Abstract
Sexual dimorphism has been found in both mitochondrial functionality and adiponectin expression in white adipose tissue, with female rats presenting more functional mitochondria than males and greater adiponectin expression. However, little is known about the role of sex hormones in this dimorphism. The aim was to elucidate the role of sex hormones in mitochondrial biogenesis and dynamics and in adiponectin synthesis in white adipocytes, and also to provide new evidence of the link between these processes. 3T3-L1 preadipocytes were differentiated and treated either with 17-β estradiol (E2; 10 nM), progesterone (Pg), testosterone (1 μM both), or a combination of Pg or testosterone with flutamide (FLT; 10 μM) or E2 (1 μM). The markers of mitochondrial biogenesis and dynamics and adiponectin expression were analyzed. E2 induced mitochondrial proliferation and differentiation in 3T3-L1, although testosterone showed opposite effects. Pg treatment stimulated proliferation but impaired differentiation. In concerns mitochondrial dynamics, these hormones promoted fusion over fission. FLT treatment indicated that Pg elicits its effects on mitochondrial dynamics through the androgen receptor. E2 coadministration with testosterone or Pg reversed its effects. In conclusion, our results show that E2 induces stimulation of mitochondrial biogenesis in white adipocytes in vitro, especially in situations that imply an impairment of mitochondrial function, whereas testosterone would have opposite effects. Moreover, testosterone and Pg alter mitochondrial dynamics by promoting fusion over fission, while E2 stimulates both processes. All these alterations run in parallel with changes in adiponectin expression, thus suggesting the existence of a link between mitochondrial biogenesis and dynamics and adiponectin synthesis in white adipocytes.
Introduction
Mitochondrial biogenesis is a complex event that includes both mitochondrial proliferation (increase in mitochondrial mass) and differentiation (improvement of mitochondrial capacities) (Attardi & Schatz 1988), whose regulation requires the coordinated contribution of both mitochondrial and nuclear genome (Fernández-Silva et al. 2003). The family of the peroxisome proliferator-activated receptor γ coactivator 1 (PGC1) plays a central role in the regulatory network governing the transcriptional control of mitochondrial biogenesis (Scarpulla 2011), and among them, PGC1a is the master regulator of the mitochondrial biogenesis process (Wu et al. 1999), but other members such as PGC1b function in the same or along similar pathways (Handschin & Spiegelman 2006). In short, PGC1a exerts its effects by activating other transcription factors, such as nuclear respiratory factors (NRFs; Wu et al. 1999), which in turn regulate the expression of nuclear genes involved in mitochondrial biogenesis, including mitochondrial transcription factor A (Tfam), a crucial factor for proper mitochondrial DNA (mtDNA) transcription and replication (Scarpulla 1997, Garstka et al. 2003, Maniura-Weber et al. 2004).
Mitochondrial function is also regulated by changes in mitochondrial morphology, which is the result of the balance between fusion and fission processes. Mammalian mitochondrial fusion is mediated by mitofusins (MFN) and optic atrophy protein 1 (OPA1), while mitochondrial fission is mediated mainly by dynamin-related protein 1 (DRP1) and fission protein 1 (FIS1) (Liesa et al. 2009). Alterations in these mitochondrial dynamics induce changes in mitochondrial shape and size: a shift toward fusion enables the cell to build extended, interconnected mitochondrial networks; whereas when fission prevails mitochondria are mainly small, spherical organelles (Chen & Chan 2004). This plasticity enables mitochondrial recruitment to critical subcellular compartments, mitochondria shape control, content exchange between mitochondria, mitochondrial communication with the cytosol, and mitochondrial quality control (Lee et al. 2004, Chen et al. 2005, 2010, Twig et al. 2008, Liesa et al. 2009).
White adipose tissue (WAT) is more than a simple fat deposit, as it is an endocrine organ that contributes to energy homeostasis mechanisms by releasing proteins that are commonly referred to as adipokines (Harwood 2012, Henry et al. 2012). Adiponectin is an insulin-sensitizing adipokine that modulates energy expenditure and caloric intake, and there is an inverse correlation between the levels of circulating adiponectin and the risk of obesity, insulin resistance, type 2 diabetes, and cardiovascular disease (Ronti et al. 2006, Trujillo & Scherer 2006, Fonseca-Alaniz et al. 2007, Galic et al. 2010). Adiponectin also exerts autocrine effects in WAT, promoting adipocyte differentiation through the activation of peroxisome proliferator-activated receptor γ (PPARg), a key transcriptional factor to initiate and maintain the fully differentiated adipocyte phenotype (Spiegelman et al. 1993, Fu et al. 2005). Mitochondrial function is an important factor in adipocyte differentiation (Lu et al. 2010), and an impairment of mitochondrial function has been related to alterations in adipokine synthesis, including adiponectin, in WAT (Koh et al. 2007, Wang et al. 2013).
Several studies suggest that sex steroids may be regarded as critical modulators of preadipocyte proliferation and/or differentiation, as well as of the metabolism of mature adipocytes (Roncari & Van 1978, Anderson et al. 2001). In this context, previous research by our group demonstrates that there is a sexual dimorphism in mitochondrial function and biogenesis in WAT, in that mitochondria of female rats are more functional than those of males, and this is accompanied by greater adiponectin expression (Amengual-Cladera et al. 2012a,b). Although estrogens are known to modulate both mitochondrial biogenesis (Mattingly et al. 2008) and adipokine secretion (Hong et al. 2007), our previous studies in ovariectomized rats pointed out that 17-β estradiol (E2) would not be the only factor responsible for the differences between males and females in WAT (Amengual-Cladera et al. 2012c).
Thus, the aim of this in vitro study was to elucidate whether sex hormones, specifically E2, mediate changes in the expression of mitochondrial biogenesis and dynamics markers and adiponectin, thus providing new evidence of both the link between mitochondrial function and adiponectin production in WAT and the role of sex hormones in the modulation of this link.
Subjects and methods
Cell culture
Murine 3T3-L1 preadipocytes (American Type Culture Collection, Barcelona, Spain) were routinely stored at 37 °C in a humidified atmosphere of 5% CO2. Fetal bovine serum (FBS), charcoal-stripped FBS, and penicillin–streptomycin were from Biological Industries (Beit-Haemek, Israel), and all DMEM were from Gibco (Gibco by Invitrogen). The cells were grown for 2 days after confluence in DMEM/high-glucose medium supplemented with 10% FBS and 1% penicillin–streptomycin. Then, differentiation was induced by incubating for 2 days in the same medium supplemented with 0.25 μM dexamethasone, 0.5 mM 3-isobutyl-1-methylxanthine, and 5 μM insulin, and for 2 more days supplemented only with 5 μM insulin. This was followed for 3 days in complete medium, which was replaced 24 h before treatment by phenol red-free DMEM/high-glucose medium supplemented with 1% penicillin–streptomycin and 10% charcoal-stripped FBS to avoid the interference of lipid compounds from the serum. For all the experiments, cell line was between 16 and 21 passages.
Treatments and sample collection
Previous experiments were carried out in order to determine the suitable concentration of each compound (data not shown). To test the possible toxic effects of the treatments, cell death was assessed by the LDH-Cytotoxicity Assay Kit II (BioVision, Inc., San Francisco, CA, USA). None of the treatments induced cell death (data not shown).
Hormones and flutamide (FLT) were purchased from Sigma–Aldrich. They were dissolved in ethanol and added to the cell culture plates for 24 h to a final concentration of 10 nM E2, 1 μM progesterone (Pg), and testosterone. When corresponded, 10 μM FLT, an androgen receptor (AR) blocker (Labrie 1993), was added to the plate 1 h before Pg or testosterone. In sex hormone-combined treatments, all concentrations were set at 1 μM. An equivalent volume of ethanol was added to the untreated control plates.
The cells were harvested with TriPure Isolation Reagent (Roche Diagnostics) and DNA, RNA, and protein were isolated following the manufacturer's instructions, quantified using the Gene5 Take3 Module with the Powerwave XS Reader (Bio-Tek, Winooski, VT, USA), and stored for future use. For immunoblot analysis, cells were harvested in solubilization buffer (50 mM Tris, pH 8.8, 1 mM EGTA, 1% Igepal, 10 mM iodoacetamide, 1 mM leupeptin, 1 mM pepstatin, and 1 mM sodium orthovanadate), incubated for 1 h at 4 °C by shaking, and centrifuged at 15 000 g for 30 min. The supernatant was collected, and the protein content was assessed by a BCA protein Assay Kit (Pierce, Bonn, Germany) and then stored for future use. Protein concentration within culture media was assessed by colorimetric assay (Bradford 1976). To determine enzymatic activities, cells were harvested with sterile water. Cell disruption was carried out mechanically by passing the cells through a pipette. Cell lysate was sonicated at 20 W and centrifuged at 500 g to remove membranes. Citrate synthase (CS) activity was determined spectrophotometrically (Nakano et al. 2005), and protein content was measured using the BCA Kit (Pierce).
Real-time PCR
One microgram of RNA was reverse transcribed to cDNA at 42 °C for 60 min with 25 U MuLV reverse transcriptase in 10 μl of retrotranscription reaction mixture containing 10 mM Tris–HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 2.5 mM MgCl2, 2.5 μM random hexamers, 10 U RNase inhibitor, and 500 μM each dNTP in a GeneAmp 9700 Thermal Cycler (Applied Biosystems). Each cDNA was diluted to 1/10. Real-time PCR was carried out for 18 target genes, and 18S (Rn18s) rRNA was used as a housekeeping gene (Table 1). Real-time PCR was carried out using LightCycler 480 SYBR Green I Master technology on a LightCycler 480 System II rapid thermal cycler (Roche Diagnostics). Each reaction contained 5 μl of LightCycler 480 SYBR Green I Master (containing FastStart Taq DNA polymerase, dNTP mix, reaction buffer, MgCl2, and SYBR Green I dye), 0.5 μM of the sense and antisense specific primers, and 2.5 μl of the cDNA dilution in a final volume of 10 μl. The amplification program consisted of a preincubation step for the denaturation of the template cDNA (2 min, 94 °C), followed by 40 cycles consisting of a denaturation step (95 °C, 10 s), annealing (primer-dependent temperature, 10 s), extension (72 °C, 12 s), and fluorescence capture (Table 1). Product specificity was confirmed routinely by melting curve analysis and agarose gel electrophoresis. A negative control without cDNA was run in each assay.
Oligonucleotide primer sequences and conditions used in real-time PCR amplification in 3T3-L1 adipocytes
| Gene | Forward primer (5′→3′) | Reverse primers (5′→3′) | Annealing temperature (°C) | Product length (bp) |
|---|---|---|---|---|
| 18S | CCTCCAATGGATCCTCGT | AAACGGCTACCACATCCA | 54 | 160 |
| Cox2 | AAGACGCCACATCCCCTATT | CTTCAGTATCATTGGTGCCCT | 53 | 291 |
| Cox4 | AGAAGGCGCTGAAGGAGAAGGA | CCAGCATGCCGAGGGAGTGA | 58 | 385 |
| Cs | GTTAGCTGGAGACGCTTT | AGAGGCCTGGAAGGAAAC | 53 | 157 |
| Nrf1 | CCTCTGATGCTTGCGTCGTCT | TTACTCTGCTGTGGCTGATGG | 55 | 71 |
| Gabpa | GGGGAACAGAACAGGAAACA | CCGTAATGCACGGCTAAGTT | 60 | 189 |
| Pgc1a | ATCTACTGCCTGGGGACCTT | ATGTGTCGCCTTCTTGCTCT | 62 | 179 |
| Pgc1b | ACTATGATCCCACGTCTGAAGAGTC | CCTTGTCTGAGGTATTGAGGTATTC | 61 | 123 |
| Tfam | AGCCAGGTCCAGCTCACT | AAACCCAAGAAAGCATGT | 52 | 165 |
| Mfn1 | GCTGTCAGAGCCCATCTTTC | CAGCCCACTGTTTTCCAAAT | 51 | 198 |
| Fis1 | AAGTATGTGCGAGGGCTGTT | ACAGCCAGTCCAATGAGTCC | 53 | 166 |
| Drp1 | AGAAAACTGTCTGCCCGAGA | GCTGCCCTACCAGTTCACTC | 53 | 169 |
| Opa1 | GATGACACGCTCTCCAGTGA | TCGGGGCTAACAGTACAACC | 55 | 176 |
| Adiponectin | GTTGCAAGCTCTCCTGTTCC | TCTCCAGGAGTGCCATCTCT | 55 | 192 |
| AdipoR2 | CCACAACCTTGCTTCATCTACC | ACGAACACTCCTGCTCTGAC | 54 | 118 |
| AdipoR1 | AGATGGAGGAGTTCGTGTATAAG | ATGTAGCAGGTAGTCGTTGTC | 54 | 100 |
| Resistin | CCAAGGTCCAGTCTCCTCCG | AGGGTGTGTGTGGGAATTGT | 56 | 169 |
| Pparg | TTTTCAAGGGTGCCAGTTTC | AATCCTTGGCCCTCTGAGAT | 56 | 173 |
| ALBP/aP2 | CCGATCCACTCCTTACCTCA | GCCACCGTGACCTTGTACTT | 56 | 234 |
Cox2, cytochrome c oxidase subunit 2; Cox4, cytochrome c oxidase subunit 4; Cs, citrate synthase; Nrf1, nuclear respiratory factor 1; Gabpa, GA-binding protein α; Pgc1a, peroxisome proliferator-activated receptor coactivator 1α; Pgc1b, peroxisome proliferator-activated receptor coactivator 1β; Tfam, mitochondrial transcription factor A; Mfn1, mitofusin 1; Opa1, optic atrophy protein 1; Fis1, fission protein 1; Drp1, dynamin-related protein; AdipoR1 and AdipoR2, adiponectin receptors 1 and 2; Pparg, peroxisome proliferator-activated receptor γ; ALBP/aP2, adipocyte lipid-binding protein aP2. The amplification program consisted of a preincubation step for denaturation of the template cDNA (2 min, 94 °C), followed by 40 cycles consisting of a denaturation step (95 °C, 10 s), and annealing (primer-dependent temperature, 10 s), extension (72 °C, 12 s), and fluorescence capture step. Product length was assessed by agarose electrophoresis.
mtDNA quantification
mtDNA content relative to nuclear DNA was assessed by quantitative real-time PCR, using diluted total DNA as template and primers for cytochrome c oxidase subunit 2 (Cox2 (mtCo2)) as a mitochondrial gene and 18S as a nuclear gene (Table 1). Reactions were carried out by real-time PCR (see above).
Western blot analysis of protein levels
A volume of 30 μl of conditioned culture medium or 30 μg of purified cell protein (for medium and cell adiponectin determination respectively) or 30 μg of protein from homogenate (for estrogen receptor (ER) determination) was fractioned by SDS–PAGE and electrotransferred onto a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad). Membranes were blocked with blocking solution (5% nonfat powdered milk in PBS, pH 7.5, and containing 0.1% Tween 20) and were incubated with the corresponding antibody: adiponectin was purchased from ProSci Incorporated (Poway, CA, USA), and ERs (ERa and ERb), tubulin, and BSA (loading controls) were from Santa Cruz Biotechnology. Development of the immunoblots was carried out using an ECL Kit (Bio-Rad). Bands were visualized with the ChemiDoc XRS System (Bio-Rad) and analyzed with the image analysis program Quantity One (Bio-Rad).
Analysis of cardiolipin content
Cardiolipin content was assayed using nonyl acridine orange (NAO). The cells were seeded in a fluorescence plate, differentiated, and treated with either vehicle, E2, Pg, or testosterone for 24 h. The culture medium was aspired and NAO (250 nM) dissolved in PBS–glucose (20 mM) was added. The plate was incubated in the dark for 30 min at 37 °C and fluorescence was quantified using a microplate fluorescence reader FLx800 (Bio-Tek) set at 485 nm excitation and 528 nm emission. The fluorescence was corrected by cell density assessed by a violet crystal staining. Briefly, 20 μl of violet crystal (0.5% w/v in 30% acetic acid) was added in all wells and incubated for 10 min. Four washes with distilled water were done and the remaining violet crystal was solubilized in 100 μl of methanol. Absorbance was determined at 570 nm in a spectrophotometer Powerwave XS reader (Bio-Tek).
Laser scanning confocal microscopy
The cells were seeded in cover slips placed in the culture plate and differentiated to adipocytes. Then, cells were treated as described above and, at the time of the analysis, 0.5 μM MitoTracker Green (MTG; Invitrogen) was added. The cells were incubated for 1 h and washed twice with fresh media. Fluorescence was viewed using a Leica confocal microscope and images were acquired using a 63× objective lens and the Leica Application Suite (LAS) Software, version Advanced Fluorescence 2.3.6 build 5381 (LAS, Wetzlar, Germany), and processed using ImageJ 1.45 (http://imagej.nih.gov/ij/; NIH, Bethesda, MA, USA).
Statistical analysis
All data are expressed as mean values±s.e.m. of at least three independent experiments carried out in duplicate. The Ct values of the real-time PCR were analyzed using GenEx Standard Software (MultiD Analyses, Goteborg, Sweden). The efficiency of the reaction was taken into account for each gene. Statistical differences between groups were stated either by Student's t-test, when two groups were compared, or by one-way ANOVA followed by least-significant difference (LSD) post-hoc analysis, when three or more groups were compared. A P value <0.05 was considered statistically significant. All statistical analyses were carried out using the SPSS 17.0 for Windows, Inc. software package.
Results
Effect of hormonal treatments on mitochondrial biogenesis and function markers
E2 treatment increased the expression of Pgc1a (Ppargc1a), Pgc1b (Ppargc1b), and Tfam, which are the key regulators of mitochondrial content and functional capacity (Table 2). Cox4 mRNA levels, mtDNA, cardiolipin content (an indicator of inner mitochondrial membrane quantity), and mitochondrial mass measured by MTG fluorescence intensity (Fig. 1) were also increased by E2 treatment. Pg treatment also increased mtDNA, MTG intensity, and cardiolipin content, whereas Cox4, Pgc1b, Nrf1, and Gabpa mRNA levels were decreased. Testosterone treatment decreased Cox4, Pgc1b, and Gabpa expression, as well as CS activity and mitochondrial mass measured by MTG fluorescence (Fig. 1).
Effects of sex hormones treatment on the markers of mitochondrial biogenesis and function in 3T3-L1 adipocytes
| Control | E2 | Pg | Testosterone | |
|---|---|---|---|---|
| Pgc1a mRNA (AU) | 1.48±0.17 | 2.04±0.19* | 1.12±0.06 | 1.96±0.25 |
| Pgc1b mRNA (AU) | 2.42±0.07 | 3.73±0.43* | 1.75±0.24* | 2.21±0.06* |
| Nrf1 mRNA (AU) | 3.28±0.18 | 3.33±0.38 | 1.73±0.30* | 3.52±0.50 |
| Gabpa mRNA (AU) | 2.80±0.09 | 2.97±0.32 | 1.34±0.11* | 1.53±0.06* |
| Tfam mRNA (AU) | 1.55±0.20 | 2.80±0.39* | 1.35±0.11 | 1.91±0.28 |
| mtDNA (AU) | 5.91±2.37 | 49.9±17.7* | 22.3±0.9* | 3.89±1.09 |
| Cardiolipin content (%) | 100±2 | 112±5* | 115±3* | 104±4 |
| Cox4 mRNA (AU) | 2.92±0.25 | 3.44±0.08* | 1.73±0.32* | 2.19±0.30* |
| Cs mRNA (AU) | 2.41±0.54 | 3.17±0.36 | 2.16±0.23 | 2.58±0.16 |
| CS activity (IU/mg DNA) | 4.75±0.14 | 5.08±0.27 | 4.64±0.41 | 4.21±0.09* |
E2, 17-β estradiol; Pg, progesterone; Pgc1a, peroxisome proliferator-activated receptor γ coactivator 1α; Pgc1b, peroxisome proliferator-activated receptor γ coactivator 1β; Nrf1, nuclear respiratory factor 1; GABPa, GA-binding protein α; Tfam, mitochondrial transcription factor A; mtDNA, mitochondrial DNA; Cox4, cytochrome c oxidase subunit 4; Cs, citrate synthase. Results are expressed in arbitrary units (AU) or in international units (IU). 3T3-L1 were treated with E2 (10 nM) and Pg and testosterone (1 μM both) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of three independent experiments (n=6). The values for vehicle-treated cells were set as 100% for the determinations of cardiolipin. For mRNA levels, GenEx Software was used to analyze the Ct values normalized to 18S Ct. *Difference vs control cells (Student's t-test, P<0.05).
Mitochondrial mass measured as MTG intensity and representative confocal images. E2, 17-β estradiol; Pg, progesterone; FLT, flutamide; MTG, Mitotracker Green. 3T3-L1 cell lines were treated with E2 (10 nM), Pg and testosterone (1 μM both), Pg or testosterone (1 μM) plus E2 (1 μM), and Pg or testosterone (1 μM) plus FLT (10 μM) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of nine regions of a field of view. Values of control cells were set as 100. ImageJ Software was used to quantify MTG intensity. (A) The effects of E2 treatments. *Significant difference vs control cells (Student's t-test, P<0.05). (B and C) The effects of Pg and testosterone treatments alone and combined with FLT or E2. One-way ANOVA (P<0.05) and post-hoc analysis (LSD-test, P<0.05): a, significant difference vs control cells; and c, significant difference vs testosterone-treated cells. (D) Confocal images of 3T3-L1 stained with MTG 0.5 μM. The fluorescence was monitored with a Leica confocal microscope using 63X lens.
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Mitochondrial mass measured as MTG intensity and representative confocal images. E2, 17-β estradiol; Pg, progesterone; FLT, flutamide; MTG, Mitotracker Green. 3T3-L1 cell lines were treated with E2 (10 nM), Pg and testosterone (1 μM both), Pg or testosterone (1 μM) plus E2 (1 μM), and Pg or testosterone (1 μM) plus FLT (10 μM) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of nine regions of a field of view. Values of control cells were set as 100. ImageJ Software was used to quantify MTG intensity. (A) The effects of E2 treatments. *Significant difference vs control cells (Student's t-test, P<0.05). (B and C) The effects of Pg and testosterone treatments alone and combined with FLT or E2. One-way ANOVA (P<0.05) and post-hoc analysis (LSD-test, P<0.05): a, significant difference vs control cells; and c, significant difference vs testosterone-treated cells. (D) Confocal images of 3T3-L1 stained with MTG 0.5 μM. The fluorescence was monitored with a Leica confocal microscope using 63X lens.
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Mitochondrial mass measured as MTG intensity and representative confocal images. E2, 17-β estradiol; Pg, progesterone; FLT, flutamide; MTG, Mitotracker Green. 3T3-L1 cell lines were treated with E2 (10 nM), Pg and testosterone (1 μM both), Pg or testosterone (1 μM) plus E2 (1 μM), and Pg or testosterone (1 μM) plus FLT (10 μM) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of nine regions of a field of view. Values of control cells were set as 100. ImageJ Software was used to quantify MTG intensity. (A) The effects of E2 treatments. *Significant difference vs control cells (Student's t-test, P<0.05). (B and C) The effects of Pg and testosterone treatments alone and combined with FLT or E2. One-way ANOVA (P<0.05) and post-hoc analysis (LSD-test, P<0.05): a, significant difference vs control cells; and c, significant difference vs testosterone-treated cells. (D) Confocal images of 3T3-L1 stained with MTG 0.5 μM. The fluorescence was monitored with a Leica confocal microscope using 63X lens.
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Effect of hormonal treatments on markers of mitochondrial dynamics
The expression of genes encoding proteins involved in fusion and fission processes in mitochondria is shown in Figs 2A, 3A and 4A. E2 treatment induced an increase in Opa1 and in Drp1 (Dnm1l) mRNA levels. Pg upregulated Mfn1 expression and decreased Fis1 and Drp1 mRNA levels. The addition of E2 to Pg-treated cells returned Fis1 and Drp1 levels to control values. FLT addition had the same effect on Drp1 levels and increased Fis1 expression, although without achieving control values in the latter. Testosterone treatment induced an increase in Mfn1 mRNA levels that was reversed to control values by FLT or E2 supplementation. The expression of Fis1 and Drp1 was also decreased by testosterone. FLT and E2 returned Drp1 mRNA levels of testosterone-treated cells to control values and the same happened with Fis1 mRNA when FLT was added. However, Fis1 levels increased over control values in the testosterone+E2 treatment.
Effects of 17β-estradiol on the expression levels of mitochondrial dynamics and adipogenic markers, adipokines and adiponectin receptors on 3T3-L1 adipocytes (A), and on intracellular and secreted adiponectin protein levels (B). E2, 17-β estradiol; Mfn1, mitofusin 1; Opa1, optic atrophy protein 1; Fis1, fission protein 1; Drp1, dynamin-related protein; AdipoR1 and AdipoR2, adiponectin receptors 1 and 2; Pparg, peroxisome proliferator-activated receptor γ; ALBP/aP2, adipocyte lipid-binding protein aP2; Ad, adiponectin. 3T3-L1 adipocytes were treated with E2 (10 nM) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of three independent experiments performed in duplicate (n=6). Values of control cells were set as 100. GenEx Software was used to analyze the Ct values normalized to 18S Ct (GenEx Software, MultiDAnalyses, Goteborg, Sweden). Two representative immunoblots are shown below the corresponding graphs, and when immunoblot bands have been grouped from different parts of the same gel it is indicated by lines in the figure. *Significant difference vs control cells (Student's t-test, P<0.05).
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Effects of 17β-estradiol on the expression levels of mitochondrial dynamics and adipogenic markers, adipokines and adiponectin receptors on 3T3-L1 adipocytes (A), and on intracellular and secreted adiponectin protein levels (B). E2, 17-β estradiol; Mfn1, mitofusin 1; Opa1, optic atrophy protein 1; Fis1, fission protein 1; Drp1, dynamin-related protein; AdipoR1 and AdipoR2, adiponectin receptors 1 and 2; Pparg, peroxisome proliferator-activated receptor γ; ALBP/aP2, adipocyte lipid-binding protein aP2; Ad, adiponectin. 3T3-L1 adipocytes were treated with E2 (10 nM) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of three independent experiments performed in duplicate (n=6). Values of control cells were set as 100. GenEx Software was used to analyze the Ct values normalized to 18S Ct (GenEx Software, MultiDAnalyses, Goteborg, Sweden). Two representative immunoblots are shown below the corresponding graphs, and when immunoblot bands have been grouped from different parts of the same gel it is indicated by lines in the figure. *Significant difference vs control cells (Student's t-test, P<0.05).
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Effects of 17β-estradiol on the expression levels of mitochondrial dynamics and adipogenic markers, adipokines and adiponectin receptors on 3T3-L1 adipocytes (A), and on intracellular and secreted adiponectin protein levels (B). E2, 17-β estradiol; Mfn1, mitofusin 1; Opa1, optic atrophy protein 1; Fis1, fission protein 1; Drp1, dynamin-related protein; AdipoR1 and AdipoR2, adiponectin receptors 1 and 2; Pparg, peroxisome proliferator-activated receptor γ; ALBP/aP2, adipocyte lipid-binding protein aP2; Ad, adiponectin. 3T3-L1 adipocytes were treated with E2 (10 nM) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of three independent experiments performed in duplicate (n=6). Values of control cells were set as 100. GenEx Software was used to analyze the Ct values normalized to 18S Ct (GenEx Software, MultiDAnalyses, Goteborg, Sweden). Two representative immunoblots are shown below the corresponding graphs, and when immunoblot bands have been grouped from different parts of the same gel it is indicated by lines in the figure. *Significant difference vs control cells (Student's t-test, P<0.05).
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Effects of progesterone and its combined treatments with flutamide or E2 on the expression levels of mitochondrial dynamics (A) and adipogenic markers (C), adipokines and adiponectin receptors on 3T3-L1 adipocytes (B), and on intracellular and secreted adiponectin protein levels (D). E2, 17-β estradiol; Pg, progesterone; FLT, flutamide; Mfn1, mitofusin 1; Opa1, optic atrophy protein 1; Fis1, fission protein 1; Drp1, dynamin-related protein; AdipoR1 and AdipoR2, adiponectin receptors 1 and 2; Pparg, peroxisome proliferator-activated receptor γ; ALBP/aP2, adipocyte lipid-binding protein aP2; Ad, adiponectin. 3T3-L1 adipocytes were treated with Pg (1 μM) alone or in combination with FLT (10 μM) or with E2 (1 μM) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of three independent experiments performed in duplicate (n=6). Values of control cells were set as 100. GenEx Software was used to analyze the Ct values normalized to 18S Ct. Two representative immunoblots are shown below the corresponding graphs, and when immunoblot bands have been grouped from different parts of the same gel it is indicated by lines in the figure. One-way ANOVA (P<0.05) and post-hoc analysis (LSD-test, P<0.05): a, significant difference vs control cells and b, significant difference vs Pg-treated cells.
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Effects of progesterone and its combined treatments with flutamide or E2 on the expression levels of mitochondrial dynamics (A) and adipogenic markers (C), adipokines and adiponectin receptors on 3T3-L1 adipocytes (B), and on intracellular and secreted adiponectin protein levels (D). E2, 17-β estradiol; Pg, progesterone; FLT, flutamide; Mfn1, mitofusin 1; Opa1, optic atrophy protein 1; Fis1, fission protein 1; Drp1, dynamin-related protein; AdipoR1 and AdipoR2, adiponectin receptors 1 and 2; Pparg, peroxisome proliferator-activated receptor γ; ALBP/aP2, adipocyte lipid-binding protein aP2; Ad, adiponectin. 3T3-L1 adipocytes were treated with Pg (1 μM) alone or in combination with FLT (10 μM) or with E2 (1 μM) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of three independent experiments performed in duplicate (n=6). Values of control cells were set as 100. GenEx Software was used to analyze the Ct values normalized to 18S Ct. Two representative immunoblots are shown below the corresponding graphs, and when immunoblot bands have been grouped from different parts of the same gel it is indicated by lines in the figure. One-way ANOVA (P<0.05) and post-hoc analysis (LSD-test, P<0.05): a, significant difference vs control cells and b, significant difference vs Pg-treated cells.
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Effects of progesterone and its combined treatments with flutamide or E2 on the expression levels of mitochondrial dynamics (A) and adipogenic markers (C), adipokines and adiponectin receptors on 3T3-L1 adipocytes (B), and on intracellular and secreted adiponectin protein levels (D). E2, 17-β estradiol; Pg, progesterone; FLT, flutamide; Mfn1, mitofusin 1; Opa1, optic atrophy protein 1; Fis1, fission protein 1; Drp1, dynamin-related protein; AdipoR1 and AdipoR2, adiponectin receptors 1 and 2; Pparg, peroxisome proliferator-activated receptor γ; ALBP/aP2, adipocyte lipid-binding protein aP2; Ad, adiponectin. 3T3-L1 adipocytes were treated with Pg (1 μM) alone or in combination with FLT (10 μM) or with E2 (1 μM) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of three independent experiments performed in duplicate (n=6). Values of control cells were set as 100. GenEx Software was used to analyze the Ct values normalized to 18S Ct. Two representative immunoblots are shown below the corresponding graphs, and when immunoblot bands have been grouped from different parts of the same gel it is indicated by lines in the figure. One-way ANOVA (P<0.05) and post-hoc analysis (LSD-test, P<0.05): a, significant difference vs control cells and b, significant difference vs Pg-treated cells.
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Effects of testosterone and its combined treatments with flutamide or E2 on the expression levels of mitochondrial dynamics (A) and adipogenic markers (C), adipokines and adiponectin receptors on 3T3-L1 adipocytes (B), and on intracellular and secreted adiponectin protein levels (D). E2, 17-β estradiol; FLT, flutamide; Mfn1, mitofusin 1; Opa1, optic atrophy protein 1; Fis1, fission protein 1; Drp1, dynamin-related protein; AdipoR1 and AdipoR2, adiponectin receptors 1 and 2; Pparg, peroxisome proliferator-activated receptor γ; ALBP/aP2, adipocyte lipid-binding protein aP2; Ad, adiponectin. 3T3-L1 adipocytes were treated with testosterone (1 μM) alone or in combination with FLT (10 μM) or with E2 (1 μM) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of three independent experiments performed in duplicate (n=6). Values of control cells were set as 100. GenEx Software was used to analyze the Ct values normalized to 18S Ct. Two representative immunoblots are shown below the corresponding graphs, and when immunoblot bands have been grouped from different parts of the same gel it is indicated by lines in the figure. One-way ANOVA (P<0.05) and post-hoc analysis (LSD-test, P<0.05): a, significant difference vs control cells and c, significant difference vs testosterone-treated cells.
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Effects of testosterone and its combined treatments with flutamide or E2 on the expression levels of mitochondrial dynamics (A) and adipogenic markers (C), adipokines and adiponectin receptors on 3T3-L1 adipocytes (B), and on intracellular and secreted adiponectin protein levels (D). E2, 17-β estradiol; FLT, flutamide; Mfn1, mitofusin 1; Opa1, optic atrophy protein 1; Fis1, fission protein 1; Drp1, dynamin-related protein; AdipoR1 and AdipoR2, adiponectin receptors 1 and 2; Pparg, peroxisome proliferator-activated receptor γ; ALBP/aP2, adipocyte lipid-binding protein aP2; Ad, adiponectin. 3T3-L1 adipocytes were treated with testosterone (1 μM) alone or in combination with FLT (10 μM) or with E2 (1 μM) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of three independent experiments performed in duplicate (n=6). Values of control cells were set as 100. GenEx Software was used to analyze the Ct values normalized to 18S Ct. Two representative immunoblots are shown below the corresponding graphs, and when immunoblot bands have been grouped from different parts of the same gel it is indicated by lines in the figure. One-way ANOVA (P<0.05) and post-hoc analysis (LSD-test, P<0.05): a, significant difference vs control cells and c, significant difference vs testosterone-treated cells.
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Effects of testosterone and its combined treatments with flutamide or E2 on the expression levels of mitochondrial dynamics (A) and adipogenic markers (C), adipokines and adiponectin receptors on 3T3-L1 adipocytes (B), and on intracellular and secreted adiponectin protein levels (D). E2, 17-β estradiol; FLT, flutamide; Mfn1, mitofusin 1; Opa1, optic atrophy protein 1; Fis1, fission protein 1; Drp1, dynamin-related protein; AdipoR1 and AdipoR2, adiponectin receptors 1 and 2; Pparg, peroxisome proliferator-activated receptor γ; ALBP/aP2, adipocyte lipid-binding protein aP2; Ad, adiponectin. 3T3-L1 adipocytes were treated with testosterone (1 μM) alone or in combination with FLT (10 μM) or with E2 (1 μM) for 24 h. Control cells were treated with the equivalent volume of vehicle. Values are expressed as the mean±s.e.m. of three independent experiments performed in duplicate (n=6). Values of control cells were set as 100. GenEx Software was used to analyze the Ct values normalized to 18S Ct. Two representative immunoblots are shown below the corresponding graphs, and when immunoblot bands have been grouped from different parts of the same gel it is indicated by lines in the figure. One-way ANOVA (P<0.05) and post-hoc analysis (LSD-test, P<0.05): a, significant difference vs control cells and c, significant difference vs testosterone-treated cells.
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Effect of hormonal treatments on adipokine and adiponectin receptor levels
Effects of E2, Pg, and testosterone on adipokines and adiponectin receptor expression are shown in Figs 2A, B, 3B, D and 4B, D respectively. E2 induced an increase in adiponectin protein content of 3T3-L1 adipocytes, which was reflected in the culture media levels. Neither adiponectin, nor resistin, nor adiponectin receptor mRNA levels were affected by E2 treatment. Pg-treated cells showed lower adiponectin mRNA and protein levels as well as lower adiponectin receptor expression than control cells. Combination of Pg and E2 treatments induced a greater decrease in adiponectin expression than Pg alone. Only AdipoR1 (Adipor1) mRNA levels recovered control values when FLT was added to Pg treatment. Pg+E2 treatment restored AdipoR2 (Adipor2) expression to control levels and increased AdipoR1 expression over control values. Resistin mRNA levels increased with Pg treatment, but the combination with either FLT or E2 returned it to control values. Testosterone treatment induced a decrease in adiponectin mRNA and protein levels and also in adiponectin receptor expression. FLT and E2 prevented this testosterone-associated decrease, and in the specific case of AdipoR1, the response overcame control levels. Resistin mRNA levels increased with testosterone treatment and decreased with both FLT and E2 addition.
Effect of hormonal treatments on the mRNA levels of adipogenic markers and on ER protein ratio
The expression of the adipogenic marker ALBP/aP2 (Fabp4) was enhanced in E2-treated cells (Fig. 2A). Pparg expression was not affected by E2 treatment but was downregulated by Pg (Fig. 3C). The addition of E2 induced an increase that resulted in higher levels than those in control cells. ER protein ratio (ERa:ERb) was unaffected by E2 and Pg treatments, whereas it was decreased by testosterone treatment (Fig. 5).
ERa:ERb ratio of protein levels in 3T3-L1 adipocytes after E2 (10 nM), Pg, or testosterone (1 μM both) treatment for 24 h and representative immunoblot are shown. ERa, estrogen receptor α; ERb, estrogen receptor β; E2, 17-β estradiol; Pg, progesterone. Values are expressed as the mean±s.e.m. of three independent experiments performed in duplicate (n=6). The values of control cells were set as 100. Two representative immunoblots are shown below the corresponding graphs, and when immunoblot bands have been grouped from different parts of the same gel it is indicated by lines in the figure. *Significant difference vs control cells (Student's t-test, P<0.05).
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
ERa:ERb ratio of protein levels in 3T3-L1 adipocytes after E2 (10 nM), Pg, or testosterone (1 μM both) treatment for 24 h and representative immunoblot are shown. ERa, estrogen receptor α; ERb, estrogen receptor β; E2, 17-β estradiol; Pg, progesterone. Values are expressed as the mean±s.e.m. of three independent experiments performed in duplicate (n=6). The values of control cells were set as 100. Two representative immunoblots are shown below the corresponding graphs, and when immunoblot bands have been grouped from different parts of the same gel it is indicated by lines in the figure. *Significant difference vs control cells (Student's t-test, P<0.05).
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
ERa:ERb ratio of protein levels in 3T3-L1 adipocytes after E2 (10 nM), Pg, or testosterone (1 μM both) treatment for 24 h and representative immunoblot are shown. ERa, estrogen receptor α; ERb, estrogen receptor β; E2, 17-β estradiol; Pg, progesterone. Values are expressed as the mean±s.e.m. of three independent experiments performed in duplicate (n=6). The values of control cells were set as 100. Two representative immunoblots are shown below the corresponding graphs, and when immunoblot bands have been grouped from different parts of the same gel it is indicated by lines in the figure. *Significant difference vs control cells (Student's t-test, P<0.05).
Citation: Journal of Molecular Endocrinology 52, 2; 10.1530/JME-13-0201
Discussion
Mitochondrial biogenesis is aimed at maintaining optimal mitochondrial function (Lee & Wei 2005). Our study reveals that E2 induces mitochondrial proliferation in white adipocytes – as indicated by the rise in mtDNA and in mitochondrial mass – through the increase in both Pgc1a and Pgc1b and also in Tfam expression. PGC1a is set as the master regulator of mitochondrial biogenesis. It activates NRFs that bind and upregulate the expression of nuclear genes encoding mitochondrial proteins, as well as the expression of Tfam, a factor involved in the regulation of the transcription and replication of the mitochondrial genome (Clayton 1992, Dairaghi et al. 1995, Puigserver & Spiegelman 2003). Along these lines, E2-induced Pgc1a upregulation also enhances mitochondrial differentiation or maturation in 3T3-L1 adipocytes, as revealed by the rise in Cox4 expression and in cardiolipin content. These results agree with our previous in vivo studies, in which we reported that the WAT of female rats showed a higher mitochondrial content than that of males, which was also associated with an increase in both Pgc1a and Tfam expression (Amengual-Cladera et al. 2012a,b).
Interestingly, the effects of testosterone on mitochondrial biogenesis are opposite to those observed with E2. This androgen promotes a decrease in mitochondrial mass (measured by MTG and by CS activity) in 3T3-L1 adipocytes in relation to control cells that is accompanied by a decrease in Pgc1b and Gabpa, but not in Pgc1a, thus indicating that E2 and testosterone effects in mitochondrial biogenesis are mediated by different pathways. Furthermore, the testosterone-induced decrease in ER ratio (ERa:ERb) would be in agreement with the negative effects of testosterone in mitochondrial biogenesis, because ERb, which is known to be activated by testosterone metabolites (Hiroi et al. 2013), represses NRFs expression and a subset of mitochondrial respiratory chain genes (O'Lone et al. 2007).
These opposite effects of E2 and testosterone in mitochondrial biogenesis are also evident in mitochondrial dynamics. Along with mitochondrial biogenesis, mitochondrial dynamics (i.e. fission and fusion processes) is crucial for proper mitochondrial function, and even mild defects in mitochondrial dynamics are associated with pathologies such as neuropathies, nonalcoholic fatty liver disease progression, and type 2 diabetes (Liesa et al. 2009, Zorzano et al. 2009, Galloway & Yoon 2012). We found that E2, which enhances mitochondrial biogenesis, stimulates both mitochondrial fusion and fission by upregulating Opa1 and Drp1 expression respectively. Thus, E2 helps to maintain active, balanced mitochondrial dynamics in white adipocytes that is a key to ensuring proper mitochondrial and, therefore, cell function. Meanwhile, Pg and testosterone upregulate fusion marker Mfn1 expression and impair fission through the decrease in Fis1 and Drp1 mRNA levels. This predominance of mitochondrial fusion over fission induced by testosterone treatment could be understood as a mechanism to counteract the impaired mitochondrial function promoted by this hormone, as enhanced fusion is known to preserve mitochondrial function by favoring content exchange between mitochondria (Detmer & Chan 2007).
The controversial effects of Pg on mitochondrial functionality are remarkable, because it promotes mitochondrial proliferation and fusion, and impairs mitochondrial maturation. It has been reported that progestins in high dosages can bind AR, given that it is closely related to the Pg receptor (Bardin et al. 1983). Pg can also be converted to testosterone in adipocytes, and thus can bind AR. In fact, we found that both Pg and testosterone would act over mitochondrial fission markers through AR, while fusion marker Mfn1 regulation seems to be AR independent, as the addition of FLT, an AR blocker (Labrie 1993), does not prevent the increase in Mfn1 mRNA levels. It is of great interest that E2 acts by rebalancing mitochondrial dynamics when administered with either testosterone or Pg, with all markers reaching the control levels. In 3T3-L1 adipocytes, E2 could act by counteracting stimuli that impair mitochondrial function. Thus, E2 effects on mitochondrial dynamics would be stronger in situations that imply an impairment of mitochondrial function than in control situations with full mitochondrial functionality. These findings reinforce our previous reported results in a rat model of high-fat, diet-induced mitochondrial dysfunction, in which WAT mitochondrial dynamics was impaired in males but not in females, which the hormonal milieu would protect from the negative effects of an obesogenic diet (Amengual-Cladera et al. 2012b).
Adiponectin is an insulin-sensitizing hormone that modulates energy expenditure and caloric intake (Galic et al. 2010), and its synthesis has been related to mitochondrial function in WAT (Koh et al. 2007, Wang et al. 2013). In agreement with this idea, the increase in both mitochondrial proliferation and maturation induced by E2 runs parallel to an increase in adiponectin synthesis and secretion in 3T3-L1 adipocytes. In our study, E2 also induces an increase in the differentiation status (reflected by the increase in the adipogenic marker ALBP/aP), which could be related to the increase in adiponectin expression, as adiponectin is known to exert autocrine actions in white adipocytes, regulating cytokine secretion (Dietze-Schroeder et al. 2005) and acting as a differentiation factor (Fu et al. 2005). A link between mitochondrial function and adiponectin synthesis is also suggested by testosterone treatment, as we observe a testosterone-induced decrease in adiponectin receptors and adiponectin expression that is consistent with the reported reduction in mitochondrial biogenesis. Such a decrease in adiponectin expression could be mediated by the lowering of Pparg mRNA levels, as adiponectin promoter presents PPAR-responsive elements, and PPARg is a key factor of the adipogenic program (Iwaki et al. 2003, Fu et al. 2005). Indeed, testosterone exerts direct effects on adiponectin secretion, as serum total and high molecular weight adiponectin concentrations are high in castrated rodents and hypogonadal men, and decrease after testosterone therapy (Nishizawa et al. 2002, Xu et al. 2005). As E2 and testosterone coadministration reverts the fall in the expression of both adiponectin and its receptors to the control situation, E2 is acting as a balancing factor in a situation of impaired cell function, as happened with mitochondrial dysfunction.
In conclusion, our study demonstrates the involvement of E2 in the stimulation of mitochondrial biogenesis in white adipocytes, whereas testosterone would have quite opposite effects. These alterations in mitochondrial capacities are paralleled in both cases by changes in adiponectin expression, thus suggesting a link between mitochondrial biogenesis and adiponectin synthesis in white adipocytes, but additional experiments would be necessary to demonstrate this. These data support and extend our previous in vivo observations, in which we reported higher WAT mitochondrial function in female rats than in males which was accompanied by greater adiponectin expression (Amengual-Cladera et al. 2012a,b,c). E2 also enhances mitochondrial dynamics, while testosterone stimulates fusion over fission, probably in an attempt to counteract the impairment of mitochondrial biogenesis promoted by this androgen. Furthermore, E2 stands out as an equilibrator of mitochondrial biogenesis and dynamics in situations that imply mitochondrial dysfunction, such as testosterone treatment, which is in agreement with our in vivo results indicating that mitochondrial dysfunction induced by high-fat diet had fewer detrimental effects in the adiponectin profile of female rats than in male rats (Amengual-Cladera et al. 2012a,b).
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by Dirección General de Investigación y Gestión del Plan Nacional de I+D+i (SAF2010-21792), Fondo de Investigaciones Sanitarias of the Spanish Government (PI 060293), and Comunitat Autònoma de les Illes Balears and FEDER (31/2011 and AAEE002/2012). G C-A was funded by a grant from the Conselleria d'Educació, Cultura i Universitats of the Balearic Islands Government, after being selected in the framework of an operating program cofinanced by the European Social Fund.
References
Amengual-Cladera E, Llado I, Gianotti M & Proenza AM 2012a Sex differences in the effect of high-fat diet feeding on rat white adipose tissue mitochondrial function and insulin sensitivity. Metabolism 61 1108–1117. (doi:10.1016/j.metabol.2011.12.016).
Amengual-Cladera E, Llado I, Proenza AM & Gianotti M 2012b High-fat diet feeding induces a depot-dependent response on the pro-inflammatory state and mitochondrial function of gonadal white adipose tissue. British Journal of Nutrition 109 413–424. (doi:10.1017/S0007114512001171).
Amengual-Cladera E, Llado I, Gianotti M & Proenza AM 2012c Retroperitoneal white adipose tissue mitochondrial function and adiponectin expression in response to ovariectomy and 17β-estradiol replacement. Steroids 77 659–665. (doi:10.1016/j.steroids.2012.02.012).
Anderson LA, McTernan PG, Barnett AH & Kumar S 2001 The effects of androgens and estrogens on preadipocyte proliferation in human adipose tissue: influence of gender and site. Journal of Clinical Endocrinology and Metabolism 86 5045–5051. (doi:10.1210/jcem.86.10.7955).
Attardi G & Schatz G 1988 Biogenesis of mitochondria. Annual Review of Cell Biology 4 289–333. (doi:10.1146/annurev.cb.04.110188.001445).
Bardin CW, Brown T, Isomaa VV & Janne OA 1983 Progestins can mimic, inhibit and potentiate the actions of androgens. Pharmacology & Therapeutics 23 443–459. (doi:10.1016/0163-7258(83)90023-2).
Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Analytical Biochemistry 72 248–254. (doi:10.1016/0003-2697(76)90527-3).
Chen H & Chan DC 2004 Mitochondrial dynamics in mammals. Current Topics in Developmental Biology 59 119–144. (doi:10.1016/S0070-2153(04)59005-1).
Chen H, Chomyn A & Chan DC 2005 Disruption of fusion results in mitochondrial heterogeneity and dysfunction. Journal of Biological Chemistry 280 26185–26192. (doi:10.1074/jbc.M503062200).
Chen H, Vermulst M, Wang YE, Chomyn A, Prolla TA, McCaffery JM & Chan DC 2010 Mitochondrial fusion is required for mtDNA stability in skeletal muscle and tolerance of mtDNA mutations. Cell 141 280–289. (doi:10.1016/j.cell.2010.02.026).
Clayton DA 1992 Transcription and replication of animal mitochondrial DNAs. International Review of Cytology 141 217–232. (doi:10.1016/S0074-7696(08)62067-7).
Dairaghi DJ, Shadel GS & Clayton DA 1995 Human mitochondrial transcription factor A and promoter spacing integrity are required for transcription initiation. Biochimica et Biophysica Acta 1271 127–134. (doi:10.1016/0925-4439(95)00019-Z).
Detmer SA & Chan DC 2007 Functions and dysfunctions of mitochondrial dynamics. Nature Reviews. Molecular Cell Biology 8 870–879. (doi:10.1038/nrm2275).
Dietze-Schroeder D, Sell H, Uhlig M, Koenen M & Eckel J 2005 Autocrine action of adiponectin on human fat cells prevents the release of insulin resistance-inducing factors. Diabetes 54 2003–2011. (doi:10.2337/diabetes.54.7.2003).
Fernández-Silva P, Enriquez JA & Montoya J 2003 Replication and transcription of mammalian mitochondrial DNA. Experimental Physiology 88 41–56. (doi:10.1113/eph8802514).
Fonseca-Alaniz MH, Takada J, Alonso-Vale MI & Lima FB 2007 Adipose tissue as an endocrine organ: from theory to practice. Journal of Pediatrics 83 S192–S203. (doi:10.1590/S0021-75572007000700011).
Fu Y, Luo N, Klein RL & Garvey WT 2005 Adiponectin promotes adipocyte differentiation, insulin sensitivity, and lipid accumulation. Journal of Lipid Research 46 1369–1379. (doi:10.1194/jlr.M400373-JLR200).
Galic S, Oakhill JS & Steinberg GR 2010 Adipose tissue as an endocrine organ. Molecular and Cellular Endocrinology 316 129–139. (doi:10.1016/j.mce.2009.08.018).
Galloway CA & Yoon Y 2012 Mitochondrial morphology in metabolic diseases. Antioxidants & Redox Signaling 19 415–30. (doi:10.1089/ars.2012.4779).
Garstka HL, Schmitt WE, Schultz J, Sogl B, Silakowski B, Perez-Martos A, Montoya J & Wiesner RJ 2003 Import of mitochondrial transcription factor A (TFAM) into rat liver mitochondria stimulates transcription of mitochondrial DNA. Nucleic Acids Research 31 5039–5047. (doi:10.1093/nar/gkg717).
Handschin C & Spiegelman BM 2006 Peroxisome proliferator-activated receptor γ coactivator 1 coactivators, energy homeostasis, and metabolism. Endocrine Reviews 27 728–735. (doi:10.1210/er.2006-0037).
Harwood HJ Jr 2012 The adipocyte as an endocrine organ in the regulation of metabolic homeostasis. Neuropharmacology 63 57–75. (doi:10.1016/j.neuropharm.2011.12.010).
Henry SL, Bensley JG, Wood-Bradley RJ, Cullen-McEwen LA, Bertram JF & Armitage JA 2012 White adipocytes: more than just fat depots. International Journal of Biochemistry & Cell Biology 44 435–440. (doi:10.1016/j.biocel.2011.12.011).
Hiroi R, Lacagnina AF, Hinds LR, Carbone DG, Uht RM & Handa RJ 2013 The androgen metabolite, 5α-androstane-3β,17β-diol (3β-diol), activates the oxytocin promoter through an estrogen receptor-β pathway. Endocrinology 154 1802–1812. (doi:10.1210/en.2012-2253).
Hong SC, Yoo SW, Cho GJ, Kim T, Hur JY, Park YK, Lee KW & Kim SH 2007 Correlation between estrogens and serum adipocytokines in premenopausal and postmenopausal women. Menopause 14 835–840. (doi:10.1097/gme.0b013e31802cddca).
Iwaki M, Matsuda M, Maeda N, Funahashi T, Matsuzawa Y, Makishima M & Shimomura I 2003 Induction of adiponectin, a fat-derived antidiabetic and antiatherogenic factor, by nuclear receptors. Diabetes 52 1655–1663. (doi:10.2337/diabetes.52.7.1655).
Koh EH, Park JY, Park HS, Jeon MJ, Ryu JW, Kim M, Kim SY, Kim MS, Kim SW & Park IS et al. 2007 Essential role of mitochondrial function in adiponectin synthesis in adipocytes. Diabetes 56 2973–2981. (doi:10.2337/db07-0510).
Labrie F 1993 Mechanism of action and pure antiandrogenic properties of flutamide. Cancer 72 3816–3827. (doi:10.1002/1097-0142(19931215)72:12+<3816::AID-CNCR2820721711>3.0.CO;2-3).
Lee HC & Wei YH 2005 Mitochondrial biogenesis and mitochondrial DNA maintenance of mammalian cells under oxidative stress. International Journal of Biochemistry & Cell Biology 37 822–834. (doi:10.1016/j.biocel.2004.09.010).
Lee YJ, Jeong SY, Karbowski M, Smith CL & Youle RJ 2004 Roles of the mammalian mitochondrial fission and fusion mediators Fis1, Drp1, and Opa1 in apoptosis. Molecular Biology of the Cell 15 5001–5011. (doi:10.1091/mbc.E04-04-0294).
Liesa M, Palacin M & Zorzano A 2009 Mitochondrial dynamics in mammalian health and disease. Physiological Reviews 89 799–845. (doi:10.1152/physrev.00030.2008).
Lu RH, Ji H, Chang ZG, Su SS & Yang GS 2010 Mitochondrial development and the influence of its dysfunction during rat adipocyte differentiation. Molecular Biology Reports 37 2173–2182. (doi:10.1007/s11033-009-9695-z).
Maniura-Weber K, Goffart S, Garstka HL, Montoya J & Wiesner RJ 2004 Transient overexpression of mitochondrial transcription factor A (TFAM) is sufficient to stimulate mitochondrial DNA transcription, but not sufficient to increase mtDNA copy number in cultured cells. Nucleic Acids Research 32 6015–6027. (doi:10.1093/nar/gkh921).
Mattingly KA, Ivanova MM, Riggs KA, Wickramasinghe NS, Barch MJ & Klinge CM 2008 Estradiol stimulates transcription of nuclear respiratory factor-1 and increases mitochondrial biogenesis. Molecular Endocrinology 22 609–622. (doi:10.1210/me.2007-0029).
Nakano K, Tarashima M, Tachikawa E, Noda N, Nakayama T, Sasaki K, Mizoguchi E, Matsuzaki M & Osawa M 2005 Platelet mitochondrial evaluation during cytochrome c and dichloroacetate treatments of MELAS. Mitochondrion 5 426–433. (doi:10.1016/j.mito.2005.10.002).
Nishizawa H, Shimomura I, Kishida K, Maeda N, Kuriyama H, Nagaretani H, Matsuda M, Kondo H, Furuyama N & Kihara S et al. 2002 Androgens decrease plasma adiponectin, an insulin-sensitizing adipocyte-derived protein. Diabetes 51 2734–2741. (doi:10.2337/diabetes.51.9.2734).
O'Lone R, Knorr K, Jaffe IZ, Schaffer ME, Martini PG, Karas RH, Bienkowska J, Mendelsohn ME & Hansen U 2007 Estrogen receptors α and β mediate distinct pathways of vascular gene expression, including genes involved in mitochondrial electron transport and generation of reactive oxygen species. Molecular Endocrinology 21 1281–1296. (doi:10.1210/me.2006-0497).
Puigserver P & Spiegelman BM 2003 Peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α): transcriptional coactivator and metabolic regulator. Endocrine Reviews 24 78–90. (doi:10.1210/er.2002-0012).
Roncari DA & Van RL 1978 Promotion of human adipocyte precursor replication by 17β-estradiol in culture. Journal of Clinical Investigation 62 503–508. (doi:10.1172/JCI109153).
Ronti T, Lupattelli G & Mannarino E 2006 The endocrine function of adipose tissue: an update. Clinical Endocrinology 64 355–365. (doi:10.1111/j.1365-2265.2006.02474.x).
Scarpulla RC 1997 Nuclear control of respiratory chain expression in mammalian cells. Journal of Bioenergetics and Biomembranes 29 109–119. (doi:10.1023/A:1022681828846).
Scarpulla RC 2011 Metabolic control of mitochondrial biogenesis through the PGC-1 family regulatory network. Biochimica et Biophysica Acta 1813 1269–1278. (doi:10.1016/j.bbamcr.2010.09.019).
Spiegelman BM, Choy L, Hotamisligil GS, Graves RA & Tontonoz P 1993 Regulation of adipocyte gene expression in differentiation and syndromes of obesity/diabetes. Journal of Biological Chemistry 268 6823–6826.
Trujillo ME & Scherer PE 2006 Adipose tissue-derived factors: impact on health and disease. Endocrine Reviews 27 762–778. (doi:10.1210/er.2006-0033).
Twig G, Elorza A, Molina AJ, Mohamed H, Wikstrom JD, Walzer G, Stiles L, Haigh SE, Katz S & Las G et al. 2008 Fission and selective fusion govern mitochondrial segregation and elimination by autophagy. EMBO Journal 27 433–446. (doi:10.1038/sj.emboj.7601963).
Wang CH, Wang CC, Huang HC & Wei YH 2013 Mitochondrial dysfunction leads to impairment of insulin sensitivity and adiponectin secretion in adipocytes. FEBS Journal 280 1039–1050. (doi:10.1111/febs.12096).
Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, Troy A, Cinti S, Lowell B & Scarpulla RC et al. 1999 Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98 115–124. (doi:10.1016/S0092-8674(00)80611-X).
Xu A, Chan KW, Hoo RL, Wang Y, Tan KC, Zhang J, Chen B, Lam MC, Tse C & Cooper GJ et al. 2005 Testosterone selectively reduces the high molecular weight form of adiponectin by inhibiting its secretion from adipocytes. Journal of Biological Chemistry 280 18073–18080. (doi:10.1074/jbc.M414231200).
Zorzano A, Liesa M & Palacin M 2009 Role of mitochondrial dynamics proteins in the pathophysiology of obesity and type 2 diabetes. International Journal of Biochemistry & Cell Biology 41 1846–1854. (doi:10.1016/j.biocel.2009.02.004).
