Erythropoietin regulates POMC expression via STAT3 and potentiates leptin response

in Journal of Molecular Endocrinology

The arcuate nucleus of the hypothalamus is essential for metabolic homeostasis and responds to leptin by producing several neuropeptides including proopiomelanocortin (POMC). We previously reported that high-dose erythropoietin (Epo) treatment in mice while increasing hematocrit reduced body weight, fat mass, and food intake and increased energy expenditure. Moreover, we showed that mice with Epo receptor (EpoR) restricted to erythroid cells (ΔEpoRE) became obese and exhibited decreased energy expenditure. Epo/EpoR signaling was found to promote hypothalamus POMC expression independently from leptin. Herein we used WT and ΔEpoRE mice and hypothalamus-derived neural culture system to study the signaling pathways activated by Epo in POMC neurons. We show that Epo stimulation activated STAT3 signaling and upregulated POMC expression in WT neural cultures. ΔEpoRE mice hypothalamus showed reduced POMC levels and lower STAT3 phosphorylation, with and without leptin treatment, compared to in vivo and ex vivo WT controls. Collectively, these data show that Epo regulates hypothalamus POMC expression via STAT3 activation, and provide a previously unrecognized link between Epo and leptin response.

Abstract

The arcuate nucleus of the hypothalamus is essential for metabolic homeostasis and responds to leptin by producing several neuropeptides including proopiomelanocortin (POMC). We previously reported that high-dose erythropoietin (Epo) treatment in mice while increasing hematocrit reduced body weight, fat mass, and food intake and increased energy expenditure. Moreover, we showed that mice with Epo receptor (EpoR) restricted to erythroid cells (ΔEpoRE) became obese and exhibited decreased energy expenditure. Epo/EpoR signaling was found to promote hypothalamus POMC expression independently from leptin. Herein we used WT and ΔEpoRE mice and hypothalamus-derived neural culture system to study the signaling pathways activated by Epo in POMC neurons. We show that Epo stimulation activated STAT3 signaling and upregulated POMC expression in WT neural cultures. ΔEpoRE mice hypothalamus showed reduced POMC levels and lower STAT3 phosphorylation, with and without leptin treatment, compared to in vivo and ex vivo WT controls. Collectively, these data show that Epo regulates hypothalamus POMC expression via STAT3 activation, and provide a previously unrecognized link between Epo and leptin response.

Introduction

The hematopoietic cytokine erythropoietin (Epo), the primary regulator of erythrocyte production, is mainly produced in the kidneys in a hypoxia-dependent manner. Epo receptor (EpoR) expression is highest in erythroid progenitors, and its deletion in mice (EpoR−/−) is embryonic lethal due to severe anemia (Wu et al. 1995). In addition, EpoR signaling in non-hematopoietic cells has pleiotropic effects beyond erythropoiesis (Noguchi et al. 2008, Alnaeeli et al. 2012). In the brain, Epo has been associated with neurogenesis, neuroprotection, neural progenitor cell (NPC) migration, and memory retrieval (Shingo et al. 2001, Tsai et al. 2006, Wang et al. 2006, Chen et al. 2007, Miskowiak et al. 2007, Wang et al. 2008, Mengozzi et al. 2012). Epo treatment in mice increases hematocrit and can also increase energy expenditure, reduce blood glucose levels, and reduce appetite and body fat mass (Hojman et al. 2009, Katz et al. 2010, Foskett et al. 2011, Teng et al. 2011). Expression of an erythroid tissue-specific EpoR transgene rescued the embryonic lethal phenotype in EpoR/− mice (Suzuki et al. 2002). This mouse model has EpoR expression restricted to erythroid tissue (ΔEpoRE) (Suzuki et al. 2002). Previously, we reported that ΔEpoRE mice exhibit increased body weight from the first postnatal week, show decreased energy expenditure, and develop metabolic syndromes with age via effects on white adipose tissue and hypothalamus (Teng et al. 2011).

The hypothalamus is a major central neuroendocrine regulation center involved in the control of energy homeostasis via orexigenic agouti-related peptide (AgRP)/neuropeptideY (NPY)-producing neurons and anorexigenic proopiomelanocortin (POMC)-producing neurons (Bouyer & Simerly 2013). Ablation of POMC neurons and loss of POMC-derived transmitters lead to obesity (Yaswen et al. 1999), further underscoring the importance of POMC neurons in regulation of energy homeostasis. Considering our reported findings that show high EpoR expression in hypothalamus, regulation of appetite and energy expenditure by exogenous Epo treatment in mice, and POMC induction in response to Epo treatment (Foskett et al. 2011, Teng et al. 2011), here we examine the regulation of hypothalamus POMC neuron function/response to Epo/EpoR signaling.

Leptin, a hormone secreted by adipose tissue into the circulation, binds its long-form receptor (LepRb) in the arcuate nucleus of the hypothalamus and activates signal transducer and activator of transcription 3 (STAT3), which positively regulates POMC expression (Bates et al. 2003). The largest population of LepRb-expressing neurons is in the hypothalamus (Zuure et al. 2013). Mice lacking leptin, LepRb, or STAT3 genes become obese with a concomitant decrease in POMC expression (Gao et al. 2004, Diano et al. 2011, Harlan et al. 2011). Conversely, leptin treatment in mice reduced food intake and increased oxygen consumption (Coppari et al. 2005). Interestingly, Epo and leptin are both members of the hematopoietic cytokine superfamily and have similar protein structure (Ouyang & He 2003, Fruhbeck 2006), receptor structure (Constantinescu et al. 2001, Mancour et al. 2012), and signaling mechanism (Banks et al. 2000, Zhang et al. 2014), and stimulate anorexic response after administration (Balthasar et al. 2004, Teng et al. 2011). Therefore, here we investigate potential links between Epo and leptin action, regulation of hypothalamus POMC neuron function/response to Epo/EpoR signaling, and potential cross talk between Epo and leptin signaling in POMC neurons.

Materials and methods

Animal studies

ΔEpoRE mice were generated using the TgEpoR transgene consisting of EpoR cDNA driven by the GATA-1 locus erythroid regulatory domain (Suzuki et al. 2002) bred onto an EpoR null (EpoR−/−) background. This rescues the EpoR−/− phenotype from severe anemia and death in utero (Suzuki et al. 2002). These ΔEpoRE mice can survive through adulthood and their hematocrits are normal. The ΔEpoRE mice are on of C57BL/6 background and age-matched C57BL/6 WT mice were used as controls. For Epo treatment (3000 U/kg body weight; Epoetin alpha, Amgen, Thousand Oaks, CA, USA), the mice received s.c. injections three times at 0930 h per week. For leptin treatment (5 mg/kg body weight; Peprotech, Rocky Hill, NJ, USA), mice received i.p. injection twice daily (0930 h and 1730 h) for three consecutive days. Mice were housed in individual cages for body weight and food intake studies, kept on 12 h light/darkness cycle, and fed normal chow diet. Studies were conducted following National Institutes of Health guidelines under institution-approved animal protocol.

NPC cultures

Embryos at 15.5 days (E15.5) were harvested from pregnant mice. The developing hypothalamus and cortex were dissected and transferred separately to serum-free media containing DMEM (with l-glutamine)/F12 (1:1) (Invitrogen) supplemented with B27 (Invitrogen), EGF (PeproTech, 20ng/ml), FGF-2 (PeproTech, 20 ng/ml), and 0.5 units/ml Pen-Strep (Invitrogen). Hypothalamus and cortex tissues were mechanically dissociated into single-cell suspension with a pipette. Cultures were also established from hypothalamus of newborn WT and ΔEpoRE pups. Cell viability was assessed using trypan blue exclusion. Dissociated cells were cultured as an adherent monolayer and seeded on tissue culture plates pre-coated with 15 μg/ml poly-l-ornithine (PLO) (Sigma) and 1 μg/ml laminin (Sigma) with a seeding density of 1×105 cells/cm2. After 7 days, cells reached around 90% confluency and were passaged at 1:4 to new plates and designated as passage 1. Expansion cultures were passaged every 5 days regularly from first passage onward at 1:4 ratio and recorded as passage 2 through passage 10.

Quantitative RT-PCR

Total RNA was extracted using RNeasy kit (Qiagen) and reverse transcribed using Molony Murine Leukemia virus (MuLV) reverse transcriptase and the reagents from GeneAmp RNA PCR (Applied Biosystems). The SYBR green-I (Life Technologies)-based relative quantitative real-time PCR was performed on a 7900HT Thermocycler (Applied Biosystems). All primers were designed to span exon junctions in order to prevent the amplification of contaminating genomic DNA and β-Actin mRNA expression was used as a reference. The primer sequences are as follows: mEpoR-forward, ACGCTTGGAAGACTTGGTGTG; mEpoR-reverse, TGTTGGCAGTGAACACCAGAA; POMC-forward, TTTCCTGGCAACGGAGATGA; POMC-reverse, CCACCGTAACGCTTGTCCTT; NPY-forward, TCGTGTGTTTGGGCATTCTG; NPY-reverse, TCTGGTGATGAGATTGATGTAGTG; AgRP-forward, TGACTGCAATGTTGCTGAGTTGTG; AgRP-reverse, CTAGGTGCGACTACAGAGGTTCG; β-Actin-forward, CAACGGCTCCGGCATGTGCAAAG, β-Actin-reverse, GGTGTGATGGTGGGAATGGGTCAG; nestin-forward, AGAGATTGGAAGGCCGCTGG; nestin-reverse, CACCTTCCAGGATCTGAGCGA; β-tubulin-forward, GGGCCAAGTTCTGGGAGGTCATC; β-tubulin-reverse, GCACATACTTGTGAGAGGAGGCC.

Western blotting

For western blot analysis, NPC cultures were treated with Epo for 30 min to detect phosphorylated-STAT3 (p-STAT3), phosphorylated-JAK2 (p-JAK2), and phosphorylated-Akt (p-Akt) and for 24 h to detect POMC expression. Cells were lysed in RIPA buffer and protein was resolved on the basis of size in an NuPAGE electrophoresis system (Life Technologies). The primary antibodies used were anti-p-STAT3-Tyr705 (9131), anti-STAT3 (4904), anti-p-JAK2-Tyr1007 (4406), anti-JAK2 (3230), anti-β-Actin (4967) (from Cell Signaling, Danvers, MA, USA), anti-POMC (ab14064), and anti-GAPDH (ab9485) (from Abcam). All antibodies were used at 1:1000 dilution. Either β-Actin or GAPDH protein expression was used to confirm equal protein loading between lanes.

Immunofluorescence analysis

After overnight fasting, mice were treated either with leptin, Epo, or saline at 0930 h. After 90 min, animals were anesthetized with isoflurane and perfused with ice-cold PBS via the heart and then fixed with 100 ml of 4% paraformaldehyde (PFA) solution (Sigma). Brain was removed, post-fixed overnight in 4% PFA, followed by overnight cryoprotection in 30% sucrose, and cut in 10-μm coronal sections, collected in five series. Immunostaining was done on serial sections with α-MSH antibody (20074, Immunostar, Hudson, WI, USA) at 1:4000 dilution and counterstained with DAPI for nuclear staining. Alexa Fluor 488-conjugated goat anti-rabbit IgG (Abcam) was used as a secondary antibody. The saline-treated group served as a negative control and tested antibody specificity. For staining NPC cultures, passage 3 cells were grown in cover slips coated with PLO and laminin as described above for NPC culture, and fixed with 4% PFA for 20 min. Due to variability in commercial lots of EpoR polyclonal antibody, we used the MAB developed at Genetics Institute against the EpoR extracellular domain (mh2er.16.5.1) that previously provided consistent results for immunohistochemistry and has been characterized for specificity (D'Andrea et al. 1993, Anagnostou et al. 1994, Teng et al. 2011). Anti-EpoR antibody was used at 1:25 dilution. Passage 1 NPC cells were also used as a negative control for EpoR staining. To detect POMC expression, cells were stained using POMC antibody (H-029-30, Phoenix Pharmaceuticals, Burlingame, CA, USA) at 1:1000 dilution. For fluorescent detection of POMC and EpoR, Alexa488-conjugated goat anti-rabbit IgG and Alexa594-conjugated goat anti-mouse IgG respectively (Abcam) were used.

Statistical analysis

Differences among groups were analyzed by ANOVA with post-hoc comparison by Student's t test for continuous variables and χ2 or Fisher's exact test for nominal variables, as appropriate, followed by Bonferroni correction for multiple comparisons. All results are reported as mean±s.d. from at least three independent experiments. In all cases, P<0.05 was considered to be statistically significant.

Results

Primary hypothalamus NPC cultures express POMC and EpoR

We previously reported that EpoR protein in mouse hypothalamus localizes to POMC-expressing neurons, and Epo directly regulates POMC expression in these neurons (Teng et al. 2011). To study Epo/EpoR-mediated regulation of POMC in mouse hypothalamus, we established NPC cultures from E15.5 mouse hypothalamus. For comparison, primary NPCs derived from E15.5 hippocampus and cortex were used because these brain regions also express EpoR (Yu et al. 2002, Chen et al. 2007). POMC expression in the respective cultures, determined by quantitative RT-PCR, revealed that POMC mRNA was mainly expressed in hypothalamus-derived NPC cultures and ten times higher than levels detected in cultures derived from cortex or hippocampus (Fig. 1A). In contrast, EpoR mRNA expression was readily detected in NPC cultures from each of these three regions with expression highest in the hippocampus. The levels in the hypothalamus were one-half to one-third the levels in the hippocampus or cortex (Fig. 1B).

Figure 1
Figure 1

Gene expression in primary neural progenitor cell (NPC) cultures from WT hypothalamus. (A and B) POMC (A) and EpoR (B) mRNA levels in NPCs derived from embryonic day E15.5 cortex (cor), hippocampus (hip), and hypothalamus (hyp) from WT mice as measured by quantitative real-time (RT) PCR and normalized to β-Actin mRNA levels. (C, D, E and F) Quantification of nestin (C), β-tubulin (D), POMC (E), and EpoR (F) mRNA levels in hypothalamus NPC culture at passages 1, 3, and 10 relative to β-Actin mRNA levels as determined by RT-PCR. Reactions were run in triplicate and results are representative of three independent experiments (G) western blotting for POMC (top panel) and β-Actin (middle panel) protein expression, and quantitative densitometry analysis (lower panel) at passages 1, 3, 5, and 8 of hypothalamus NPC cultures are shown. Densitometry data is representative of three independent experiments. Statistical significance is indicated by *P<0.05, **P<0.01, and ***P<0.001 (one-way ANOVA followed by Bonferroni correction). (H) Double fluorescent immunostaining for POMC (green) and EpoR (red) on hypothalamus NPC cultures at passage 3 and stained with DAPI staining (blue) for nuclei and merged for triple stained image. Scale bar represents 100 μm.

Citation: Journal of Molecular Endocrinology 56, 2; 10.1530/JME-15-0171

NPC cultures as an adherent monolayer are prone to density-dependent differentiation. Adherent NPC cultures were passaged when confluence was >90% to promote density-dependent differentiation. With increasing passage, nestin mRNA expression decreased by more than an order of magnitude (Fig. 1C) while β-tubulin mRNA expression increased between passage 1 and passage 3 (Fig. 1D), indicating a shift from NPCs to immature neurons concomitant with an increase in POMC and EpoR mRNA expression (Fig. 1E and F). POMC protein production examined by western blotting increased between passage 1 and passage 3, was maximal between passages 3 and 5, and then decreased by passage 8 (Fig. 1G). These data suggest that the increase in POMC expression and protein production in these cultures correlates with a shift in nestin-expressing NPCs toward β-tubulin- and POMC-expressing immature neurons with a maximal shift occurring between passages 3 and 5. At passage 10, EpoR mRNA continued to be expressed, but β-tubulin and POMC mRNA levels declined (Fig. 1D and E). Immunostaining of passage 3 cells also showed colocalization of POMC and EpoR protein expression and the presence of cells that did not stain for either, suggesting EpoR expression is specific for POMC neurons in this population of cells (Fig. 1H). These POMC- and EpoR-expressing cells comprised ∼50% of total cell population in culture at this stage. Moreover, there were no cells that expressed EpoR only, and not POMC. Immunostaining of passage 1 cells with anti-POMC and anti-EpoR antibodies served as negative controls and confirmed the specificity of these antibodies. The apparent patterns of cytoplasmic anti-EpoR staining in POMC neurons may relate to the processing and trafficking of EpoR and the reported observations that only a minor fraction of the Golgi-processed receptor is on the cell surface and a few high affinity Epo surface binding receptors in neuronal cells are sufficient for Epo-activated cell signaling (Hilton et al. 1995, Um et al. 2007). In all subsequent experiments, cells from passages 3 to 5 which showed optimum POMC and EpoR expression were used. In cortex-derived NPC cultures, the low level of POMC expression did not increase with time in passage indicating that cortex-derived NPCs did not exhibit the ability to self-differentiate into POMC-expressing neurons (data not shown).

Epo increases POMC expression in hypothalamus NPC cultures via JAK2/STAT3 pathway

Epo treatment of hypothalamus NPC cultures increased POMC mRNA expression in a dose-dependent manner as determined by quantitative RT-PCR (Fig. 2A). Similar increase in POMC protein expression was also observed as determined by western blotting (Fig. 2B). In addition to regulating POMC, Epo treatment increased JAK2- and STAT3-phosphorylation in NPC cultures (Fig. 2C). Pre-treatment with STAT3 inhibitor WP1066 (3 μM) for 30 min was sufficient to abrogate Epo induction of POMC (Fig. 2D). While β-tubulin expression did not change with Epo treatment, there was a modest decrease (10% or less) in β-tubulin with WP1066 treatment with and without Epo (Fig. 2F). These results suggest that STAT3 phosphorylation is required for Epo induction of POMC and that inhibition of STAT3 phosphorylation by WP1066 decreases POMC expression by reducing the amount of POMC expression with minimal change in β-tubulin and the proportion of cells with the potential to express POMC. Epo treatment of hypothalamus NPC cultures at 10 and 20 U/ml also resulted in a small but significant increase in cell number in a dose-dependent manner at both 32 h and 48 h of treatment (Fig. 2F).

Figure 2
Figure 2

Epo treatment induces proliferation, POMC expression, and JAK2 and STAT3 signaling in WT hypothalamus NPC culture. (A and B) Dose-dependent increase in POMC mRNA levels relative to untreated cells and adjusted to β-Actin mRNA levels (A), and POMC protein normalized to β-Actin after 24 h of Epo-treatment (B) were determined. Densitometry data is representative of three independent experiments. (C) Western blotting for phosphorylated-JAK2 (p-JAK2), total JAK2 (t-JAK2), phosphorylated-STAT3 (p-STAT3), total STAT3 (t-STAT3), and β-Actin protein in control- and Epo-treated (20 U/ml) NPC cultures, and quantitative densitometry analysis of band intensity ratio of p-STAT3 and t-STAT3 are shown. Densitometry data is representative of three independent experiments. (D and E) Level of POMC (D) and β-tubulin (E) mRNA as measured by RT-PCR analysis of NPCs after saline treatment (Cont), Epo treatment, Epo with STAT3 inhibitor WP1066 and WP1066 only. The mRNA expression levels are relative to saline-treated (Cont) cells and adjusted to β-Actin mRNA levels, and represents mean±s.d. from triplicate reactions. (F) Proliferation of NPC cultures after 32 h and 48 h of Epo treatment at 0-, 10-, and 20-U/ml doses. Relative cell numbers are representative of triplicate treatments for each dose. Statistical significance is indicated by *P<0.05 and **P<0.01 (one-way ANOVA followed by Bonferroni correction).

Citation: Journal of Molecular Endocrinology 56, 2; 10.1530/JME-15-0171

Loss of EpoR signaling in hypothalamus NPC cultures affects their leptin response

We previously reported that leptin is not required for the effects of exogenous Epo treatment on body weight and fat mass loss (Teng et al. 2011). However, Epo signaling in NPC is mediated via STAT3 pathway (Fig. 2), which is also activated in the arcuate nucleus after leptin treatment. Whether Epo/EpoR signaling affects leptin response in hypothalamus was unknown. To investigate this question, hypothalamus-derived NPC cultures were generated from neonate WT and ΔEpoRE mice. With leptin and Epo treatment, WT cultures showed an increase in STAT3 phosphorylation (Fig. 3A). In contrast, NPC cultures from ΔEpoRE mice did not show the increase in STAT3 phosphorylations expected with Epo treatment (Fig. 3A). Interestingly, ΔEpoRE hypothalamus cultures also did not exhibit the expected increase in STAT3 phosphorylation with leptin treatment (Fig. 3A). Of note, baseline levels of STAT3 phosphorylation were lower in ΔEpoRE hypothalamus NPC cultures compared to those from WT hypothalamus (comparing saline treatment lanes, Fig. 3A). Moreover, Epo and leptin combination treatments were not more effective than Epo or leptin treatment alone in inducing STAT3 phosphorylation (Fig. 3A). Consistent with STAT3 activation, 24 h treatment with either leptin or Epo increased POMC mRNA expression in WT hypothalamus cultures by two- to 2.5-fold, with combination treatment no better than individual treatment conditions (Fig. 3B). In ΔEpoRE hypothalamus cultures, baseline POMC mRNA expression appeared to be fourfold lower than WT cultures, but was induced approximately twofold by leptin or the combination of leptin plus Epo treatment, but not by Epo alone (Fig. 3B). Note that even with leptin treatment, POMC expression in ΔEpoRE cultures was only half the level of control-treated WT cultures (Fig. 3B), and no significant induction in STAT3 phosphorylation was detected (Fig. 3A). Conversely, NPY and AgRP mRNA expression did not show any difference between WT and ΔEpoRE hypothalamus NPC cultures, and was reduced similarly by leptin treatment only (Fig. 3C and D). Combination treatment or Epo alone did not affect either NPY or AgRP mRNA expression (Fig. 3C and D). These data support the previous finding that EpoR expression is specific for POMC neurons (Teng et al. 2011) and lack of EpoR neither affect NPY and AgRP expression nor its response after leptin treatment. These observations collectively point to an important and previously unrecognized role for EpoR signaling to contribute to leptin response in hypothalamus NPC ex vivo. Interestingly, LepRb mRNA levels showed a small but significant reduction in ΔEpoRE cultures compared to the WT (Fig. 3E), but cell proliferation during the NPC culture is not affected by loss of EpoR (Fig. 3F).

Figure 3
Figure 3

EpoR signaling is required for optimum leptin response in NPC cultures. (A) Western blotting and quantitative densitometry analysis were used to determine levels of phosphorylated-STAT3, total-STAT3, and β-Actin protein levels (A), in WT and ΔEpoRE NPC cultures after control saline treatment, Epo treatment, Epo+leptin treatment, and leptin treatment. Epo and leptin was used at 20 U/ml and 1000 U/ml respectively and densitometry analysis is representative of three independent experiments (B, C and D) POMC (B), NPY (C), and AgRP (D) mRNA expression in WT and ΔEpoRE NPC cultures were determined after Epo, Epo+leptin, and leptin treatments, relative to control saline-treated WT cells. (E) LepRb mRNA expression in WT and ΔEpoRE NPC cultures. Gene expressions were adjusted to β-Actin mRNA levels and RT-PCR reactions were run in triplicate. (F) Fold change in numbers of NPC from WT and ΔEpoRE E15.5 embryos. P0 represents cell proliferation from day 1 to day 7 of culture, and P1–P5 represents passages 1–5 after every 5 days. Fold change is representative of three independent experiments. Statistical significance is indicated by *P<0.05, **P<0.01 and ***P<0.001 (one-way ANOVA followed by Bonferroni correction).

Citation: Journal of Molecular Endocrinology 56, 2; 10.1530/JME-15-0171

Absence of hypothalamus EpoR signaling reduces in vivo STAT3 phosphorylation and POMC production, blunts leptin-induced STAT3 activation but not the leptin-induced relative increase of POMC

Ex vivo hypothalamus NPC cultures provided evidence for Epo-stimulated STAT3-activation (Figs 2 and 3). Loss of endogenous Epo activity in ΔEpoRE hypothalamus should also reduce STAT3 phosphorylation in vivo. ΔEpoRE mice show age-dependent obesity, and at 8 months are 30% or greater in body mass vs WT due to increased fat mass with a corresponding increase in circulating leptin levels (Teng et al. 2011). To avoid this apparent obesity related increase in leptin level and the expected change in STAT3 phosphorylation related to increased leptin signaling, we examined hypothalamus STAT3 phosphorylation in young mice prior to development of fat tissue. At postnatal day 2–3, STAT3 phosphorylation in the hypothalamus of ΔEpoRE mice was reduced by threefold compared with WT mice while levels of total STAT3 were comparable (Fig. 4A). The difference in STAT3 phosphorylation was also evident in ΔEpoRE mice at postnatal day 4–5 (Fig. 4B).

Figure 4
Figure 4

ΔEpoRE mice show blunted STAT3 activation but equivalent POMC induction in the hypothalamus after leptin treatment compared to WT mice. (A and B) Western blotting and quantitative densitometry analysis (from three pups each of WT and ΔEpoRE) were used to compare phosphorylated-STAT3 (p-STAT3), total-STAT3 (t-STAT3), and GAPDH protein levels in WT and ΔEpoRE pups at postnatal day 2–3 (A) and postnatal day 4–5 (B). (C and D) Western blotting and quantitative densitometry analysis demonstrating phosphorylated-STAT3 (p-STAT3) and total-STAT3 (t-STAT3) (C), POMC and GAPDH (D) in a 3-week-old female WT and ΔEpoRE mice 45 min after treated with leptin (5 mg/kg body weight) or saline (n=3 for each treatment group). (E and F) Body weight (E), and food intake (F) were determined in WT and ΔEpoRE mice after saline- or leptin-treatment twice daily for 3 days (n=4 for each treatment group). Statistical significance is indicated by *P<0.05, and **P<0.01 (one-way ANOVA followed by Bonferroni correction).

Citation: Journal of Molecular Endocrinology 56, 2; 10.1530/JME-15-0171

Regulation of body weight involves a balance between energy intake and energy expenditure. Leptin has the ability to decrease food intake, increase energy expenditure and promote body weight loss. We investigated whether the changed energy balance of ΔEpoRE mice involved alterations in leptin-mediated signaling in the hypothalamus (Fig. 4C and F). Three-week old mice were used to eliminate possible leptin resistance associated with older, obese ΔEpoRE mice, and also to ensure complete development of neurons of the arcuate nucleus. ΔEpoRE hypothalamus showed a lower level of STAT3 phosphorylation compared to WT hypothalamus (Fig. 4C). However, the difference is reduced compared with mice at postnatal days 2–3 (Fig. 4A) and days 4–5 old (Fig. 4B). This suggests that ΔEpoRE mice by 3 weeks develop a compensatory mechanism that restores STAT3 phosphorylation closer to normal WT levels. In contrast to ex vivo ΔEpoRE hypothalamus cultures that show no leptin-induced STAT3 phosphorylation (Fig. 3A), ΔEpoRE mice exhibited a blunted in vivo leptin-induced STAT3 phosphorylation in hypothalamus compared with WT mice (Fig. 4C). This suggests that, in vivo, other mechanisms attempt to compensate for the apparent loss of direct leptin induction of STAT3 phosphorylation in hypothalamus NPC derived cells.

In vivo, baseline POMC protein levels were lower in ΔEpoRE mice, analogous to the reduced POMC mRNA in ΔEpoRE hypothalamus cultures (Fig. 3B), and leptin could induce POMC expression only up to baseline WT levels (Fig. 4D). These data suggest that in vivo leptin response in ΔEpoRE hypothalamus is blunted with respect to STAT3 phosphorylation, and the reduction in baseline STAT3 activation results in a lower level of POMC in ΔEpoRE mice, compared with WT mice without and with leptin treatment. Leptin induction of POMC in both WT and ΔEpoRE mice was also reflected in a small but significant decrease in body weight after leptin treatment in WT mice (6%) and in an apparent smaller decrease in ΔEpoRE mice (2.5%) (Fig. 4E). Food intake for 3 days was significantly lower in leptin-treated WT mice, and also showed a reduced trend in ΔEpoRE mice (Fig. 4F). In summary, these data suggest that loss of EpoR in young mice reduces baseline hypothalamus STAT3 activation and lowers POMC expression in the hypothalamus. Moreover, leptin sensitivity with respect to body weight loss and reduced food intake are still evident in ΔEpoRE mice.

Finally, immunohistochemical staining of brain sections displaying the arcuate nucleus region of the hypothalamus also showed lower staining for α-MSH, a cleavage product of POMC, in ΔEpoRE mice compared to WT mice (Fig. 5A and B). Both Epo and leptin treatment of WT mice induced α-MSH expression (Fig. 5C and E). As expected, the ΔEpoRE mice brain sections showed higher immunoreactivity to α-MSH only after leptin treatment and not Epo treatment (Fig. 5D and F).

Figure 5
Figure 5

Induction of α-MSH, a POMC product, in the arcuate nucleus region of the mouse brain after either saline, Epo, or leptin treatment. Representative fluorescence photomicrographs for α-MSH immunoreactivity in brain sections prepared from the mouse mediobasal hypothalamus consisting of the arcuate nucleus region are shown. Three-week old female WT (A, C and E) or ΔEpoRE (B, D and F) mice were treated with either saline (A and B), Epo (3000 U/kg body weight) (C and D), or Leptin (5 mg/kg body weight) (E and F). Scale bar represents 100 μm. 3V, third ventricle; ARC, arcuate nucleus; ME, median eminence.

Citation: Journal of Molecular Endocrinology 56, 2; 10.1530/JME-15-0171

Discussion

EpoR is expressed in the POMC neurons of the hypothalamus, a master regulatory site of appetite and energy expenditure, and the increased POMC expression in Epo-treated WT mice suggested that Epo could directly stimulate these POMC neurons (Teng et al. 2011), although the detailed mechanism of POMC neuron response to Epo was uncertain. We previously showed that Epo treatment in WT mice decreases body weight and fat mass by reducing food intake and increasing energy expenditure (Foskett et al. 2011, Teng et al. 2011). While EpoR is expressed in several brain regions including hypothalamus, hippocampus and cortex, NPC cultures from the hypothalamus show unique induction of POMC expression with Epo treatment. Using hypothalamus-derived NPC cultures, we studied the signaling pathways activated by Epo in POMC neurons and investigated the crosstalk between LepRb and EpoR signaling.

Epo and leptin are both members of the class-I cytokine superfamily (Ouyang & He 2003, Fruhbeck 2006) and act through the JAK/STAT signaling pathway (Constantinescu et al. 2001, Mancour et al. 2012). Leptin stimulation of POMC expression in the hypothalamus is mediated via STAT3 activation (Bates et al. 2003) and we found that Epo-stimulated increase of POMC is also dependent on STAT3 activation. The requirement for EpoR for normal hypothalamus response is further confirmed by analysis of hypothalamus from ΔEpoRE mice with EpoR expression restricted to erythroid tissue. Neonatal ΔEpoRE mice show reduced STAT3 phosphorylation and lower level of POMC expression in the hypothalamus compared with WT mice. In addition, corresponding hypothalamus NPC cultures from ΔEpoRE mice lack activation of STAT3 or induction of POMC with Epo treatment. Evidence that loss of EpoR may blunt the leptin response is further suggested by ex vivo findings from ΔEpoRE hypothalamus cultures that also exhibit loss of leptin-induced increase in STAT3 phosphorylation. These data provide evidence that endogenous Epo signaling in WT hypothalamus contributes to STAT3 phosphorylation while loss of Epo signaling reduces endogenous baseline level of STAT3 activation and POMC production. The reduction in endogenous STAT3 activity in ΔEpoRE mice is consistent with the severe obese phenotype observed in mice with neural-specific disruption of STAT3 that underscore its importance in the CNS in regulating energy homeostasis (Gao et al. 2004). Interestingly, with leptin treatment in the ΔEpoRE mice, induction of STAT3 phosphorylation in the hypothalamus is reduced to half that in treated WT mice. While the low level of POMC expression in ΔEpoRE hypothalamus is increased with leptin treatment and fold induction of POMC in ΔEpoRE and WT hypothalamus are similar, the level of POMC remains 50% or less than treated WT hypothalamus. The lack of leptin induced STAT3 activation observed in ΔEpoRE hypothalamus cultures suggests that other Epo-independent signaling pathways compensate in part to provide leptin induced POMC expression in ΔEpoRE hypothalamus. Epo influence on leptin-responsive weight loss is also suggested by the lower percentage weight decrease in ΔEpoRE mice.

The finding that leptin requires functional EpoR for normal levels of STAT3 activation and POMC induction in hypothalamus provides an explanation for the low POMC levels in hypothalamus of ΔEpoRE mice despite elevated circulating leptin levels and for the resultant altered energy homeostasis (Teng et al. 2011), and suggests disruption of critical leptin regulation of energy efficiency in the hypothalamus. However, a combination of Epo/leptin treatment did not induce higher POMC expression, which raises the possibility that Epo may prime POMC neurons in the hypothalamus for subsequent leptin action, and the kinetics of treatment is critical to see a combined Epo/leptin effect on POMC expression. Although lack of EpoR does not affect NPC proliferation in culture, LepRb expression is modestly reduced in ΔEpoRE NPC cultures. This raises the possibility that EpoR signaling is required for the complete maturation of POMC neurons without affecting its numbers.

These data suggest that direct response by the hypothalamus to Epo treatment contributes, in part, to regulation of body weight and fat mass via STAT3 activation and POMC induction. The ΔEpoRE mice provide further evidence that increased metabolic load of Epo-stimulated erythropoiesis cannot explain the body weight reduction after Epo treatment in WT mice. Specifically, ΔEpoRE mice treated with Epo exhibit the expected increase in hematocrit, but without the significant reduction in body mass observed in WT mice (Teng et al. 2011). Finally, transgene-driven expressions of EpoR in ΔEpoRE mice hematopoietic cells and spleen are comparable to endogenous EpoR levels and also ΔEpoRE mice do not show any difference in hematocrit levels (Suzuki et al. 2002, Teng et al. 2011).

Leptin receptor is distributed in the arcuate nucleus and other regions of the hypothalamus and in extra-hypothalamic autonomic control sites as well as cortex and hippocampus (Caron et al. 2010), indicating that leptin response associated with energy balance involves multiple regions of the brain. EpoR is also expressed in various sites in the brain, such as cortex and hippocampus that are also linked to food intake (Morton et al. 2006, Volkow et al. 2011), raising the possibility that Epo activity in the brain beyond POMC neurons may modulate metabolic activity. Although AgRP/NPY neurons in the arcuate nucleus of the hypothalamus also contribute to leptin regulation of POMC, EpoR expression was not detected in AgRP/NPY neurons (Teng et al. 2011). Moreover, we did not see any difference in AgRP and NPY expression between WT and ΔEpoRE hypothalamus NPC cultures, and NPY expression was reduced after leptin treatment only. This also suggests that the effect we see in ΔEpoRE mice is specifically due to Epo-mediated regulation of POMC neurons and not due to secondary effects on AgRP and NPY neurons.

Similar to acute leptin administration (Hill et al. 2008), exogenous Epo treatment in WT mice also results in a reduction in food intake and body weight, and an increase in physical activity with activation of POMC neurons (Teng et al. 2011). The uncoupling of food intake and energy expenditure has been observed in POMC neurons, and selective deletion of leptin receptor in POMC neurons fails to affect food intake (Balthasar et al. 2004). It has been argued that neural control over feeding behavior has several layers of redundancy (Schwartz et al. 2003). It should be noted that although the knockout of anorexigenic neuropeptide-expressing POMC gene causes increased food intake (Yaswen et al. 1999), the knockout of orexigenic NPY gene does not affect daily food intake (Erickson et al. 1996). In this regard, we observed that the ΔEpoRE mice that show a 50% reduction in POMC expression in the hypothalamus develop obesity, with reduced physical activity, but no detectable increase in food intake (Teng et al. 2011).

Endogenous Epo is present in brain and cerebral spinal fluid (Chavez et al. 2006), in addition to the adult kidney, Epo can be produced in an oxygen-dependent manner by astrocytes and neurons (Chavez et al. 2006) and provide a local source for Epo production to stimulate the EpoR-expressing neural cells in the hypothalamus. Interestingly, hypothalamic astrocytes have also been suggested to influence metabolic status and obesity (Fuente-Martin et al. 2012). High fat diet feeding in mice results in inflammatory response and increase in pro-inflammatory markers in astrocytes, together with a decrease in POMC neurons in the arcuate nucleus (Thaler et al. 2012).

Overall, in this study we identified a previously unknown mechanism of EpoR-dependent regulation of POMC expression via STAT3 activation and LepRb signaling in the hypothalamus. We further explored the molecular links underlying the contribution of loss of EpoR in non-hematopoietic tissue to the obese phenotype in ΔEpoRE mice. Our study also identified the importance of endogenous Epo signaling in regulation of energy homeostasis.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This research was supported by the Intramural Research Program of the National Institute of Diabetes and Digestive and Kidney Diseases, NIH, Bethesda, USA.

Author contribution statement

S D and X L designed and performed experiments; S D wrote the paper; R T, M A, Z C, H R, contributed by technical assistance, advice, and manuscript revision; C T N developed the concept, supervised the study, and wrote the paper.

References

  • AlnaeeliMWangLPiknovaBRogersHLiXNoguchiCT2012Erythropoietin in brain development and beyond. Anatomy Research International2012953264. (doi:10.1155/2012/953264).

    • Search Google Scholar
    • Export Citation
  • AnagnostouALiuZSteinerMChinKLeeESKessimianNNoguchiCT1994Erythropoietin receptor mRNA expression in human endothelial cells. PNAS9139743978. (doi:10.1073/pnas.91.9.3974).

    • Search Google Scholar
    • Export Citation
  • BalthasarNCoppariRMcMinnJLiuSMLeeCETangVKennyCDMcGovernRAChuaSCJrElmquistJK2004Leptin receptor signaling in POMC neurons is required for normal body weight homeostasis. Neuron42983991. (doi:10.1016/j.neuron.2004.06.004).

    • Search Google Scholar
    • Export Citation
  • BanksASDavisSMBatesSHMyersMGJr2000Activation of downstream signals by the long form of the leptin receptor. Journal of Biological Chemistry2751456314572. (doi:10.1074/jbc.275.19.14563).

    • Search Google Scholar
    • Export Citation
  • BatesSHStearnsWHDundonTASchubertMTsoAWWangYBanksASLaveryHJHaqAKMaratos-FlierE2003STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature421856859. (doi:10.1038/nature01388).

    • Search Google Scholar
    • Export Citation
  • BouyerKSimerlyRB2013Neonatal leptin exposure specifies innervation of presympathetic hypothalamic neurons and improves the metabolic status of leptin-deficient mice. Journal of Neuroscience33840851. (doi:10.1523/JNEUROSCI.3215-12.2013).

    • Search Google Scholar
    • Export Citation
  • CaronESachotCPrevotVBouretSG2010Distribution of leptin-sensitive cells in the postnatal and adult mouse brain. Journal of Comparative Neurology518459476. (doi:10.1002/cne.22219).

    • Search Google Scholar
    • Export Citation
  • ChavezJCBaranovaOLinJPichiuleP2006The transcriptional activator hypoxia inducible factor 2 (HIF-2/EPAS-1) regulates the oxygen-dependent expression of erythropoietin in cortical astrocytes. Journal of Neuroscience2694719481. (doi:10.1523/JNEUROSCI.2838-06.2006).

    • Search Google Scholar
    • Export Citation
  • ChenZYAsavaritikraiPPrchalJTNoguchiCT2007Endogenous erythropoietin signaling is required for normal neural progenitor cell proliferation. Journal of Biological Chemistry2822587525883. (doi:10.1074/jbc.M701988200).

    • Search Google Scholar
    • Export Citation
  • ConstantinescuSNKerenTSocolovskyMNamHHenisYILodishHF2001Ligand-independent oligomerization of cell-surface erythropoietin receptor is mediated by the transmembrane domain. PNAS9843794384. (doi:10.1073/pnas.081069198).

    • Search Google Scholar
    • Export Citation
  • CoppariRIchinoseMLeeCEPullenAEKennyCDMcGovernRATangVLiuSMLudwigTChuaSCJr2005The hypothalamic arcuate nucleus: a key site for mediating leptin's effects on glucose homeostasis and locomotor activity. Cell Metabolism16372. (doi:10.1016/j.cmet.2004.12.004).

    • Search Google Scholar
    • Export Citation
  • D'AndreaADRupBJFisherMJJonesS1993Anti-erythropoietin receptor (EPO-R) monoclonal antibodies inhibit erythropoietin binding and neutralize bioactivity. Blood824652.

    • Search Google Scholar
    • Export Citation
  • DianoSLiuZWJeongJKDietrichMORuanHBKimESuyamaSKellyKGyengesiEArbiserJL2011Peroxisome proliferation-associated control of reactive oxygen species sets melanocortin tone and feeding in diet-induced obesity. Nature Medicine1711211127. (doi:10.1038/nm.2421).

    • Search Google Scholar
    • Export Citation
  • EricksonJCCleggKEPalmiterRD1996Sensitivity to leptin and susceptibility to seizures of mice lacking neuropeptide Y. Nature381415421. (doi:10.1038/381415a0).

    • Search Google Scholar
    • Export Citation
  • FoskettAAlnaeeliMWangLTengRNoguchiCT2011The effects of erythropoietin dose titration during high-fat diet-induced obesity. Journal of Biomedicine & Biotechnology2011373781. (doi:10.1155/2011/373781).

    • Search Google Scholar
    • Export Citation
  • FruhbeckG2006Intracellular signalling pathways activated by leptin. Biochemical Journal393720. (doi:10.1042/BJ20051578).

  • Fuente-MartinEGarcia-CaceresCGranadoMde CeballosMLSanchez-GarridoMASarmanBLiuZWDietrichMOTena-SempereMArgente-ArizonP2012Leptin regulates glutamate and glucose transporters in hypothalamic astrocytes. Journal of Clinical Investigation12239003913. (doi:10.1172/JCI64102).

    • Search Google Scholar
    • Export Citation
  • GaoQWolfgangMJNeschenSMorinoKHorvathTLShulmanGIFuXY2004Disruption of neural signal transducer and activator of transcription 3 causes obesity, diabetes, infertility, and thermal dysregulation. PNAS10146614666. (doi:10.1073/pnas.0303992101).

    • Search Google Scholar
    • Export Citation
  • HarlanSMMorganDAAgassandianKGuoDFCassellMDSigmundCDMarkALRahmouniK2011Ablation of the leptin receptor in the hypothalamic arcuate nucleus abrogates leptin-induced sympathetic activation. Circulation Research108808812. (doi:10.1161/CIRCRESAHA.111.240226).

    • Search Google Scholar
    • Export Citation
  • HillJWWilliamsKWYeCLuoJBalthasarNCoppariRCowleyMACantleyLCLowellBBElmquistJK2008Acute effects of leptin require PI3K signaling in hypothalamic proopiomelanocortin neurons in mice. Journal of Clinical Investigation11817961805. (doi:10.1172/JCI32964).

    • Search Google Scholar
    • Export Citation
  • HiltonDJWatowichSSMurrayPJLodishHF1995Increased cell surface expression and enhanced folding in the endoplasmic reticulum of a mutant erythropoietin receptor. PNAS92190194. (doi:10.1073/pnas.92.1.190).

    • Search Google Scholar
    • Export Citation
  • HojmanPBrolinCGisselHBrandtCZerahnBPedersenBKGehlJ2009Erythropoietin over-expression protects against diet-induced obesity in mice through increased fat oxidation in muscles. PLoS ONE4e5894. (doi:10.1371/journal.pone.0005894).

    • Search Google Scholar
    • Export Citation
  • KatzOStuibleMGolishevskiNLifshitzLTremblayMLGassmannMMittelmanMNeumannD2010Erythropoietin treatment leads to reduced blood glucose levels and body mass: insights from murine models. Journal of Endocrinology2058795. (doi:10.1677/JOE-09-0425).

    • Search Google Scholar
    • Export Citation
  • MancourLVDaghestaniHNDuttaSWestfieldGHSchillingJOleskieANHerbstmanJFChouSZSkiniotisG2012Ligand-induced architecture of the leptin receptor signaling complex. Molecular Cell48655661. (doi:10.1016/j.molcel.2012.09.003).

    • Search Google Scholar
    • Export Citation
  • MengozziMCervelliniIVillaPErbayraktarZGokmenNYilmazOErbayraktarSManohasandraMVan HummelenPVandenabeeleP2012Erythropoietin-induced changes in brain gene expression reveal induction of synaptic plasticity genes in experimental stroke. PNAS10996179622. (doi:10.1073/pnas.1200554109).

    • Search Google Scholar
    • Export Citation
  • MiskowiakKO'SullivanUHarmerCJ2007Erythropoietin enhances hippocampal response during memory retrieval in humans. Journal of Neuroscience2727882792. (doi:10.1523/JNEUROSCI.5013-06.2007).

    • Search Google Scholar
    • Export Citation
  • MortonGJCummingsDEBaskinDGBarshGSSchwartzMW2006Central nervous system control of food intake and body weight. Nature443289295. (doi:10.1038/nature05026).

    • Search Google Scholar
    • Export Citation
  • NoguchiCTWangLRogersHMTengRJiaY2008Survival and proliferative roles of erythropoietin beyond the erythroid lineage. Expert Reviews in Molecular Medicine10e36. (doi:10.1017/S1462399408000860).

    • Search Google Scholar
    • Export Citation
  • OuyangSHeF2003Phylogeny of a growth hormone-like cytokine superfamily based upon 3D structure. Journal of Molecular Evolution56131136. (doi:10.1007/s00239-002-2385-2).

    • Search Google Scholar
    • Export Citation
  • SchwartzMWWoodsSCSeeleyRJBarshGSBaskinDGLeibelRL2003Is the energy homeostasis system inherently biased toward weight gain?Diabetes52232238. (doi:10.2337/diabetes.52.2.232).

    • Search Google Scholar
    • Export Citation
  • ShingoTSorokanSTShimazakiTWeissS2001Erythropoietin regulates the in vitro and in vivo production of neuronal progenitors by mammalian forebrain neural stem cells. Journal of Neuroscience2197339743.

    • Search Google Scholar
    • Export Citation
  • SuzukiNOhnedaOTakahashiSHiguchiMMukaiHYNakahataTImagawaSYamamotoM2002Erythroid-specific expression of the erythropoietin receptor rescued its null mutant mice from lethality. Blood10022792288. (doi:10.1182/blood-2002-01-0124).

    • Search Google Scholar
    • Export Citation
  • TengRGavrilovaOSuzukiNChanturiyaTSchimelDHugendublerLMammenSYverDRCushmanSWMuellerE2011Disrupted erythropoietin signalling promotes obesity and alters hypothalamus proopiomelanocortin production. Nature Communications2520. (doi:10.1038/ncomms1526).

    • Search Google Scholar
    • Export Citation
  • ThalerJPYiCXSchurEAGuyenetSJHwangBHDietrichMOZhaoXSarrufDAIzgurVMaravillaKR2012Obesity is associated with hypothalamic injury in rodents and humans. Journal of Clinical Investigation122153162. (doi:10.1172/JCI59660).

    • Search Google Scholar
    • Export Citation
  • TsaiPTOhabJJKerteszNGroszerMMatterCGaoJLiuXWuHCarmichaelST2006A critical role of erythropoietin receptor in neurogenesis and post-stroke recovery. Journal of Neuroscience2612691274. (doi:10.1523/JNEUROSCI.4480-05.2006).

    • Search Google Scholar
    • Export Citation
  • UmMGrossAWLodishHF2007A "classical" homodimeric erythropoietin receptor is essential for the antiapoptotic effects of erythropoietin on differentiated neuroblastoma SH-SY5Y and pheochromocytoma PC-12 cells. Cellular Signalling19634645. (doi:10.1016/j.cellsig.2006.08.014).

    • Search Google Scholar
    • Export Citation
  • VolkowNDWangGJBalerRD2011Reward, dopamine and the control of food intake: implications for obesity. Trends in Cognitive Sciences153746. (doi:10.1016/j.tics.2010.11.001).

    • Search Google Scholar
    • Export Citation
  • WangLZhangZGZhangRLGreggSRHozeska-SolgotALeTourneauYWangYChoppM2006Matrix metalloproteinase 2 (MMP2) and MMP9 secreted by erythropoietin-activated endothelial cells promote neural progenitor cell migration. Journal of Neuroscience2659966003. (doi:10.1523/JNEUROSCI.5380-05.2006).

    • Search Google Scholar
    • Export Citation
  • WangLChoppMGreggSRZhangRLTengHJiangAFengYZhangZG2008Neural progenitor cells treated with EPO induce angiogenesis through the production of VEGF. Journal of Cerebral Blood Flow and Metabolism2813611368. (doi:10.1038/jcbfm.2008.32).

    • Search Google Scholar
    • Export Citation
  • WuHLiuXJaenischRLodishHF1995Generation of committed erythroid BFU-E and CFU-E progenitors does not require erythropoietin or the erythropoietin receptor. Cell835967. (doi:10.1016/0092-8674(95)90234-1).

    • Search Google Scholar
    • Export Citation
  • YaswenLDiehlNBrennanMBHochgeschwenderU1999Obesity in the mouse model of pro-opiomelanocortin deficiency responds to peripheral melanocortin. Nature Medicine510661070. (doi:10.1038/12506).

    • Search Google Scholar
    • Export Citation
  • YuXShackaJJEellsJBSuarez-QuianCPrzygodzkiRMBeleslin-CokicBLinCSNikodemVMHempsteadBFlandersKC2002Erythropoietin receptor signalling is required for normal brain development. Development129505516.

    • Search Google Scholar
    • Export Citation
  • ZhangYWangLDeySAlnaeeliMSureshSRogersHTengRNoguchiCT2014Erythropoietin action in stress response, tissue maintenance and metabolism. International Journal of Molecular Sciences151029610333. (doi:10.3390/ijms150610296).

    • Search Google Scholar
    • Export Citation
  • ZuureWARobertsALQuennellJHAndersonGM2013Leptin signaling in GABA neurons, but not glutamate neurons, is required for reproductive function. Journal of Neuroscience331787417883. (doi:10.1523/JNEUROSCI.2278-13.2013).

    • Search Google Scholar
    • Export Citation
*

(S Dey and X Li contributed equally to this work)

X Li is now at Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing 100191, China

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 567 161 9
PDF Downloads 148 83 10
  • View in gallery

    Gene expression in primary neural progenitor cell (NPC) cultures from WT hypothalamus. (A and B) POMC (A) and EpoR (B) mRNA levels in NPCs derived from embryonic day E15.5 cortex (cor), hippocampus (hip), and hypothalamus (hyp) from WT mice as measured by quantitative real-time (RT) PCR and normalized to β-Actin mRNA levels. (C, D, E and F) Quantification of nestin (C), β-tubulin (D), POMC (E), and EpoR (F) mRNA levels in hypothalamus NPC culture at passages 1, 3, and 10 relative to β-Actin mRNA levels as determined by RT-PCR. Reactions were run in triplicate and results are representative of three independent experiments (G) western blotting for POMC (top panel) and β-Actin (middle panel) protein expression, and quantitative densitometry analysis (lower panel) at passages 1, 3, 5, and 8 of hypothalamus NPC cultures are shown. Densitometry data is representative of three independent experiments. Statistical significance is indicated by *P<0.05, **P<0.01, and ***P<0.001 (one-way ANOVA followed by Bonferroni correction). (H) Double fluorescent immunostaining for POMC (green) and EpoR (red) on hypothalamus NPC cultures at passage 3 and stained with DAPI staining (blue) for nuclei and merged for triple stained image. Scale bar represents 100 μm.

  • View in gallery

    Epo treatment induces proliferation, POMC expression, and JAK2 and STAT3 signaling in WT hypothalamus NPC culture. (A and B) Dose-dependent increase in POMC mRNA levels relative to untreated cells and adjusted to β-Actin mRNA levels (A), and POMC protein normalized to β-Actin after 24 h of Epo-treatment (B) were determined. Densitometry data is representative of three independent experiments. (C) Western blotting for phosphorylated-JAK2 (p-JAK2), total JAK2 (t-JAK2), phosphorylated-STAT3 (p-STAT3), total STAT3 (t-STAT3), and β-Actin protein in control- and Epo-treated (20 U/ml) NPC cultures, and quantitative densitometry analysis of band intensity ratio of p-STAT3 and t-STAT3 are shown. Densitometry data is representative of three independent experiments. (D and E) Level of POMC (D) and β-tubulin (E) mRNA as measured by RT-PCR analysis of NPCs after saline treatment (Cont), Epo treatment, Epo with STAT3 inhibitor WP1066 and WP1066 only. The mRNA expression levels are relative to saline-treated (Cont) cells and adjusted to β-Actin mRNA levels, and represents mean±s.d. from triplicate reactions. (F) Proliferation of NPC cultures after 32 h and 48 h of Epo treatment at 0-, 10-, and 20-U/ml doses. Relative cell numbers are representative of triplicate treatments for each dose. Statistical significance is indicated by *P<0.05 and **P<0.01 (one-way ANOVA followed by Bonferroni correction).

  • View in gallery

    EpoR signaling is required for optimum leptin response in NPC cultures. (A) Western blotting and quantitative densitometry analysis were used to determine levels of phosphorylated-STAT3, total-STAT3, and β-Actin protein levels (A), in WT and ΔEpoRE NPC cultures after control saline treatment, Epo treatment, Epo+leptin treatment, and leptin treatment. Epo and leptin was used at 20 U/ml and 1000 U/ml respectively and densitometry analysis is representative of three independent experiments (B, C and D) POMC (B), NPY (C), and AgRP (D) mRNA expression in WT and ΔEpoRE NPC cultures were determined after Epo, Epo+leptin, and leptin treatments, relative to control saline-treated WT cells. (E) LepRb mRNA expression in WT and ΔEpoRE NPC cultures. Gene expressions were adjusted to β-Actin mRNA levels and RT-PCR reactions were run in triplicate. (F) Fold change in numbers of NPC from WT and ΔEpoRE E15.5 embryos. P0 represents cell proliferation from day 1 to day 7 of culture, and P1–P5 represents passages 1–5 after every 5 days. Fold change is representative of three independent experiments. Statistical significance is indicated by *P<0.05, **P<0.01 and ***P<0.001 (one-way ANOVA followed by Bonferroni correction).

  • View in gallery

    ΔEpoRE mice show blunted STAT3 activation but equivalent POMC induction in the hypothalamus after leptin treatment compared to WT mice. (A and B) Western blotting and quantitative densitometry analysis (from three pups each of WT and ΔEpoRE) were used to compare phosphorylated-STAT3 (p-STAT3), total-STAT3 (t-STAT3), and GAPDH protein levels in WT and ΔEpoRE pups at postnatal day 2–3 (A) and postnatal day 4–5 (B). (C and D) Western blotting and quantitative densitometry analysis demonstrating phosphorylated-STAT3 (p-STAT3) and total-STAT3 (t-STAT3) (C), POMC and GAPDH (D) in a 3-week-old female WT and ΔEpoRE mice 45 min after treated with leptin (5 mg/kg body weight) or saline (n=3 for each treatment group). (E and F) Body weight (E), and food intake (F) were determined in WT and ΔEpoRE mice after saline- or leptin-treatment twice daily for 3 days (n=4 for each treatment group). Statistical significance is indicated by *P<0.05, and **P<0.01 (one-way ANOVA followed by Bonferroni correction).

  • View in gallery

    Induction of α-MSH, a POMC product, in the arcuate nucleus region of the mouse brain after either saline, Epo, or leptin treatment. Representative fluorescence photomicrographs for α-MSH immunoreactivity in brain sections prepared from the mouse mediobasal hypothalamus consisting of the arcuate nucleus region are shown. Three-week old female WT (A, C and E) or ΔEpoRE (B, D and F) mice were treated with either saline (A and B), Epo (3000 U/kg body weight) (C and D), or Leptin (5 mg/kg body weight) (E and F). Scale bar represents 100 μm. 3V, third ventricle; ARC, arcuate nucleus; ME, median eminence.

  • AlnaeeliMWangLPiknovaBRogersHLiXNoguchiCT2012Erythropoietin in brain development and beyond. Anatomy Research International2012953264. (doi:10.1155/2012/953264).

    • Search Google Scholar
    • Export Citation
  • AnagnostouALiuZSteinerMChinKLeeESKessimianNNoguchiCT1994Erythropoietin receptor mRNA expression in human endothelial cells. PNAS9139743978. (doi:10.1073/pnas.91.9.3974).

    • Search Google Scholar
    • Export Citation
  • BalthasarNCoppariRMcMinnJLiuSMLeeCETangVKennyCDMcGovernRAChuaSCJrElmquistJK2004Leptin receptor signaling in POMC neurons is required for normal body weight homeostasis. Neuron42983991. (doi:10.1016/j.neuron.2004.06.004).

    • Search Google Scholar
    • Export Citation
  • BanksASDavisSMBatesSHMyersMGJr2000Activation of downstream signals by the long form of the leptin receptor. Journal of Biological Chemistry2751456314572. (doi:10.1074/jbc.275.19.14563).

    • Search Google Scholar
    • Export Citation
  • BatesSHStearnsWHDundonTASchubertMTsoAWWangYBanksASLaveryHJHaqAKMaratos-FlierE2003STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature421856859. (doi:10.1038/nature01388).

    • Search Google Scholar
    • Export Citation
  • BouyerKSimerlyRB2013Neonatal leptin exposure specifies innervation of presympathetic hypothalamic neurons and improves the metabolic status of leptin-deficient mice. Journal of Neuroscience33840851. (doi:10.1523/JNEUROSCI.3215-12.2013).

    • Search Google Scholar
    • Export Citation
  • CaronESachotCPrevotVBouretSG2010Distribution of leptin-sensitive cells in the postnatal and adult mouse brain. Journal of Comparative Neurology518459476. (doi:10.1002/cne.22219).

    • Search Google Scholar
    • Export Citation
  • ChavezJCBaranovaOLinJPichiuleP2006The transcriptional activator hypoxia inducible factor 2 (HIF-2/EPAS-1) regulates the oxygen-dependent expression of erythropoietin in cortical astrocytes. Journal of Neuroscience2694719481. (doi:10.1523/JNEUROSCI.2838-06.2006).

    • Search Google Scholar
    • Export Citation
  • ChenZYAsavaritikraiPPrchalJTNoguchiCT2007Endogenous erythropoietin signaling is required for normal neural progenitor cell proliferation. Journal of Biological Chemistry2822587525883. (doi:10.1074/jbc.M701988200).

    • Search Google Scholar
    • Export Citation
  • ConstantinescuSNKerenTSocolovskyMNamHHenisYILodishHF2001Ligand-independent oligomerization of cell-surface erythropoietin receptor is mediated by the transmembrane domain. PNAS9843794384. (doi:10.1073/pnas.081069198).

    • Search Google Scholar
    • Export Citation
  • CoppariRIchinoseMLeeCEPullenAEKennyCDMcGovernRATangVLiuSMLudwigTChuaSCJr2005The hypothalamic arcuate nucleus: a key site for mediating leptin's effects on glucose homeostasis and locomotor activity. Cell Metabolism16372. (doi:10.1016/j.cmet.2004.12.004).

    • Search Google Scholar
    • Export Citation
  • D'AndreaADRupBJFisherMJJonesS1993Anti-erythropoietin receptor (EPO-R) monoclonal antibodies inhibit erythropoietin binding and neutralize bioactivity. Blood824652.

    • Search Google Scholar
    • Export Citation
  • DianoSLiuZWJeongJKDietrichMORuanHBKimESuyamaSKellyKGyengesiEArbiserJL2011Peroxisome proliferation-associated control of reactive oxygen species sets melanocortin tone and feeding in diet-induced obesity. Nature Medicine1711211127. (doi:10.1038/nm.2421).

    • Search Google Scholar
    • Export Citation
  • EricksonJCCleggKEPalmiterRD1996Sensitivity to leptin and susceptibility to seizures of mice lacking neuropeptide Y. Nature381415421. (doi:10.1038/381415a0).

    • Search Google Scholar
    • Export Citation
  • FoskettAAlnaeeliMWangLTengRNoguchiCT2011The effects of erythropoietin dose titration during high-fat diet-induced obesity. Journal of Biomedicine & Biotechnology2011373781. (doi:10.1155/2011/373781).

    • Search Google Scholar
    • Export Citation
  • FruhbeckG2006Intracellular signalling pathways activated by leptin. Biochemical Journal393720. (doi:10.1042/BJ20051578).

  • Fuente-MartinEGarcia-CaceresCGranadoMde CeballosMLSanchez-GarridoMASarmanBLiuZWDietrichMOTena-SempereMArgente-ArizonP2012Leptin regulates glutamate and glucose transporters in hypothalamic astrocytes. Journal of Clinical Investigation12239003913. (doi:10.1172/JCI64102).

    • Search Google Scholar
    • Export Citation
  • GaoQWolfgangMJNeschenSMorinoKHorvathTLShulmanGIFuXY2004Disruption of neural signal transducer and activator of transcription 3 causes obesity, diabetes, infertility, and thermal dysregulation. PNAS10146614666. (doi:10.1073/pnas.0303992101).

    • Search Google Scholar
    • Export Citation
  • HarlanSMMorganDAAgassandianKGuoDFCassellMDSigmundCDMarkALRahmouniK2011Ablation of the leptin receptor in the hypothalamic arcuate nucleus abrogates leptin-induced sympathetic activation. Circulation Research108808812. (doi:10.1161/CIRCRESAHA.111.240226).

    • Search Google Scholar
    • Export Citation
  • HillJWWilliamsKWYeCLuoJBalthasarNCoppariRCowleyMACantleyLCLowellBBElmquistJK2008Acute effects of leptin require PI3K signaling in hypothalamic proopiomelanocortin neurons in mice. Journal of Clinical Investigation11817961805. (doi:10.1172/JCI32964).

    • Search Google Scholar
    • Export Citation
  • HiltonDJWatowichSSMurrayPJLodishHF1995Increased cell surface expression and enhanced folding in the endoplasmic reticulum of a mutant erythropoietin receptor. PNAS92190194. (doi:10.1073/pnas.92.1.190).

    • Search Google Scholar
    • Export Citation
  • HojmanPBrolinCGisselHBrandtCZerahnBPedersenBKGehlJ2009Erythropoietin over-expression protects against diet-induced obesity in mice through increased fat oxidation in muscles. PLoS ONE4e5894. (doi:10.1371/journal.pone.0005894).

    • Search Google Scholar
    • Export Citation
  • KatzOStuibleMGolishevskiNLifshitzLTremblayMLGassmannMMittelmanMNeumannD2010Erythropoietin treatment leads to reduced blood glucose levels and body mass: insights from murine models. Journal of Endocrinology2058795. (doi:10.1677/JOE-09-0425).

    • Search Google Scholar
    • Export Citation
  • MancourLVDaghestaniHNDuttaSWestfieldGHSchillingJOleskieANHerbstmanJFChouSZSkiniotisG2012Ligand-induced architecture of the leptin receptor signaling complex. Molecular Cell48655661. (doi:10.1016/j.molcel.2012.09.003).

    • Search Google Scholar
    • Export Citation
  • MengozziMCervelliniIVillaPErbayraktarZGokmenNYilmazOErbayraktarSManohasandraMVan HummelenPVandenabeeleP2012Erythropoietin-induced changes in brain gene expression reveal induction of synaptic plasticity genes in experimental stroke. PNAS10996179622. (doi:10.1073/pnas.1200554109).

    • Search Google Scholar
    • Export Citation
  • MiskowiakKO'SullivanUHarmerCJ2007Erythropoietin enhances hippocampal response during memory retrieval in humans. Journal of Neuroscience2727882792. (doi:10.1523/JNEUROSCI.5013-06.2007).

    • Search Google Scholar
    • Export Citation
  • MortonGJCummingsDEBaskinDGBarshGSSchwartzMW2006Central nervous system control of food intake and body weight. Nature443289295. (doi:10.1038/nature05026).

    • Search Google Scholar
    • Export Citation
  • NoguchiCTWangLRogersHMTengRJiaY2008Survival and proliferative roles of erythropoietin beyond the erythroid lineage. Expert Reviews in Molecular Medicine10e36. (doi:10.1017/S1462399408000860).

    • Search Google Scholar
    • Export Citation
  • OuyangSHeF2003Phylogeny of a growth hormone-like cytokine superfamily based upon 3D structure. Journal of Molecular Evolution56131136. (doi:10.1007/s00239-002-2385-2).

    • Search Google Scholar
    • Export Citation
  • SchwartzMWWoodsSCSeeleyRJBarshGSBaskinDGLeibelRL2003Is the energy homeostasis system inherently biased toward weight gain?Diabetes52232238. (doi:10.2337/diabetes.52.2.232).

    • Search Google Scholar
    • Export Citation
  • ShingoTSorokanSTShimazakiTWeissS2001Erythropoietin regulates the in vitro and in vivo production of neuronal progenitors by mammalian forebrain neural stem cells. Journal of Neuroscience2197339743.

    • Search Google Scholar
    • Export Citation
  • SuzukiNOhnedaOTakahashiSHiguchiMMukaiHYNakahataTImagawaSYamamotoM2002Erythroid-specific expression of the erythropoietin receptor rescued its null mutant mice from lethality. Blood10022792288. (doi:10.1182/blood-2002-01-0124).

    • Search Google Scholar
    • Export Citation
  • TengRGavrilovaOSuzukiNChanturiyaTSchimelDHugendublerLMammenSYverDRCushmanSWMuellerE2011Disrupted erythropoietin signalling promotes obesity and alters hypothalamus proopiomelanocortin production. Nature Communications2520. (doi:10.1038/ncomms1526).

    • Search Google Scholar
    • Export Citation
  • ThalerJPYiCXSchurEAGuyenetSJHwangBHDietrichMOZhaoXSarrufDAIzgurVMaravillaKR2012Obesity is associated with hypothalamic injury in rodents and humans. Journal of Clinical Investigation122153162. (doi:10.1172/JCI59660).

    • Search Google Scholar
    • Export Citation
  • TsaiPTOhabJJKerteszNGroszerMMatterCGaoJLiuXWuHCarmichaelST2006A critical role of erythropoietin receptor in neurogenesis and post-stroke recovery. Journal of Neuroscience2612691274. (doi:10.1523/JNEUROSCI.4480-05.2006).

    • Search Google Scholar
    • Export Citation
  • UmMGrossAWLodishHF2007A "classical" homodimeric erythropoietin receptor is essential for the antiapoptotic effects of erythropoietin on differentiated neuroblastoma SH-SY5Y and pheochromocytoma PC-12 cells. Cellular Signalling19634645. (doi:10.1016/j.cellsig.2006.08.014).

    • Search Google Scholar
    • Export Citation
  • VolkowNDWangGJBalerRD2011Reward, dopamine and the control of food intake: implications for obesity. Trends in Cognitive Sciences153746. (doi:10.1016/j.tics.2010.11.001).

    • Search Google Scholar
    • Export Citation
  • WangLZhangZGZhangRLGreggSRHozeska-SolgotALeTourneauYWangYChoppM2006Matrix metalloproteinase 2 (MMP2) and MMP9 secreted by erythropoietin-activated endothelial cells promote neural progenitor cell migration. Journal of Neuroscience2659966003. (doi:10.1523/JNEUROSCI.5380-05.2006).

    • Search Google Scholar
    • Export Citation
  • WangLChoppMGreggSRZhangRLTengHJiangAFengYZhangZG2008Neural progenitor cells treated with EPO induce angiogenesis through the production of VEGF. Journal of Cerebral Blood Flow and Metabolism2813611368. (doi:10.1038/jcbfm.2008.32).

    • Search Google Scholar
    • Export Citation
  • WuHLiuXJaenischRLodishHF1995Generation of committed erythroid BFU-E and CFU-E progenitors does not require erythropoietin or the erythropoietin receptor. Cell835967. (doi:10.1016/0092-8674(95)90234-1).

    • Search Google Scholar
    • Export Citation
  • YaswenLDiehlNBrennanMBHochgeschwenderU1999Obesity in the mouse model of pro-opiomelanocortin deficiency responds to peripheral melanocortin. Nature Medicine510661070. (doi:10.1038/12506).

    • Search Google Scholar
    • Export Citation
  • YuXShackaJJEellsJBSuarez-QuianCPrzygodzkiRMBeleslin-CokicBLinCSNikodemVMHempsteadBFlandersKC2002Erythropoietin receptor signalling is required for normal brain development. Development129505516.

    • Search Google Scholar
    • Export Citation
  • ZhangYWangLDeySAlnaeeliMSureshSRogersHTengRNoguchiCT2014Erythropoietin action in stress response, tissue maintenance and metabolism. International Journal of Molecular Sciences151029610333. (doi:10.3390/ijms150610296).

    • Search Google Scholar
    • Export Citation
  • ZuureWARobertsALQuennellJHAndersonGM2013Leptin signaling in GABA neurons, but not glutamate neurons, is required for reproductive function. Journal of Neuroscience331787417883. (doi:10.1523/JNEUROSCI.2278-13.2013).

    • Search Google Scholar
    • Export Citation