neuron fibers normalized to hormones area (P0). (g) Quantification of sympathetic innervation expressed as TH+ area normalized to hormones (glucagon+insulin) area (P21). (h) Quantification of parasympathetic innervation expressed as the number of VIP+ puncta normalized to hormones (glucagon+insulin) area (P21). Data in b, c, f and g are in arbitrary units for quantifications, n=4 for each genotype. For glucose tolerance tests, n=6 for each genotype.

Citation: Journal of Molecular Endocrinology 56, 2; 10.1530/JME-15-0213

Islet innervation is normal in GFRα3-deficient mice

GFRα2 has been shown to be required for proper parasympathetic innervation of the endocrine pancreas (Rossi et al. 2005). Since GFRα3 is expressed in developing and adult pancreatic neurons (and glial cells) we assessed pancreatic innervation in GFRα3-deficient mice. We hypothesized that a mild islet innervation defect could eventually not impact IPGTT tests, a hypothesis supported by the observation that while vagal stimulation of insulin secretion is lost in GFRα2 KO mice, systemic glucose tolerance is normal (Rossi et al. 2005). Endocrine innervation matures postnatally (Burris & Hebrok 2007); we thus examined endocrine innervation at P0 and P21. Immunofluorescence experiments revealed the presence of TUJ1+ neuronal cells in GFRα3tLacZ/tLacZ mice at P0 (Supplementary Figure 4a and b). Careful quantification of TUJ1 fiber lengths (normalized to endocrine cells) at this stage did not reveal any significant variation (Fig. 6f), suggesting that GFRα3 is not essential for pancreas innervation during embryogenesis and at early postnatal stages. At P21, sympathetic neuronal cells were present in both islets and exocrine cells in GFRα3tLacZ/tLacZ mice (Supplementary Figure 4c and d) and quantification of intra-islet sympathetic fibers did not show any difference between control and mutant mice (Fig. 6g). The same conclusion was reached for the parasympathetic innervation (Fig. 6h and Supplementary Figure 5e, f, see section on supplementary data given at the end of this article). Finally, P21 GFRα3-deficient islets were properly surrounded by glial cells (Supplementary Figure 5g and h). Thus, GFRα3 is not required for islet cell innervation neither for the formation of glial cells.

Artn overexpression has no impact on islet cell development

We next thought to determine the consequences of Artn overexpression on islet cell development and generated a mouse model where Artn is expressed in pancreatic progenitors (Pdx1 promoter). Artn cDNA was thus cloned downstream of Pdx1 regulatory sequences and in fusion with the self-cleaving 2A peptide and mCherry fluorescent protein (to follow transgene expression) resulting into pPdx1-Artn-2A-mCherry construct or PAM (Fig. 7a). We expected that Artn will be secreted from pancreatic progenitors and signal to Ngn3- and hormone-positive endocrine cells which express GFRα3 receptor. One founder mouse expressed mCherry in the embryonic pancreas (Fig. 7b) in Pdx1-expressing cells as expected (Supplementary Figure 6a, see section on supplementary data given at the end of this article). Immunofluorescence experiments revealed that Artn was specifically expressed in E13.5 transgenic embryos following the mCherry pattern (Fig. 7c and d) while no Artn protein was detected in WT embryo (not shown). Careful examination of Artn immunostaining showed that Artn is located both in mCherry+ cells (Fig. 7d, e and f; red arrows) and in adjacent mCherry cells (Fig. 7d, e and f; green arrows). Interestingly in mCherry+ cells, Artn expression is found in the cytoplasm and at the plasma membrane, contrasting with the polarized and membranar signal of Artn observed in mCherry cells (Fig. 7d, e and f; green arrows). These results could suggest that Artn is properly produced by mCherry+ cells and secreted and binds to cells expressing the receptor explaining the polarized signal. Due to incompatibilities of Artn and GFRα3 antibodies, this hypothesis could not be tested.

Figure 7
Figure 7

Islet cell differentiation and function in transgenic mice overexpressing ARTN. (a) Schematic of the transgene construct (PAM) driving expression of Artn-2A-mCherry protein in Pdx1-expressing cells. 2A, self-clivable peptide. (b) Digestive tract from a E13.5 PAM transgenic embryo showing mCherry fluorescence in the pancreas (red arrows). (c and d) Immunostaining for Artn (green) and intrinsic mCherry fluorescence (in d) on cryosections of an E13.5 transgenic pancreas. (e and f) Higher magnification of inset in d. Red and green arrows point to mCherry+/Artn+ and mCherry/Artn+ cells respectively. (g) Quantification of the number of Ngn3-immuno-positive cells per pancreas on cryosections of WT and transgenic PAM embryos at E13.5. (h) Quantifications of insulin and glucagon immuno-positive areas on cryosections of WT and transgenic embryos at E13.5 normalized to total DAPI area. (i) IPGTT performed on WT (black curve) and PAM transgenic adult mice (red curve). For quantifications n=3–4 embryos for each genotype. For glucose metabolism, n≥4 for each genotype. Magnification of macroscopic picture is 20× in (b). sp, spleen; d, duodenum.

Citation: Journal of Molecular Endocrinology 56, 2; 10.1530/JME-15-0213

We next determined whether Artn overexpression had an impact on endocrine differentiation at E13.5. Transgenic mice displayed a normal pattern of Ngn3-positive cells (Supplementary Figure 6) and quantification did not reveal any variation of Ngn3 cell numbers in Artn-overexpressing embryos (Fig. 7g). Similarly, clusters of α-cells and more scattered β-cells were observed as expected at this developmental stage in controls as well as in PAM transgenic mice, and their number did not vary (Fig. 7h). Thus, at E13.5 we did not observe any obvious change in islet cell development in embryos overexpressing Artn. Due to the expression of Pdx1 in β-cells, the transgene was also found in adult islets (Supplementary Figure 6b). However, both islet organization (Supplementary Figure 6c) and glucose tolerance (Fig. 7i) were normal in adult transgenic mice. Similarly, Artn overexpression did not alter islet innervation (Supplementary Figure 6d, e and f). Taken together, these results demonstrate that Artn overexpression does not impact islet differentiation, organization, and function.

Discussion

We provide here the first description of the expression of the GDNF receptor family GFRα3 in the pancreas. We found that this receptor is expressed at the plasma membrane of endocrine progenitors and developing α- and β-cells in the embryo but only in α cells in adult islets. In addition, GFRα3 is found in embryonic and adult pancreatic neurons and glial cells. This expression pattern suggested a role of GFRα3 and its ligand Artn in the control of pancreatic islet and nervous system development or function. However, both loss and gain of function studies did not reveal any function in these processes suggesting functional redundancies of GDNF family of ligands and receptors. Importantly we provide evidence that GFRα3 can be used as a bio-marker for the immune-isolation of endocrine progenitor cells.

During pancreas development, we found that GFRα3 is expressed in a subset of Ngn3-expressing cells suggesting that some islet progenitors could receive and integrate Artn signaling. It is not clear however why only a subpopulation of Ngn3 cells expresses the receptor. Different scenarios can explain this pattern. Since GFRα3 is found in all developing islet cells we do not believe that GFRα3/Ngn3 double positive cells mark cells that have adopted a particular islet sub-type fate. We believe that GFRα3 is not expressed (or not at detectable levels) in nascent Ngn3-positive islet progenitors but only in more mature Ngn3 cells, which could be in agreement with the fact that the receptor persists in developing α- and β-cells. Thus this specific expression pattern of GFRa3 could reflect a role of Arnt/GFRa3 signaling in the maintenance/survival or maturation developing islet cells.

Our attempts to identify the source of Artn expressing cells in the embryonic and adult pancreas by various means failed, only quantitative RT-PCR revealed Artn expression in the pancreatic mesenchyme at E12.5 suggesting that Artn is expressed at very low levels in the pancreas. Interestingly Artn2 has also been described in mesenchymal cells in the vicinity of developing opercular muscle cells in zebrafish (Knight et al. 2011). Similarly Gdnf is expressed by mesenchymal cells of the gastrointestinal tract and by mesenchymal cells in the vicinity of the ureteric bud (Hellmich et al. 1996) but, in the embryonic pancreas, Gdnf is restricted to epithelial pancreatic progenitor cells (Munoz-Bravo et al. 2013). In other studies Artn as been described along blood vessels in endothelial smooth cells of the developing vasculature acting as a chemo attractant guidance factor for sympathetic fibers (Honma et al. 2002, Damon et al. 2007).

In mice, it has been shown that Artn/GFRα3 signaling is essential for sympathetic neurons migration and survival (Nishino et al. 1999, Honma et al. 2002). In zebrafish embryos, it has been reported that GFRα3 is required for myogenesis; loss of function results in reduced expression of myogenic factors including the b-hlh transcription factor MyoD (Knight et al. 2011). Our studies suggest that GFRα3 is dispensable for endocrine cell formation, survival, and function which is rather striking given the remarkable expression pattern of this receptor in the endocrine lineage during development and in α-cells in the adult islets. Thus, either GFRα3 has a non-essential function in these processes or another GFR can compensate for the lack of GFRα3. Importantly variable penetrance of the sympathetic phenotype in GFRa3 or Artn knock-out mice (Honma et al. 2002) indeed suggest functional redundancy among GFLs and GFRs. As we detected (Affymetrix data) low amounts of GFRα1 transcripts in the embryonic pancreas and that Artn can weakly crosstalk with GFRα1 (Saarma & Sariola 1999), we thought that this receptor could eventually compensate for the absence of GFRα3. Although GFRα1 immunostaining was clearly observed in developing pancreatic neurons at E15.5, we did not detect any expression of this receptor in the pancreatic epithelium at the same stage (data not shown). However, Munoz-Bravo et al. (2013) reported GFRα1 expression in multipotent progenitor TIP cells as well as in developing acinar cells. However, expression of GFRα1 in developing islet cells was not seen by us or reported by others. Therefore, we believe it is unlikely that GFRα1 compensates the loss of GFRα3, although we cannot completely exclude it. Similarly, we have no clear evidence that GFRα2 is expressed outside the neuronal lineage in the embryonic pancreas (data not shown) and thus unlikely replaces GFRα3, and finally, we could not detect any pancreatic expression of GFRα4. Interestingly ARTN, as well as GDNF and NRTN, are able to bind to other receptors, such as Syndecan-3 (Bespalov et al. 2011), but it is unknown whether this receptor is expressed in developing islet cells.

Our studies revealed that GFRα3 is expressed in pancreatic neurons and glial cells in the embryo and in the adult. Sensitive neurons were not investigated. Although both parasympathetic and sympathetic fibers express the receptor, parasympathetic and sympathetic islet innervation were not affected in GFRα3 KO mice, neither was glial cell differentiation or survival impaired. GFRα2 is expressed by glial cells as well as by parasympathetic nervous system in the pancreas and islet parasympathetic innervation is reduced severely in GFRα2-deficient mice (Rossi et al. 2003, 2005). Thus, GFRα2 could compensate GFRα3 deficiency in parasympathetic neurons but eventually also in glial cell where the role of GFRα2 in unknown. Whether GFRα1 is redundant with GFRα3 in sympathetic fibers remains to be studied.

We showed above that islet cell development in transgenic mice overexpressing Artn was unaltered at E13.5. It could be that endogenous Artn is sufficient or that Artn has no effect on endocrine cell differentiation or survival. Alternatively transgenic artemin is not bioactive, a hypothesis that we do not favor as in control experiments we verified that the artemin-2A-mRFP construct promoted neuroblast cell proliferation (data not shown). Of note, in similar experiment, it has been reported that transgenic mice overexpressing GDNF (which binds GFRα1) displayed a higher number of Ngn3 cells (Mwangi et al. 2010). We think, as supported by data from Munoz-Bravo et al. (2013), that this does not result from a direct trophic effect of GDNF on Ngn3 cells but rather from the proliferation of Pdx1-pancreatic progenitors from which Ngn3-cells derive (Gu et al. 2002). While the current study was on-going, Blum et al. (2014) published the results of a screen for factors that reverse β cell de-differentiation (loss of mature β-cell phenotype), a mechanism that might cause diabetes. Interestingly, they found that after induced islet dedifferentiation in vitro, a small molecule inhibitor of the TGF β receptor I, but also artemin, restored the expression of Urocortin 3 (Unc3), a marker of functionally mature β-cells. We did not notice any change in Unc3 protein expression neither in adult islets of GFRa3 KO mice nor in pPdx1-Artn-2A-mCherry transgenics suggesting that islet cells are mature in both models (data not shown). Whether transgenic mice overexpressing artemin are protected from induced β-cell de-differentiation or diabetes remains to be investigated.

Interestingly, two out of the three GFRα3 regulated genes we identified, Nphp3 and Pkd2l2 are coding for proteins related to cilia. Nphp3 whose mutations are associated with multiorgan polycystic disease encodes a protein located in cilia centrosome complex (Leeman et al. 2014). Recent findings suggest that Pkd2l2 is coding for calcium channels at primary cilia (DeCaen et al. 2013). Thus, Artn/GFRα3 could be involved in ciliogenesis or cilia based signaling. In conclusion, this study revealed a novel receptor expressed at the surface of developing islet cells as well as adult α-cells. However, the role of Artn/GFRα3 signaling in islet cell development and function remains elusive. Indeed, we could not elucidate the precise function of Artn/GFRα3 during islet cell development and there is thus no clear rational justifying to add Artn growth factor in hES cell differentiation protocols to improve the differentiation and functionality of the derived insulin-producing cells. Nevertheless, we could take advantage of the expression of GFRα3 at the surface of Ngn3-cells (provided this is the case in human as well) to FACS purify and study specific population of endocrine precursors cells as it has been shown for other receptors such as Ddr1, Disp2 (Hald et al. 2012) or CD133 (Prominin-1) and CD49f (or α6-integrin) (Sugiyama et al. 2007). The combination of such purification tools could be very useful to isolate bona fide endocrine precursors in a mixed cell population, a step that might promote the maturation, or increase the yield of hES derived β-cells in vitro.

Supplementary data

This is linked to the online version of the paper at http://dx.doi.org/10.1530/JME-15-0213.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This study was supported by the Beta Cell Biology Consortium through National Institutes of Health Grant U01DK089571 and the Fondation pour la Recherche Médicale. L N was a recipient of a fellowship from INSERM, the Région Alsace and from the Fondation pour la Recherche Médicale (file number FDT20130928131).

Acknowledgements

We thank Dr Enomoto and Dr Milbrandt for the generous gift of Artn and GFRα3 KO mice. We thank the Mouse Clinical Institute (Illkirch, France) for the generation of PAM transgenic mice and the members of IGBMC imaging platform and animal facility for their great help and advices, members of the lab for their support and scientific discussions. We thank D A Cano and A Grapin-Botton for helpful discussion.

References

  • Ahren B 2000 Autonomic regulation of islet hormone secretion – implications for health and disease. Diabetologia 43 393410. (doi:10.1007/s001250051322).

    • Search Google Scholar
    • Export Citation
  • Airaksinen MS & Saarma M 2002 The GDNF family: signalling, biological functions and therapeutic value. Nature Reviews. Neuroscience 3 383394. (doi:10.1038/nrn812).

    • Search Google Scholar
    • Export Citation
  • Bespalov MM, Sidorova YA, Tumova S, Ahonen-Bishopp A, Magalhaes AC, Kulesskiy E, Paveliev M, Rivera C, Rauvala H & Saarma M 2011 Heparan sulfate proteoglycan syndecan-3 is a novel receptor for GDNF, neurturin, and artemin. Journal of Cell Biology 192 153169. (doi:10.1083/jcb.201009136).

    • Search Google Scholar
    • Export Citation
  • Blum B, Roose AN, Barrandon O, Maehr R, Arvanites AC, Davidow LS, Davis JC, Peterson QP, Rubin LL & Melton DA 2014 Reversal of β cell de-differentiation by a small molecule inhibitor of the TGFβ pathway. eLife 3 e02809. (doi:10.7554/eLife.02809.001).

    • Search Google Scholar
    • Export Citation
  • Borden P, Houtz J, Leach SD & Kuruvilla R 2013 Sympathetic innervation during development is necessary for pancreatic islet architecture and functional maturation. Cell Reports 4 287301. (doi:10.1016/j.celrep.2013.06.019).

    • Search Google Scholar
    • Export Citation
  • Burris RE & Hebrok M 2007 Pancreatic innervation in mouse development and β-cell regeneration. Neuroscience 150 592602. (doi:10.1016/j.neuroscience.2007.09.079).

    • Search Google Scholar
    • Export Citation
  • Cano DA, Soria B, Martin F & Rojas A 2013 Transcriptional control of mammalian pancreas organogenesis. Cellular and Molecular Life Sciences 71 23832402. (doi:10.1007/s00018-013-1510-2).

    • Search Google Scholar
    • Export Citation
  • Costantini F & Shakya R 2006 GDNF/Ret signaling and the development of the kidney. BioEssays 28 117127. (doi:10.1002/bies.20357).

  • Damon DH, Teriele JA & Marko SB 2007 Vascular-derived artemin: a determinant of vascular sympathetic innervation? American Journal of Physiology. Heart and Circulatory Physiology 293 H266H273. (doi:10.1152/ajpheart.00859.2006).

    • Search Google Scholar
    • Export Citation
  • DeCaen PG, Delling M, Vien TN & Clapham DE 2013 Direct recording and molecular identification of the calcium channel of primary cilia. Nature 504 315318. (doi:10.1038/nature12832).

    • Search Google Scholar
    • Export Citation
  • Desgraz R & Herrera PL 2009 Pancreatic neurogenin 3-expressing cells are unipotent islet precursors. Development 136 35673574. (doi:10.1242/dev.039214).

    • Search Google Scholar
    • Export Citation
  • Gradwohl G, Dierich A, LeMeur M & Guillemot F 2000 Neurogenin3 is required for the development of the four endocrine cell lineages of the pancreas. PNAS 97 16071611. (doi:10.1073/pnas.97.4.1607).

    • Search Google Scholar
    • Export Citation
  • Gu G, Dubauskaite J & Melton DA 2002 Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors. Development 129 24472457.

    • Search Google Scholar
    • Export Citation
  • Hald J, Galbo T, Rescan C, Radzikowski L, Sprinkel AE, Heimberg H, Ahnfelt-Ronne J, Jensen J, Scharfmann R & Gradwohl G 2012 Pancreatic islet and progenitor cell surface markers with cell sorting potential. Diabetologia 55 154165. (doi:10.1007/s00125-011-2295-1).

    • Search Google Scholar
    • Export Citation
  • Hellmich HL, Kos L, Cho ES, Mahon KA & Zimmer A 1996 Embryonic expression of glial cell-line derived neurotrophic factor (GDNF) suggests multiple developmental roles in neural differentiation and epithelial-mesenchymal interactions. Mechanisms of Development 54 95105. (doi:10.1016/0925-4773(95)00464-5).

    • Search Google Scholar
    • Export Citation
  • Henseleit KD, Nelson SB, Kuhlbrodt K, Hennings JC, Ericson J & Sander M 2005 NKX6 transcription factor activity is required for α- and β-cell development in the pancreas. Development 132 31393149. (doi:10.1242/dev.01875).

    • Search Google Scholar
    • Export Citation
  • Hofmann MC 2008 Gdnf signaling pathways within the mammalian spermatogonial stem cell niche. Molecular and Cellular Endocrinology 288 95103. (doi:10.1016/j.mce.2008.04.012).

    • Search Google Scholar
    • Export Citation
  • Honma Y, Araki T, Gianino S, Bruce A, Heuckeroth R, Johnson E & Milbrandt J 2002 Artemin is a vascular-derived neurotropic factor for developing sympathetic neurons. Neuron 35 267282. (doi:10.1016/S0896-6273(02)00774-2).

    • Search Google Scholar
    • Export Citation
  • Johansson KA, Dursun U, Jordan N, Gu G, Beermann F, Gradwohl G & Grapin-Botton A 2007 Temporal control of neurogenin3 activity in pancreas progenitors reveals competence windows for the generation of different endocrine cell types. Developmental Cell 12 457465. (doi:10.1016/j.devcel.2007.02.010).

    • Search Google Scholar
    • Export Citation
  • Knight RD, Mebus K, d'Angelo A, Yokoya K, Heanue T, Tubingen Screen C & Roehl H 2011 Ret signalling integrates a craniofacial muscle module during development. Development 138 20152024. (doi:10.1242/dev.061002).

    • Search Google Scholar
    • Export Citation
  • Leeman KT, Dobson L, Towne M, Dukhovny D, Joshi M, Stoler J & Agrawal PB 2014 NPHP3 mutations are associated with neonatal onset multiorgan polycystic disease in two siblings. Journal of Perinatology 34 410411. (doi:10.1038/jp.2014.20).

    • Search Google Scholar
    • Export Citation
  • Lodh S, O'Hare EA & Zaghloul NA 2014 Primary cilia in pancreatic development and disease. Birth Defects Research. Part C, Embryo Today: Reviews 102 139158. (doi:10.1002/bdrc.21063).

    • Search Google Scholar
    • Export Citation
  • Mastracci TL & Sussel L 2012 The endocrine pancreas: insights into development, differentiation and diabetes. Wiley Interdisciplinary Reviews. Membrane Transport and Signaling 1 609628. (doi:10.1002/wdev.44).

    • Search Google Scholar
    • Export Citation
  • Mellitzer G, Martin M, Sidhoum-Jenny M, Orvain C, Barths J, Seymour PA, Sander M & Gradwohl G 2004 Pancreatic islet progenitor cells in neurogenin 3-yellow fluorescent protein knock-add-on mice. Molecular Endocrinology 18 27652776. (doi:10.1210/me.2004-0243).

    • Search Google Scholar
    • Export Citation
  • Munoz-Bravo JL, Hidalgo-Figueroa M, Pascual A, Lopez-Barneo J, Leal-Cerro A & Cano DA 2013 GDNF is required for neural colonization of the pancreas. Development 140 36693679. (doi:10.1242/dev.091256).

    • Search Google Scholar
    • Export Citation
  • Mwangi SM, Usta Y, Raja SM, Anitha M, Chandrasekharan B, Parsadanian A, Sitaraman SV & Srinivasan S 2010 Glial cell line-derived neurotrophic factor enhances neurogenin3 gene expression and beta-cell proliferation in the developing mouse pancreas. AJP: Gastrointestinal and Liver Physiology 299 G283G292. (doi:10.1152/ajpgi.00096.2010).

    • Search Google Scholar
    • Export Citation
  • Nishino J, Mochida K, Ohfuji Y, Shimazaki T, Meno C, Ohishi S, Matsuda Y, Fujii H, Saijoh Y & Hamada H 1999 GFR α3, a component of the artemin receptor, is required for migration and survival of the superior cervical ganglion. Neuron 23 725736. (doi:10.1016/S0896-6273(01)80031-3).

    • Search Google Scholar
    • Export Citation
  • Rossi J, Herzig KH, Voikar V, Hiltunen PH, Segerstrale M & Airaksinen MS 2003 Alimentary tract innervation deficits and dysfunction in mice lacking GDNF family receptor alpha2. Journal of Clinical Investigation 112 707716. (doi:10.1172/JCI17995).

    • Search Google Scholar
    • Export Citation
  • Rossi J, Santamaki P, Airaksinen MS & Herzig KH 2005 Parasympathetic innervation and function of endocrine pancreas requires the glial cell line-derived factor family receptor alpha 2 (GFRα2). Diabetes 54 13241330. (doi:10.2337/diabetes.54.5.1324).

    • Search Google Scholar
    • Export Citation
  • Saarma M & Sariola H 1999 Other neurotrophic factors: glial cell line-derived neurotrophic factor (GDNF). Microscopy Research and Technique 45 292302. (doi:10.1002/(SICI)1097-0029(19990515/01)45:4/5<292::AID-JEMT13>3.0.CO;2-8).

    • Search Google Scholar
    • Export Citation
  • Soyer J, Flasse L, Raffelsberger W, Beucher A, Orvain C, Peers B, Ravassard P, Vermot J, Voz ML & Mellitzer G 2010 Rfx6 is an Ngn3-dependent winged helix transcription factor required for pancreatic islet cell development. Development 137 203212. (doi:10.1242/dev.041673).

    • Search Google Scholar
    • Export Citation
  • Sugiyama T, Rodriguez RT, McLean GW & Kim SK 2007 Conserved markers of fetal pancreatic epithelium permit prospective isolation of islet progenitor cells by FACS. PNAS 104 175180. (doi:10.1073/pnas.0609490104).

    • Search Google Scholar
    • Export Citation
*

(J Herrmann and D E Martin contributed equally to this work)

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 809 106 8
PDF Downloads 389 134 7
  • View in gallery

    GFRα3 receptor is expressed in a subset of endocrine progenitors. (a, b, c and d) RT-qPCR on purified EYFP+ and EYFP cells from E15.5 Ngn3eYFP/+ pancreas showing that (a) GFRα3 expression is enriched in EYFP+ cells and (b) Artn is significantly enriched in the EYFP cell population. (c) GFRα2 expression is enriched in the EYFP cell population while (d) Gdnf is strongly expressed in EYFP+ cells. (e) In situ hybridization for GFRα3 (blue) and immunostaining for NGN3 (brown) on cryosections of WT E15.5 pancreas showing expression of GFRα3 in some islet progenitor cells (dark arrows). (f) Immunostaining for GFRα3 (red) and NGN3 (green) on cryosections of WT E15.5 pancreas showing that some Ngn3-positive cells express GFRα3 at the cell membrane (yellow arrows). Data are summarized as mean±s.e.m.; n≥4 for each conditions; **P≤0.01, ***P≤0.001. In f yellow, green and red arrows point to GFRα3+/NGN3+; NGN3+/GFRα3 and NGN3/GFRα3+ cells respectively. In e, dark, blue and brow arrows point to GFRα3+/NGN3+, GFRα3+/NGN3, GFRα3/NGN3+ respectively.

  • View in gallery

    GFRα3 receptor is expressed in insulin- and glucagon-positive cells in the embryo and at birth but in adult islets, only α-cells are GFRα3-positive. (a, b, c, d, e and f) Immunofluorescence on cryosections of E15.5 embryonic (a and b), newborn (c and d) or adult pancreas (e and f) for GFRα3 (red) insulin (green) and glucagon (green) expressing cells. (c and d) At P0, GFRα3 (red) expression decreases in (c) insulin+ cells (green) and (d) is maintained in glucagon+ cells (green). (e and f) In the adult pancreas, GFRα3(red) is (e) not expressed by insulin+ cells (green) but (f) glucagon+ cells (green) express the receptor. White arrows point to hormone+/GFRα3+ cells and red arrows point to GFRα3+/hormone cells.

  • View in gallery

    GFRα3 is expressed in developing and newborn but not adult somatostatin- and PP-cells. (a, b, c, d, e and f) Immunolocalisations on cryosections of WT pancreas for GFRα3 (red) and Somatostatin (SST, green, a, b and c), or Pancreatic Polypeptide (PP, green, d, e and f) at E15.5, P0 and in the adult mice. In the embryo at E15.5 and in newborn mice (P0) GFRα3 is expressed by Somatostatin+ cells and PP+ cells but not in the adult pancreas. White arrows point to hormone+/Gfrα3+ cells, red arrows point to the same double positive cells on picture where the green layer has been removed for a better appreciation of GFRα3 staining.

  • View in gallery

    Expression of GFRs and GFLs in embryonic pancreatic epithelial or mesenchymal cells. RT-qPCR on E12.5 pancreatic epithelium and mesenchyme revealed significant enrichments of Pdx1 (control), Ret, GFRα3, and Gdnf in the epithelium and of GFRα2 and Artn in mesenchyme. GFRα1 and Pspn are expressed at the same level both in the epithelium and the mesenchyme. Data are summarized as mean±s.e.m.; n≥10 for each tissue; *P≤0.05, **P≤0.01, ***P≤0.001.

  • View in gallery

    Localization of GFRα3 in developing and adult neuronal and glial cells. (a, b, c, d, e and f) Immunofluorescence on pancreatic cryosections at E15.5 (a), and at adult stage (b, c, d, e and f) for GFRα3 (red), neuron-specific class III beta tubulin Tuj1 (Tuj1, green), tyrosine hydroxylase (TH, green), vasoactive intestinal peptide (VIP, green), and calcium binding protein S100β (S100β, green). GFRα3 is expressed by neuronal cells (Tuj1+, green) in the embryonic pancreas. (b, c, d, e and f) In the adult pancreas, GFRα3 (red) is expressed by sympathetic neuronal cells (TH+, green) in both endocrine (b) and acinar (c) tissues, as well as by parasympathetic neuronal cells (VIP+, green) in both endocrine (d) and acinar (e) tissues, and by glial (f) cells (S100β+, green). White arrows point to neuronal cells expressing GFRα3+/neurons+ or Glial+ cells. Islets (i) are delimited by dashed lines. *cluster of developing islet cells. a, acinar tissue; v, blood vessel; i, islet. Nuclei are labeled with DAPI (blue). White arrows point to double labeled cells.

  • View in gallery

    Islet cell differentiation and function as well as endocrine innervation are not impacted in GFRα3-deficient mice. (a) Quantification of Ngn3 cell number (immunofluorescence) in WT and GFRα3tLacZ/tLacZ (named GKO) pancreas at E15.5. (b and c) Quantifications of insulin and glucagon areas (immunofluorescence) in pancreas from WT and GFRα3tLacZ/tLacZ embryos at E15.5 normalized to DAPI area at E15.5 (b) and P0 (c). In c, hormone area represents glucagon+insulin immune-positive areas. Black and white bars represent WT and GFRα3tLacZ/tLacZ pancreas in b. (d) Intraperitoneal and (e) oral glucose tolerance tests performed on WT (black line) and GFRα3tLacZ/tLacZ (dashed line) adult mice. (f) Quantification of the length of Tuj1+ neuron fibers normalized to hormones area (P0). (g) Quantification of sympathetic innervation expressed as TH+ area normalized to hormones (glucagon+insulin) area (P21). (h) Quantification of parasympathetic innervation expressed as the number of VIP+ puncta normalized to hormones (glucagon+insulin) area (P21). Data in b, c, f and g are in arbitrary units for quantifications, n=4 for each genotype. For glucose tolerance tests, n=6 for each genotype.

  • View in gallery

    Islet cell differentiation and function in transgenic mice overexpressing ARTN. (a) Schematic of the transgene construct (PAM) driving expression of Artn-2A-mCherry protein in Pdx1-expressing cells. 2A, self-clivable peptide. (b) Digestive tract from a E13.5 PAM transgenic embryo showing mCherry fluorescence in the pancreas (red arrows). (c and d) Immunostaining for Artn (green) and intrinsic mCherry fluorescence (in d) on cryosections of an E13.5 transgenic pancreas. (e and f) Higher magnification of inset in d. Red and green arrows point to mCherry+/Artn+ and mCherry/Artn+ cells respectively. (g) Quantification of the number of Ngn3-immuno-positive cells per pancreas on cryosections of WT and transgenic PAM embryos at E13.5. (h) Quantifications of insulin and glucagon immuno-positive areas on cryosections of WT and transgenic embryos at E13.5 normalized to total DAPI area. (i) IPGTT performed on WT (black curve) and PAM transgenic adult mice (red curve). For quantifications n=3–4 embryos for each genotype. For glucose metabolism, n≥4 for each genotype. Magnification of macroscopic picture is 20× in (b). sp, spleen; d, duodenum.