Telmisartan improves kidney function through inhibition of the oxidative phosphorylation pathway in diabetic rats

in Journal of Molecular Endocrinology

Telmisartan provides renal benefit at all stages of the renal continuum in patients with type 2 diabetes mellitus. This research is to investigate the effect of telmisartan on kidney function in diabetic rats and to identify the underlying molecular mechanisms. Diabetic rats were divided into vehicle group, low dosage (TeL) group, and high dosage of telmisartan (TeH) group. We performed Illumina RatRef-12 Expression BeadChip gene array experiments. We found 3-months of treatment with telmisartan significantly decreased 24-h urinary albumin, serum creatinine, blood urea nitrogen, and increased creatinine clearance rate. Kidney hypertrophy and glomerular mesangial matrix expansion were ameliorated. The glomeruli from the TeH group had 1541 genes with significantly changed expression (554 increased, 987 decreased). DAVID (Database for annotation, visualization and Integrated discovery) analyses showed that the most enriched term was ‘mitochondrion’ (Gene Ontology (GO:0005739)) in all 67 GO functional categories. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses indicated that all differentially expressed genes included seven KEGG pathways. Of those pathways, four are closely related to the oxidative phosphorylation pathway. Quantitative real-time PCR verified that the H+ transporting mitochondrial F1 complex, beta subunit (Atp5b), cytochrome c oxidase subunit VIc (Cox6c), and NADH dehydrogenase (ubiquinone) Fe-S protein 3 (Ndufs3) were significantly downregulated both in TeL and TeH groups, while nephrosis 1 homolog (Nphs1) and nephrosis 2 homolog (Nphs2) were significantly upregulated. The increased expression of malonaldehyde and NDUFS3 in the glomeruli of diabetic rats was attenuated by telmisartan. The other significantly changed pathway we found was the peroxisome proliferator-activated receptor (PPAR) signaling pathway. Our data suggest that telmisartan can improve kidney function in diabetic rats. The mechanism may be involved in mitochondrion oxidative phosphorylation, the PPAR-γ pathway, and the slit diaphragm.

Abstract

Telmisartan provides renal benefit at all stages of the renal continuum in patients with type 2 diabetes mellitus. This research is to investigate the effect of telmisartan on kidney function in diabetic rats and to identify the underlying molecular mechanisms. Diabetic rats were divided into vehicle group, low dosage (TeL) group, and high dosage of telmisartan (TeH) group. We performed Illumina RatRef-12 Expression BeadChip gene array experiments. We found 3-months of treatment with telmisartan significantly decreased 24-h urinary albumin, serum creatinine, blood urea nitrogen, and increased creatinine clearance rate. Kidney hypertrophy and glomerular mesangial matrix expansion were ameliorated. The glomeruli from the TeH group had 1541 genes with significantly changed expression (554 increased, 987 decreased). DAVID (Database for annotation, visualization and Integrated discovery) analyses showed that the most enriched term was ‘mitochondrion’ (Gene Ontology (GO:0005739)) in all 67 GO functional categories. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses indicated that all differentially expressed genes included seven KEGG pathways. Of those pathways, four are closely related to the oxidative phosphorylation pathway. Quantitative real-time PCR verified that the H+ transporting mitochondrial F1 complex, beta subunit (Atp5b), cytochrome c oxidase subunit VIc (Cox6c), and NADH dehydrogenase (ubiquinone) Fe-S protein 3 (Ndufs3) were significantly downregulated both in TeL and TeH groups, while nephrosis 1 homolog (Nphs1) and nephrosis 2 homolog (Nphs2) were significantly upregulated. The increased expression of malonaldehyde and NDUFS3 in the glomeruli of diabetic rats was attenuated by telmisartan. The other significantly changed pathway we found was the peroxisome proliferator-activated receptor (PPAR) signaling pathway. Our data suggest that telmisartan can improve kidney function in diabetic rats. The mechanism may be involved in mitochondrion oxidative phosphorylation, the PPAR-γ pathway, and the slit diaphragm.

Keywords:

Introduction

Diabetes mellitus (DM) is considered to be a metabolic disorder with different etiologies characterized by hyperglycemia resulting from defects in insulin secretion and/or action. In 2000, 171 million cases of DM worldwide were estimated, and that number is expected to increase to 366 million cases in 2030 (Wild et al. 2004). The increasing prevalence of DM has led to a growing number of chronic complications including diabetic nephropathy (DN; Wu et al. 2005). Approximately 30% of patients with either type 1 or type 2 DM develop DN. DN is the single most common cause of end-stage renal disease (ESRD) in adults. The lifetime risk of developing DN with progression to ESRD is roughly equivalent in type 1 and type 2 DM (Ritz & Orth 1999). The presence of DN heralds a marked increase in patient morbidity and premature mortality, and significantly impacts on the cost of care (White et al. 2008). While mortality with diabetic renal disease can precede progression to ESRD, diabetes in those with ESRD remains a significant predictor for increased cardiovascular risk and mortality.

DN is characterized by a set of diabetic pathophysiological changes, which begin with glomerular hyperfiltration and renal hypertrophy, and then progress to proteinuria and glomerular filtration rate reduction. As the molecular mechanisms leading to ESRD in DN are still unknown, treatment of DN becomes complex and the therapeutic goal is difficult to achieve.

Telmisartan is one of the angiotensin receptor blockers (ARBs). Moreover, it acts as a partial agonist of peroxisome proliferator-activated receptor γ (PPARγ). Recent evidence shows that telmisartan provides renal benefit at all stages of the renal continuum in patients with type 2 DM. It improves endothelial function in patients with normoalbuminuria (Benndorf et al. 2007), delays the progression to overt nephropathy in patients with microalbuminuria (Makino et al. 2007), and reduces proteinuria in patients with macroalbuminuria (Bakris et al. 2008). With greater tolerability, the effectiveness of telmisartan is equivalent to angiotensin-converting enzyme. The effect of telmisartan on protein excretion in DN appears to be better than that of losartan (Bakris et al. 2008) and equivalent to that of valsartan (Galle et al. 2008). In the ONTARGET study, telmisartan provided similar cardiovascular protection to ramipril in patients with DM, while being better tolerated and having fewer treatment discontinuations (ONTARGET Investigators et al. 2008).

However, little is known about the mechanism underlying the renal protection of telmisartan. In the present study, we aimed to find the mechanism of telmisartan improving kidney function by using gene array experiments.

Gene expression profiling using microarray analysis has been used to study biological signaling pathways in many studies (Ghanaat-Pour et al. 2007). By comparing the gene expression profiles of treatment groups with the vehicle group, we can identify the putative molecular mechanisms for the renal protective effects of telmisartan in diabetic rats.

Materials and methods

Animal modeling, grouping, and treatment

Male Sprague–Dawley rats (200–250 g) were purchased from the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences and Peking Union Medical College (Beijing, China, SCXK-2011-0010). According to the previous study (Onozato et al. 2008), diabetic models were administered with a single dose of streptozotocin (STZ, 60 mg/kg, tail vein), formulated in 0.1 mmol/l citrate buffer, pH 4.5 (Sigma–Aldrich). One week after STZ injection, the random blood glucose level of the diabetic rats was measured to confirm hyperglycemia. Random blood glucose concentrations that were above 16.7 mmol/l were used to define rats as diabetic. Diabetic rats with a similar degree of hyperglycemia were randomly divided into three groups: vehicle, and low dose (TeL), and high dose (TeH) telmisartan groups (n=10, in each group). The typical human daily dose of telmisartan is 40 mg/50 kg body weight, and according to the formula: drat=dhuman×0.71/0.11 (Huang et al. 2004), the corresponding dose of telmisartan for rats is 5.16 mg/kg per day, so we selected 5 and 10 mg/kg per day as low and high dosages respectively. The control (n=10) and vehicle group received 0.5% saline, whereas the TeL and TeH groups were given telmisartan (Boehringer Ingelheim, Ingelheim am Rheim, Germany) at 5 and 10 mg/kg in 0.5% saline respectively. The drug was dosed once daily using a gastric gavage for 12 weeks. All animals were housed in an environmentally controlled room at 25 °C in a 12 h light:12 h darkness cycle and given free access to food and water throughout the experimental period. Fasting animals were allowed free access to water. After 12 weeks of treatment, blood samples were taken from rats after anesthesia. The rats were then killed and their left kidneys were weighed. An index of renal hypertrophy was estimated by comparing the weight of the left kidney with the body weight. Some kidney tissue was then collected. Glomeruli were isolated by using the conventional sieving method (Schlondorff 1990). In brief, kidneys were minced well on ice and forced through sequential steel sieves, and glomeruli were collected with the use of cold PBS, transferred into a tube, and pelleted for 1 min at 1200 g. The supernatant was removed and then glomeruli were stored in dry ice to perform the microarray and quantitative real-time PCR (qRT-PCR) experiments. Some kidneys were fixed in 10% neutralized formalin for histology. All procedures involving animals were approved by the animal care and use committee of the Peking Union Medical College Hospital (Beijing, China, MC-07-6004) and were conducted in compliance with Guide of the Care and Use of Laboratory Animals (NIH publication No. 86-23, revised 1996). All surgery was performed under sodium pentobarbital anesthesia, and all efforts were made to minimize suffering.

Measurement of body weight and fasting blood glucose levels

Body weight was monitored monthly. The 6-h fasting blood glucose (FBG) level was measured monthly using a BREEZE 2 glucometer (Bayer) with blood from a tail bleed.

Measurement of urine parameters

The 24-h urine samples were collected at the 12th week. The rats were housed in metabolic cages for 24 h to collect urine samples. Urine samples were centrifuged at 3000 g for 10 min (Varifuge Heraeus 3.0, Hamburg, Germany) to remove any suspended particles and were stored in aliquots at −80 °C. Urine protein and creatinine levels were measured with an Olympus AU 5400 analyzer (Olympus Diagnostica, Hamburg, Germany). Urinary protein was determined by the sulfosalicylic acid method. Urine creatinine level was measured by creatinine enzymatic assay. Creatinine clearance rate (Ccr) was calculated as (urinary creatinine×urine volume produced per minute)/(serum creatinine×body weight), and was expressed as milliliter per minute per kilogram.

Serum biochemistry analysis

In the 12th week, after euthanasia, blood samples were taken. The blood samples were centrifuged at 3000 g for 10 min, and serum was stored in aliquots at −80 °C. Serum creatinine and blood urea nitrogen (BUN) were measured with an Olympus AU 5400 analyzer (Olympus Diagnostica). Serum creatinine level was measured by creatinine enzymatic assay. BUN was measured by urease method.

Renal histological analysis

The kidneys from the control, vehicle, and TeH groups (n=10, in each group) were removed and embedded in paraffin to prepare 4-μm tissue slices. The tissue slices were stained with periodic acid-Schiff (PAS) for histological evaluation. The mesangial expansion index was scored in four levels from 0 to 3, with the index scores defined as follows (Border et al. 1990): 0, normal glomeruli; 1, matrix expansion occurred in up to 50% of a glomerulus; 2, matrix expansion occurred in 50–75% of a glomerulus; and 3, matrix expansion occurred in 75–100% of a glomerulus from kidney slices of each rat, and the means were calculated.

RNA preparation and microarray experiments

Glomeruli were taken from the TeH and vehicle groups (n=3, in each group) to perform the microarray experiments. Before the microarray experiment, each total RNA was processed with RNase-free Dnase (Qiagen). RNA was reverse transcribed by Superscript II (Invitrogen). The Illumina RatRef-12 Expression BeadChip contains 22 524 probes for a total of 22 228 rat genes selected primarily from the NCBI RefSeq database (Release 16; Illumina, San Diego, CA, USA), and was used in accordance with the manufacturer's instructions. All reagents were optimized for use with Illumina's Whole-Genome Expression platform. Total RNA of 200 ng was used for cRNA in vitro transcription and labeling with the TotalPrep RNA Labeling Kit using Biotinylated-UTP (Ambion, Austin, TX, USA). Hybridization was carried out in Illumina Intellihyb chambers at 58 °C for 18.5 h, followed by washing and staining, in accordance with the Illumina Hybridization System Manual. The signal was developed by staining with Cy3-streptavidin. The BeadChip was scanned on a high resolution Illumina BeadArray reader, using a two-channel, 0.8-μm resolution confocal laser scanner.

Data extraction and normalization

Illumina BeadStudio software (version 2.0) was used to extract and normalize the expression data (fluorescence intensities) for the mean intensity of all arrays. Genes expressed in all arrays were selected for analyses. Normalized data were analyzed using the Student's t-test and logistic regression.

Gene array data analysis

Subsequently, signals were averaged for glomeruli from the TeH and vehicle group rats, and fold changes were calculated based on average values from each group. DiffScore and Illumina Custom from the BeadStudio software package were used to determine the differentially expressed genes. The DiffScore was defined using the following formula: 10×sgn(μcond−μref)×(log10(p)). We established the following two criteria, based on the instructions of the Illumina platform, to identify the differentially expressed genes: 1) detection P value <0.01 in either of the two sample groups; and 2) DiffScore>13 (corresponding to P value <0.05), under the Benjamini–Hochberg false discovery rate (FDR) correction for multiple tests (Benjamini & Hochberg 1995). Cluster analyses (Stanford University, Palo Alto, CA, USA) were done using software developed by the methods (Eisen et al. 1998). To assign biological meaning to the group of genes with changed expression, the subset of genes that met the above criteria was analyzed with the Gene Ontology (GO) classification system and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, using DAVID (Database for annotation, visualization and integrated discovery) software (http://david.abcc.ncifcrf.gov/; Dennis et al. 2003). Overrepresentation of genes with altered expression within specific GO categories was determined using the one-tailed Fisher exact probability test modified by the addition of a jack-knifing procedure, which penalizes the significance of categories with very few (e.g. one or two) genes and favors more robust categories with larger numbers of genes (Hosack et al. 2003).

qRT-PCR analysis

For validation of the microarray results, five genes from the gene list were selected for qRT-PCR analysis. Each qRT-PCR assay was repeated using three biological replicates and each analysis consisted of three technical replicates. Before PCR, each total RNA was processed with Rnase-free Dnase (Qiagen). RNA was reverse transcribed by Superscript II (Invitrogen). The primers were designed using Applied Biosystems (Foster City, CA, USA) Primer Express design software. Primers were purchased from Applied Biosystems. The reaction production could be accurately measured in the exponential phase of amplification by the ABI prism 7700 Sequence Detection System, with the following cycling conditions: an initial denaturation at 48 °C for 30 min, 95 °C for 15 min, 40 cycles of 95 °C for 15 s, 55 °C for 1 min, and a final unlimited 4 °C hold. The sequences of the primers used are listed in Table 1. The signal of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used for normalization. Relative quantification of the mRNA between telmasartan and the method (vehicle) group was calculated using the comparative threshold cycle (C) method (Livak et al. 2001).

Table 1

Oligonucleotide sequences for qRT-PCR analysis

Gene symbolForward primerReverse primer
Atp5bACCACCAAGAAGGGCTCGATGCATCCAAATGGGCAAAGG
Cox6cCAGCTTTGTATAAGTTTCGTGTGGACCAGCCTTCCTCATCTCCT
Ndufs3GGCTTCGAGGGACATCCTTTCCFCTTCACCTCATCGTCAT
Nphs1CCCCAACATCGACTTCACTTCTGGATGTTGGTGTGGTCAG
Nphs2CCTGTGTTTGGGGCATCAATCTCAGCCGCCATCCTC
GadphGACCCCTTCATTGACCTCAACCGCTCCTGGAAGATGGTGATG

Atp5b, H+ transporting mitochondrial F1 complex, beta subunit; Cox6c, cytochrome c oxidase subunit VIc; Ndufs3, NADH dehydrogenase (ubiquinone) Fe-S protein 3; Nphs1, nephrosis 1 homolog; Nphs2, nephrosis 2 homolog; Gadph, glyceraldehyde-3-phosphate dehydrogenase.

Immunohistochemistry staining

Renal tissues from the control, vehicle, and TeH groups (n=10, in each group) were fixed in 10% neutral buffered formalin, cast in paraffin, sliced into 4-μm sections, and placed onto microscope slides. After removal of the paraffin by xylene and dehydration by graded alcohol, slides were immersed in distilled water. Kidney sections were then transferred into a 10 mmol/l citrate buffer solution and heated at 80 °C for 5 min for antigen retrieval. After washing, 3.0% peroxide was applied for 20 min to block the activity of endogenous peroxidase. The sections were then incubated in blocking solution (5% BSA) for 1 h at room temperature, followed by treatment with human monoclonal anti-malonaldehyde (MDA) antibody (1:50; Calbiochem Co., Darmstadt, Germany) and rabbit polyclonal anti-NDUFS3 antibody (1:50, 15066-1-AP; Proteintech Group, Inc., Chicago, IL, USA), where indicated overnight at 4 °C. Negative control sections were stained under the identical conditions by substituting the primary antibody with equivalent concentrations of normal rabbit IgG. After washing with PBS, the slides were incubated with the labeled streptavidin biotin reagent, following the manufacturer's instructions. Immunoreactive products were made visible by diaminobezidine (DAB) reaction. Sections were counterstained with hematoxylin for 15 s. Brownish yellow granular or linear deposits were interpreted as positive areas. To evaluate the immunostaining, a total of more than 30 randomly chosen glomeruli per rat were coded and graded in a blind manner. Each score reflects changes in the extent rather than the intensity of staining and depends on the percentage of positive glomeruli. The degree of MDA and NDUFS3 expression in ten rats from each group was graded as follows: 0, absent or <25% staining; 1, 25–50% positive staining; 2, 50–75% positive staining; and 3, more than 75% positive staining (Gross et al. 2003).

Statistical analysis

All results are expressed as mean±s.d. Statistical analysis was performed with ANOVA followed by a Student's t-test. P<0.05 was considered statistically significant. Analysis was done with SPSS 11.0 (SPSS, Inc., Chicago, IL, USA).

Results

Telmisartan showed no influence on body weight and FBG of diabetic rats

As shown in Table 2, the mean body weight of diabetic rats decreased significantly compared with the control rats at month 1 (P<0.05), month 2 (P<0.01), and month 3 (P<0.01). The FBG levels of the diabetic rats were significantly higher than those of the control rats at month 1 (P<0.01), month 2 (P<0.01), and month 3 (P<0.01) (Table 3). However, neither body weight nor FBG was significantly different between the vehicle- and telmisartan-treated groups.

Table 2

Body weight (g) of rats during 3 months. Data represent mean±s.d. (n=10)

Groups0 Month1 Month2 Months3 Months
Control246.6±18.3262.4±17.0273.4±10.1292.6±19.9
Vehicle250.0±12.8255.8±12.4*252.8±10.0259.2±12.7
TeL261.4±18.2266.2±13.9*269.5±19.4268.9±12.5
TeH257.6±14.9261.2±12.1*255.9±11.6260.8±12.4

TeL, low dose of telmisartan; TeH, high dose of telmisartan. *P<0.05, P<0.01 vs the control group.

Table 3

Fasting blood glucose (mmol/l) of rats during 3 months. Data represent mean±s.d. (n=10)

Groups0 Month1 Month2 Months3 Months
Control6.5±0.66.3±0.76.4±0.56.7±0.3
Vehicle19.6±3.4*18.9±4.1*19.2±5.3*19.4±6.0*
TeL19.4±3.4*18.8±5.8*19.1±4.4*18.7±3.9*
TeH19.9±3.7*18.7±3.4*18.5±4.9*19.2±4.6*

TeL, low dose of telmisartan; TeH, high dose of telmisartan. *P<0.01 vs the control group.

Telmisartan moderated kidney dysfunction in diabetic rats

The Ccr of diabetic rats was significantly suppressed (P<0.01), whereas the 24-h urinary albumin (P<0.01), serum creatinine (P<0.05), and BUN (P<0.01) of diabetic rats became significantly elevated compared with the control rats. Telmisartan significantly reduced 24-h urinary albumin, serum creatinine, and BUN in all dose groups at month 3. The Ccr of the telmisartan-treated group was significantly increased compared with that of the vehicle-treated group (Fig. 1).

Figure 1
Figure 1

The effects of telmisartan treatment on 24-h (A) urinary albumin, (B) Ccr, (C) serum creatinine, and (D) serum urea nitrogen in rats (n=10, in each group). Data represent mean±s.d. (n=10). #P<0.05, ##P<0.01 vs the vehicle-treated group; *P<0.05, **P<0.01 vs the control group.

Citation: Journal of Molecular Endocrinology 49, 1; 10.1530/JME-12-0020

Telmisartan moderated the kidney hypertrophy in diabetic rats

At the end of study period, the mean left kidney weight and the ratio of left kidney weight to body weight of diabetic rats were significantly increased compared with the control group (P<0.05). As shown in Table 4, the treatment of diabetic rats with 3 months of telmisartan reduced the degree of renal hypertrophy (P<0.05).

Table 4

Effect of telmisartan on hypertrophy-related parameters of diabetic rats. Data represent mean±s.d. (n=10)

GroupsLeft kidney weight (g)Left kidney weight/body weight (mg/g)
Control1.9±0.13.8±0.3
Vehicle3.3±0.2*8.2±0.4*
TeL3.0±0.1*,6.0±0.2*,
TeH2.9±0.2*,6.5±0.3*,

TeL, low dose of telmisartan; TeH, high dose of telmisartan. *P<0.05 vs the control group. P<0.05 vs the vehicle group.

Telmisartan moderated renal histology in diabetic rats

The control group had normal histology (Fig. 2A), while histological examination of the diabetic rat kidneys revealed marked histological changes in glomerular and tubular structure (Fig. 2B). Although the effect induced by telmisartan was not achieved to that of normal group, the mesangial matrix fraction in the telmisartan group was reduced compared with that of vehicle group (Fig. 2C). The index of glomerular matrix expansion in the TeH group was significantly decreased compared with the vehicle group (P<0.05, Fig. 2D).

Figure 2
Figure 2

Histological staining with periodic acid-Schiff in glomeruli (A, B, and C, original magnification, 200×) shows the glomerular and tubulointerstitial structure of the (A) control group, (B) vehicle-treated group, and (C) TeH group. Expansion of the glomerular matrix was scored using four levels and an average value was obtained from analyses of ten rats in each group and more than 30 glomeruli for each rat (D). Data represent mean±s.d. (n=10). #P<0.05 vs the vehicle-treated group; **P<0.01 vs the control group. Full colour version of this figure available via http://dx.doi.org/10.1530/JME-12-0020.

Citation: Journal of Molecular Endocrinology 49, 1; 10.1530/JME-12-0020

Gene differentially regulated by TeH

There were 1541 differentially expressed genes identified in glomeruli between TeH and vehicle groups. Of those, 554 genes (35.9%) were expressed in increased levels; whereas 987 genes (64.1%) were downregulated in the TeH group. Hierarchical clustering based on similarity in gene expression using all differentially expressed genes highlighted the difference in the transcriptional profiles between the TeH and vehicle groups.

DAVID analysis of all differentially expressed genes in TeH group yielded 67 GO-categories (Table 5). The most enriched term was ‘mitochondrion’ (GO:0005739). There were 233 (FDR=7.74×10−38) differentially expressed genes from glomeruli associated with this GO term.

Table 5

Gene ontology groups with significant overrepresentation among genes with significantly changed expression in TeH (FDR<0.001)

GO classificationGO termGO IDCountFold enrichmentFDR
Biological processTranslational elongationGO:0006414497.3722.21×1027
TranslationGO:0006412973.2391.66×1022
Generation of precursor metabolites and energyGO:0006091613.6638.55×1016
Cofactor metabolic processGO:0051186453.1841.37×108
Acetyl-CoA metabolic processGO:0006084197.1462.13×108
Coenzyme metabolic processGO:0006732393.4832.42×108
Oxidation reductionGO:0055114902.1012.81×108
Alcohol catabolic processGO:0046164234.5653.27×106
Carbohydrate catabolic processGO:0016052273.9373.35×106
Cellular carbohydrate catabolic processGO:0044275224.3671.94×105
Purine ribonucleotide metabolic processGO:0009150323.1542.79×105
GlycolysisGO:0006096175.3994.81×105
Glucose catabolic processGO:0006007194.7645.52×105
Ribonucleotide metabolic processGO:0009259323.0496.46×105
Oxidative phosphorylationGO:0006119214.2278.32×105
Hexose catabolic processGO:0019320194.6021.01×104
Monosaccharide catabolic processGO:0046365194.6021.01×104
RNA processingGO:0006396552.1831.21×104
Purine ribonucleoside triphosphate metabolic processGO:0009205283.2011.89×104
Acetyl-CoA catabolic processGO:0046356127.4572.05×104
Ribonucleoside triphosphate metabolic processGO:0009199283.1762.25×104
Nitrogen compound biosynthetic processGO:0044271512.2152.45×104
Purine nucleoside triphosphate metabolic processGO:0009144283.0784.41×104
Purine ribonucleoside triphosphate biosynthetic processGO:0009206253.3394.58×104
ATP synthesis coupled proton transportGO:0015986164.9714.89×104
Energy coupled proton transport, down electrochemical gradientGO:0015985164.9714.89×104
Ribonucleoside triphosphate biosynthetic processGO:0009201253.3085.50×104
Purine nucleoside triphosphate biosynthetic processGO:0009145253.3085.50×104
Ion transmembrane transportGO:0034220184.3605.93×104
Purine ribonucleotide biosynthetic processGO:0009152273.1126.04×104
Nucleoside triphosphate biosynthetic processGO:0009142253.2487.89×104
Coenzyme catabolic processGO:0009109126.5969.63×104
Cellular constituentMitochondrionGO:00057392332.3947.74×1038
CytosolGO:00058292032.3322.90×1030
Mitochondrial partGO:00444291273.1673.59×1030
Ribonucleoprotein complexGO:00305291082.7301.72×1019
Ribosomal subunitGO:0033279396.0358.95×1018
RibosomeGO:0005840813.1331.10×1017
Mitochondrial inner membraneGO:0005743733.3133.99×1017
Mitochondrial lumenGO:0031980554.0362.13×1016
Mitochondrial matrixGO:0005759554.0362.13×1016
Organelle inner membraneGO:0019866733.1141.65×1015
Cytosolic partGO:0044445424.941.73×1015
Mitochondrial envelopeGO:0005740832.7541.57×1014
Mitochondrial membraneGO:00319661352.8023.75×1014
Cytosolic ribosomeGO:0022626276.7994.77×1013
Organelle envelopeGO:0031967932.1837.62×1010
EnvelopeGO:0031975932.1671.18×109
Organelle membraneGO:00310901351.8421.38×109
Membrane-enclosed lumenGO:00319741661.6982.06×109
Intracellular organelle lumenGO:00700131571.7115.52×109
Organelle lumenGO:00432331611.6936.52×109
Cytosolic small ribosomal subunitGO:0022627196.5955.63×108
Small ribosomal subunitGO:0015935215.6191.57×107
Large ribosomal subunitGO:0015934186.4213.60×107
Mitochondrial membrane partGO:0044455253.7772.30×105
MelanosomeGO:0042470213.6946.20×104
Pigment granuleGO:0048770213.6946.20×104
Molecular functionStructural constituent of ribosomeGO:000373573 3.529 3.50×1018
Cofactor bindingGO:0048037602.9111.52×1010
Coenzyme binding GO:0050662483.1165.09×109
Monovalent inorganic cation transmembrane transporter activityGO:0015077304.5177.98×109
Hydrogen ion transmembrane transporter activityGO:0015078294.6041.15×108
Structural molecule activityGO:0005198852.1483.17×108
Nucleotide bindingGO:00001662031.5162.15×107
Inorganic cation transmembrane transporter activityGO:0022890333.4181.74×106
Oxidoreductase activity, acting on NADH or NADPHGO:0016651184.6122.18×104

FDR, false discovery rate.

The aforementioned DAVID annotation tool was used for identification of putative KEGG pathways. The genes could be mapped to seven pathways (FDR<0.001, Table 6). The most common type of enriched pathway was related to ‘ribosome’ (FDR=1.12×10−29). The second most abundant pathway was related to ‘oxidative phosphorylation’ (FDR=6.77×10−13). Other pathways included those for ‘Parkinson's disease’ (FDR=1.55×10−7), ‘citrate cycle (TCA cycle)’ (FDR=4.88×10−7), ‘pyruvate metabolism’ (FDR=8.32×10−7), ‘PPAR signaling pathway’ (FDR=2.79×10−6), and ‘glycolysis/gluconeogenesis’ (FDR=2.48×10−5). Of those pathways, four were closely related to the oxidative phosphorylation pathway. These pathways included ‘oxidative phosphorylation’, ‘citrate cycle’, ‘pyruvate metabolism’, and ‘glycolysis/gluconeogenesis’. In the ‘oxidative phosphorylation’ pathway in particular, 95 genes were represented on the gene array, out of which 46 genes were differentially expressed. There were ten genes upregulated and 36 genes downregulated in this pathway.

Table 6

KEGG pathway (FDR<0.001, fold enrichment>2.0)

KEGG_IDTermCountTotal number of genes in the pathwayFold enrichmentFDRGenes
Rno03010Ribosome51817.0381.12×1029Rpl18, Rpl36a, Rgd1562315, Rpl19, Rpl14, Rpl13, Rgd1566373, Rgd1563124, Rgd1562402, Loc687780, Rgd1564698, Rps3a, Rgd1563867, Rgd1561875, Loc498555, Rpl12, Rgd1563861, Rgd1560979, Rps27a, Rgd1560831, Rpl35a, Loc690364, Rgd1565732, Rgd1562929, Rgd1565900, Rgd1563311, Rgd1561984, Rgd1562153, Rgd1566137, Rgd1563570, Rgd1560414, Rgd1564744, Rgd1559574, Loc364236, Rgd1562725, Loc367398, Rpl41, Rps17, Rgd1565370, Rps12, Loc687298, Rps10, Loc367923, Rps11, Rgd1561587, Rgd1561815, Rgd1561453, Rgd1566002, Rpl39, Rps25, Rgd1559639, Rps26, Rpl30, Rps27, Rpl32, Rgd1561086, Rgd1565165, Rgd1560952, Rpl8, Rgd1563679, Rpl4, Arbp, Rgd1559972, Rps23, Loc684988, Rpl26, Rps9, Rpl24, Rps6, Rps8, Rps7, Loc688712, Rpl13a, Rgd1561135, Rpl21, Rgd1562601, Rgd1563543, Rgd1564423
Rno00190Oxidative phosphorylation46953.8466.77×1013Ndufb3, Cox6c1, Ndufb4, Ndufb5, Ndufb7, Ndufb8, Atp5b, Atp6ap1, Cyc1, Cox7b, Ndufab1, Rgd1563463, Atp5g2, Cox7a2l, Atp6v1b2, Cox5a, Cox5b, Atp6v0c, Ndufs5, Ndufs8, Atp5l, Atp5o, Atp5i, Ndufs3, Atp5h, Atp5j, Loc688869, Ndufa5, Ndufa7, Cox8a, Cox4i1, Lhpp, Ndufa10, Ndufa1, Ppa2, Cox6c, Atp6v1f, Atp6v1c1, Sdha, Sdhb, Atp6v0e2, Uqcrh, Sdhc, Atp6v1e1, Ndufv1, Atp5c1
rno05012Parkinson's disease39973.1461.56×107Ndufb3, Cox6c1, Ndufb4, Ndufb5, Ndufb7, Ndufb8, Atp5b, Cyc1, Cox7b, Ndufab1, Rgd1563463, Pink1, Atp5g2, Cox7a2l, Cox5a, Cox5b, Ndufs5, Ndufs8, Atp5o, Rgd1564512, Ndufs3, Atp5h, Atp5j, Loc688869, Ndufa5, Ndufa7, Cox8a, Cox4i1, Ndufa10, Vdac3, Ndufa1, Park7, Cox6c, Sdha, Sdhb, Uqcrh, Sdhc, Ndufv1, Atp5c1
rno00020Citrate cycle (TCA cycle)17296.4914.89×107Dlst, Loc685778, Idh3b, Acly, Dlat, Pdhb, Idh3a, Pck1, Sdha, Sdhb, Idh3g, Sdhc, Dld, Idh2, Fh1, Mdh2, Mdh1
rno00620Pyruvate metabolism19355.5808.32×107Ldhb, Me3, Loc685778, Ldhd, Dlat, Acss2, Acat2, Pdhb, Pck1, Aldh1b1, Pklr, Dld, Akr1b1, Acot12, Acyp1, Glo1, Aldh1a7, Mdh2, Mdh1
rno03320PPAR signaling pathway25644.0332.79×106Ppard, Cyp4a3, Rgd1562373, Loc301444, Aqp7, Pdpk1, Apoa2, Cyp7a1, Apoa5, Ilk, Mmp1a, Acsl5, Cpt1c, Lpl, Acadm, Olr1, Rxrb, Rxra, Rgd1562323, Rxrg, Acadl, Dbi, Pck1, Cyp4a10, Cyp8b1, Fabp7
rno00010Glycolysis/gluconeogenesis26653.5452.48×105Aldoa, Rgd1560581, Ldhb, Rgd1562898, Pgam2, Rgd1563601, Acss2, Pdhb, Aldoal1, Tpi1, Akr1a1, Adh1, Rgd1565891, Adh4, Eno3, Aldh1a7, Gapdh, Eno1, Loc685778, Loc361841, Pfkm, Dlat, Aldh3b1, Rgd1565368, Pck1, Loc500959, G6pc, Rgd1565238, Aldh1b1, Rgd1559704, Pklr, Dld, Pgm1, Pgk1, Pgk2

FDR, false discovery rate.

qRT-PCR experiment

We used qRT-PCR assays to verify some of our microarray results. Five genes (H+ transporting mitochondrial F1 complex, beta subunit (Atp5b), cytochrome c oxidase subunit VIc (Cox6c), NADH dehydrogenase (ubiquinone) Fe-S protein 3 (Ndufs3), nephrosis 1 homolog (Nphs1), and nephrosis 2 homolog (Nphs2)) were selected for verification, because of their central positions in ‘oxidative phosphorylation’ pathway and essential components of the glomerular barrier. The expression ratios of these five genes, as determined through microarray and qRT-PCR, are shown in Table 7. Atp5b, Cox6c, and Ndufs3 were significantly downregulated both in TeL and TeH groups, while Nphs1 and Nphs2 were upregulated. Strong agreement between the microarray and qRT-PCR results was observed in all three genes, indicating the reliability of our microarray assays.

Table 7

Fold change in gene expression measured by gene array and qRT-PCR

TeL vs DNTeH vs DN
Fold change (gene array)Fold change (qRT-PCR)P value (qRT-PCR)Fold change (gene array)Fold change (qRT-PCR)P value (qRT-PCR)
Gene symbol
Atp5b−2.374−2.80.032−1.257−1.30.021
Cox6c−5.987−5.70.012−6.053−5.60.038
Ndufs3−2.147−2.20.038−2.109−1.90.035
Nphs12.5122.70.0242.6582.60.026
Nphs23.4633.60.0193.5133.40.014

TeL, low dose of telmisartan; TeH, high dose of telmisartan; Atp5b, H+ transporting mitochondrial F1 complex beta subunit; Cox6c, cytochrome c oxidase subunit VIc; Ndufs3, NADH dehydrogenase (ubiquinone) Fe-S protein 3; Nphs1, nephrosis 1 homolog; Nphs2, nephrosis 2 homolog.

Renal expression of MDA and NDUFS3

Renal immunostaining for MDA and NDUFS3 in diabetic rats (Fig. 3B and E) were elevated compared with the control group (Fig. 3A and D). The elevated MDA and NDUFS3 protein expressions in the kidney of diabetic rats were reduced by 3 months of telmisartan treatment (Fig. 3C and F). The semiquantitative score of MDA and NDUFS3 protein expressions in TeH group was also decreased significantly compared with those in the vehicle group (P<0.05, Fig. 3G and H).

Figure 3
Figure 3

Renal immunohistochemistry for MDA and NDUFS3 expression (original magnification, 200×) and semiquantitative assessments. (A, B, and C) immunostaining for MDA. (D, E and F) immunostaining for NDUFS3. Kidney tissues were harvested from (A and D) control, (B and E) vehicle, and (C and F) TeH groups. Semiquantitative scores of the immunostaining for (G) MDA and (H) NDUFS3 were scored using four levels, and an average value was obtained from analyses of ten rats in each group and more than 30 glomeruli for each rat. Data represent mean±s.d. (n=10). #P<0.05 vs the vehicle-treated group; *P<0.05, **P<0.01 vs the control group. Full colour version of this figure available via http://dx.doi.org/10.1530/JME-12-0020.

Citation: Journal of Molecular Endocrinology 49, 1; 10.1530/JME-12-0020

Discussion

In this study, we found that the administration of telmisartan to diabetic rats significantly reduced 24-h urinary albumin, serum creatinine, and BUN, and increased Ccr. Moreover, telmisartan can moderate kidney hypertrophy and renal histology in diabetic rats. Clinical studies show that the use of ARBs can effectively protect renal function in patients with type 2 DM. Post hoc analysis of studies evaluating ARBs suggests that this approach to treatment also has a cardiovascular benefit, besides the protection of renal function (Ritz et al. 2010). The ONTARGET study has shown that telmisartan provides superior reductions of proteinuria compared with ramipril and is effective in reducing renal endpoints. ARBs have renoprotection and this effect of telmisartan appears to be more potent than that of losartan, candesartan, or olmesartan in early-stage DN patients (Nakamura et al. 2010). The INNOVATION study previously showed that treatment with telmisartan effectively reduced the transition from incipient to overt nephropathy in Japanese type 2 DM patients. Telmisartan prevents the progression of microalbuminuria in normotensive Japanese patients with type 2 DM (Makino et al. 2008). But the mechanism of telmisartan on renal benefit is still on research.

Recent research reported that telmisartan was beneficial in reducing oxidative stress and fibrosis in STZ-induced DN (Lakshmanan et al. 2011). Compared with losartan, telmisartan significantly ameliorated vascular endothelial dysfunction, downregulation of phospho-eNOS, and coronary arterial remodeling in db/db mice. More vascular protective effects of telmisartan than losartan were associated with greater antiinflammatory effects of telmisartan, as shown by attenuation of vascular nuclear factor kappa B (NFκB) activation and tumor necrosis factor α (TNF-α; Toyama et al. 2011).

In our gene array research, DAVID analysis of all differentially expressed genes in the TeH group yielded 67 GO categories. The most enriched term was ‘mitochondrion’ (GO:0005739). After KEGG pathway analysis, all differentially expressed genes could be mapped to seven pathways. The second most significant pathway we found was ‘oxidative phosphorylation’ (FDR=6.77×10−13). Besides this pathway, there were three pathways closely related to the ‘oxidative phosphorylation’ pathway. These pathways included ‘citrate cycle’, ‘pyruvate metabolism’, and ‘glycolysis/gluconeogenesis’. qRT-PCR and immunohistochemistry staining verified these results. These findings suggest that the oxidative phosphorylation pathway in mitochondrion may play an important role in the renal benefit of telmisartan in diabetic rats.

In eukaryotic cells, mitochondria are important organelles. Through the oxidative phosphorylation pathway, most of ATP is generated from mitochondria. And mitochondria are a major cellular source for reactive oxygen species (ROS). Some evidence shows that increased oxidative stress contributes to DN development (Nishikawa et al. 2000, Brownlee 2001, Du et al. 2001). Hyperglycemia increases ROS production through the mitochondrial electron transport chain in mesangial cells (Kiritoshi et al. 2003). MDA is one of the ROS products. In immunohistochemistry, we found that telmisartan decreased MDA in glomeruli of diabetic rats. When primary renal proximal tubule cells (PTCs) were cultured in the presence of high glucose, H2O2 was increased. Apocynin, diphenylene iodonium (NADPH oxidase inhibitors), and rotenone (an inhibitor of complex I of the mitochondrial electron transport chain) effectively block the high glucose-induced generation of H2O2 in renal PTCs (Han et al. 2005). Moreover, hyperglycemia increases the production of ROS inside cultured bovine aortic endothelial cells (Nishikawa et al. 2000). And this increase in ROS is prevented by an inhibitor of electron transport chain complex II, by an uncoupler of oxidative phosphorylation, by uncoupling protein-1, and by manganese superoxide dismutase. Normalizing levels of mitochondrial ROS with each of these agents prevent the development and progression of DN (Nishikawa et al. 2000).

A great deal of data shows four main hypotheses on how hyperglycemia causes DN. And several trials based on specific inhibitors support these mechanisms. The four hypotheses are: increased polyol pathway flux, increased advanced glycation end-product formation, activation of protein kinase C isoforms, and increased hexosamine pathway flux. Recently, Brownlee (2005) proposed a unified mechanism that overproduction of superoxide by the mitochondrial electron transport chain activates the four pathways despite the absence of hyperglycemia.

In the citrate cycle, high glucose leads to the overproduction of electrons. Thus, the electron may generate a high mitochondrial membrane potential (Brownlee 2001). Korshunov et al. (1997) found that high membrane potential inhibits electron transfer at mitochondrial respiratory chain complex III and increases the half-life of superoxide-generating intermediates. Thus, as a consequence of overall downregulated gene expression in the oxidative phosphorylation pathway by telmisartan, it is possible that the exceed of mitochondrial membrane potential may be inhibited, resulting in increased electron transfer at respiratory chain complex III and the inhibition of the overproduction in superoxide and ROS.

The pyruvate metabolism pathway is connected to the citrate cycle through acetyl-CoA. Increased citrate cycle activity could further augment the oxidative phosphorylation pathway by increasing production of NADH and FADH2, causing increased production of electron donors and increased mitochondrial membrane potential. These, in turn, could inhibit electron transfer in the oxidative phosphorylation chain, resulting in increased ROS production (Korshunov et al. 1997, Du et al. 2001). Importantly, the downstream sequence of these perturbations on several pathways was independently linked to DN risk (Korshunov et al. 1997, Brownlee 2001, Du et al. 2001).

The other significant pathway we found was the ‘PPAR signaling pathway’ (FDR=2.79×10−6). So, telmisartan may moderate kidney function through PPAR signaling pathway. Telmisartan acts as a partial agonist of PPARγ as well as an inhibit or of the AT1 receptor. Recent research reported that telmisartan attenuates oxidative stress and renal fibrosis in STZ diabetic mice with the alteration of angiotensin-(1–7) Mas receptor expression associated with its PPAR-γ agonist action (Nakamura et al. 2010). Furthermore, Yao et al. (2008) have reported that telmisartan inhibited TGF-β1-induced alpha-smooth muscle actin expression and collagen IV secretion in mesangial cells via the activation of PPAR-γ. It has been demonstrated that telmisartan suppressed AT-1R expression in both mRNA and protein levels through the PPAR-γ-mediated pathway (Imayama et al. 2006).

We found that Nphs1 and Nphs2 were upregulated by telmisartan, which encoded nephrin and podocin respectively. Nephrin is one of the many podocyte-specific proteins that have been described in the last few years, which was the one of the extracellular components of the slit diaphragm. Doublier et al. (2003) found that nephrin expression is reduced in kidney biopsies from patients with diabetes. Podocin is a membrane-bound protein of the stomation family (Roselli et al. 2002), which is a component of a specialized membrane compartment known as a lipid raft. Schwarz et al. (2001) found that podocin may bind nephrin and recruit it to lipid rafts. We found that telmisartan can maintain the integrity of the slit diaphragm in glomeruli and decrease proteinuria by upregulating Nphs1 and Nphs2.

In summary, our studies provided evidence that telmisartan reduces 24-h urinary albumin, serum creatinine, and serum urea nitrogen in a dose-dependent manner, and ameliorate kidney function in diabetic rats. The mechanism is involved in the oxidative phosphorylation pathway, the PPAR-γ pathway, and the slit diaphragm. These results provide molecular information for further investigation of the mechanisms by which telmisartan moderates kidney function in diabetic rats. Furthermore, these results could be important in devising mechanism-based and targeted therapeutic strategies for DN and kidney dysfunction.

In conclusion, through the analyses of individual genes, pathway enrichment, and GO terms annotation, we found that the oxidative phosphorylation pathway, the PPAR-γ pathway, and the slit diaphragm were associated with telmisartan-treated in diabetic rats.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was founded by Grants from the foundation of Peking Union Medical College Hospital (grant number 2006119).

References

  • BakrisGBurgessEWeirMDavidaiGKovalSAMADEO Study Investigators2008Telmisartan is more effective than losartan in reducing proteinuria in patients with diabetic nephropathy. Kidney International74364369. doi:10.1038/ki.2008.204.

    • Search Google Scholar
    • Export Citation
  • BenjaminiYHochbergY1995Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society. Series B57289300. doi:10.2307/2346101.

    • Search Google Scholar
    • Export Citation
  • BenndorfRAAppelDMaasRSchwedhelmEWenzelUOBogerRH2007Telmisartan improves endothelial function in patients with essential hypertension. Journal of Cardiovascular Pharmacology50367371. doi:10.1097/FJC.0b013e31811dfbe7.

    • Search Google Scholar
    • Export Citation
  • BorderWAOkudaSLanguinoLRSpornMBRuoslahtiE1990Suppression of experimental glomerulonephritis by antiserum against transforming growth factor β1. Nature346371374. doi:10.1038/346371a0.

    • Search Google Scholar
    • Export Citation
  • BrownleeM2001Biochemistry and molecular cell biology of diabetic complications. Nature414813820. doi:10.1038/414813a.

  • BrownleeM2005The pathobiology of diabetic complications: a unifying mechanism. Diabetes5416151625. doi:10.2337/diabetes.54.6.1615.

  • DennisGJrShermanBTHosackDAYangJGaoWLaneHCLempickiRA2003DAVID: database for annotation, visualization, and integrated discovery. Genome Biology4P3doi:10.1186/gb-2003-4-5-p3.

    • Search Google Scholar
    • Export Citation
  • DoublierSSalvidioGLupiaERuotsalainenVVerzolaDDeferrariGCamussiG2003Nephrin expression is reduced in human diabetic nephropathy: evidence for a distinct role for glycated albumin and angiotensin II. Diabetes5210231030. doi:10.2337/diabetes.52.4.1023.

    • Search Google Scholar
    • Export Citation
  • DuXLEdelsteinDDimmelerSJuQSuiCBrownleeM2001Hyperglycemia inhibits endothelial nitric oxide synthase activity by posttranslational modification at the Akt site. Journal of Clinical Investigation10813411348. doi:10.1172/JCI11235.

    • Search Google Scholar
    • Export Citation
  • EisenMBSpellmanPTBrownPOBotsteinD1998Cluster analysis and display of genome-wide expression patterns. PNAS951486314868. doi:10.1073/pnas.95.25.14863.

    • Search Google Scholar
    • Export Citation
  • GalleJSchwedhelmEPinnettiSBogerRHWannerCVIVALDI invstigators2008Antiproteinuric effects of angiotensin receptor blockers: telmisartan vs valsartan in hypertensive patients with type 2 diabetes mellitus and overt nephropathy. Nephrology Dialysis Transplantation2331743183. doi:10.1093/ndt/gfn230.

    • Search Google Scholar
    • Export Citation
  • Ghanaat-PourHHuangZLehtihetMSjoholmA2007Global expression profiling of glucose-regulated genes in pancreatic islets of spontaneously diabetic Goto–Kakizaki rats. Journal of Molecular Endocrinology39135150. doi:10.1677/JME-07-0002.

    • Search Google Scholar
    • Export Citation
  • GrossMLEI-ShakmakASzaboAKochAKuhlmannAMunterKRitzEAmannK2003ACE-inhibitors but not endothelin receptor blockers prevent podocyte loss in early diabetic nephropathy. Diabetologia46856868. doi:10.1007/s00125-003-1106-8.

    • Search Google Scholar
    • Export Citation
  • HanHJLeeYJParkSHLeeJHTaubM2005High glucose-induced oxidative stress inhibits Na+/glucose cotransporter activity in renal proximal tubule cells. American Journal of Physiology. Renal Physiology288F988F996. doi:10.1152/ajprenal.00327.2004.

    • Search Google Scholar
    • Export Citation
  • HosackDADennisGJrShermanBTLaneHCLempickiRA2003Identifying biological themes within lists of genes with EASE. Genome Biology4R70doi:10.1186/gb-2003-4-10-r70.

    • Search Google Scholar
    • Export Citation
  • HuangJHHuangXHChenZYZhengQSSunRY2004Dose conversion among different animals and healthy volunteers in pharmacological study. Chinese Journal of Clinical Pharmacology and Therapeutics910691072.

    • Search Google Scholar
    • Export Citation
  • ImayamaIIchikiTInanagaKOhtsuboHFukuyamaKOnoHHashiguchiYSunagawaK2006Telmisartan downregulates angiotensin II type 1 receptor through activation of peroxisome proliferator-activated receptor γ. Cardiovascular Research72184190. doi:10.1016/j.cardiores.2006.07.014.

    • Search Google Scholar
    • Export Citation
  • KiritoshiSNishikawaTSonodaKKukidomeDSenokuchiTMatsuoTMatsumuraTTokunagaHBrownleeMArakiE2003Reactive oxygen species from mitochondria induce cyclooxygenase-2 gene expression in human mesangial cells: potential role in diabetic nephropathy. Diabetes5225702577. doi:10.2337/diabetes.52.10.2570.

    • Search Google Scholar
    • Export Citation
  • KorshunovSSSkulachevVPStarkovAA1997High protonic potential actuates a mechanism of production of reactive oxygen species in mitochondria. FEBS Letters4161518. doi:10.1016/S0014-5793(97)01159-9.

    • Search Google Scholar
    • Export Citation
  • LakshmananAPWatanabeKThandavarayanRASariFRHarimaMGiridharanVVSoetiknoVKodamaMAizawaY2011Telmisartan attenuates oxidative stress and renal fibrosis in streptozotocin induced diabetic mice with the alteration of angiotensin-(1–7) mas receptor expression associated with its PPAR-γ agonist action. Free Radical Research45575584. doi:10.3109/10715762.2011.560149.

    • Search Google Scholar
    • Export Citation
  • LivakKJSchmittgenTD2001Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta DeltaC(T)) method. Methods25402408. doi:10.1006/meth.2001.1262.

    • Search Google Scholar
    • Export Citation
  • MakinoHHanedaMBabazonoTMoriyaTItoSIwamotoYKawamoriRTakeuchiMKawamoriSINNOVATION Study Group2007Prevention of transition from incipient to overt nephropathy with telmisartan in patients with type 2 diabetes. Diabetes Care3015771578. doi:10.2337/dc06-1998.

    • Search Google Scholar
    • Export Citation
  • MakinoHHanedaMBabazonoTMoriyaTItoSIwamotoYKawamoriRTakeuchiMKatayamaSINNOVATION Study Group2008Microalbuminuria reduction with telmisartan in normotensive and hypertensive Japanese patients with type 2 diabetes: a post-hoc analysis of The Incipient to Overt: Angiotensin II Blocker, Telmisartan, Investigation on Type 2 Diabetic Nephropathy (INNOVATION) study. Hypertension Research31657664. doi:10.1291/hypres.31.657.

    • Search Google Scholar
    • Export Citation
  • NakamuraTFujiwaraNSatoEUedaYSugayaTKoideH2010Renoprotective effects of various angiotensin II receptor blockers in patients with early-stage diabetic nephropathy. Kidney & Blood Pressure Research33213220. doi:10.1159/000316707.

    • Search Google Scholar
    • Export Citation
  • NishikawaTEdelsteinDDuXLYamagishiSMatsumuraTKanedaYYorekMABeebeDOatesPJHammesHP2000Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage. Nature404787790. doi:10.1038/35008121.

    • Search Google Scholar
    • Export Citation
  • OnozatoMLTojoALeiperJFujitaTPalmFWilcoxCS2008Expression of NG, NG-dimethylarginine dimethylaminohydrolase and protein arginine N-methyltransferase isoforms in diabetic rat kidney: effects of angiotensin II receptor blockers. Diabetes57172180. doi:10.2337/db06-1772.

    • Search Google Scholar
    • Export Citation
  • ONTARGET InvestigatorsYusufSTeoKKPogueJDyalLCoplandISchumacherHDagenaisGSleightPAndersonC2008Telmisartan, ramipril, or both in patients at high risk for vascular events. New England Journal of Medicine35815471559. doi:10.1056/NEJMoa0801317.

    • Search Google Scholar
    • Export Citation
  • RitzEOrthSR1999Nephropathy in patients with type 2 diabetes mellitus. New England Journal of Medicine34111271133. doi:10.1056/NEJM199910073411506.

    • Search Google Scholar
    • Export Citation
  • RitzESchmiederREPollockCA2010Renal protection in diabetes: lessons from ONTARGET. Cardiovascular Diabetology960doi:10.1186/1475-2840-9-60.

    • Search Google Scholar
    • Export Citation
  • RoselliSGribouvalOBouteNSichMBenessyFAttieTGublerMCAntignacC2002Podocin localizes in the kidney to the slit diaphragm area. American Journal of Pathology160131139. doi:10.1016/S0002-9440(10)64357-X.

    • Search Google Scholar
    • Export Citation
  • SchlondorffD1990Preparation and study of isolated glomeruli. Methods in Enzymology191130140. doi:10.1016/0076-6879(90)91011-T.

  • SchwarzKSimonsMReiserJSaleemMAFaulCKrizWShawASHolzmanLBMundelP2001Podocin, a raft-associated component of the glomerular slit diaphragm, interacts with CD2AP and nephrin. Journal of Clinical Investigation10816211629. doi:10.1172/JCI12849.

    • Search Google Scholar
    • Export Citation
  • ToyamaKNakamuraTKataokaKYasudaOFukudaMTokutomiYDongYFOgawaHKim-MitsuyamaS2011Telmisartan protects against diabetic vascular complications in a mouse model of obesity and type 2 diabetes, partially through peroxisome proliferator activated receptor-γ-dependent activity. Biochemical and Biophysical Research Communications410508513. doi:10.1016/j.bbrc.2011.06.012.

    • Search Google Scholar
    • Export Citation
  • WhiteKEMarshallSMBilousRW2008Prevalence of atubular glomeruli in type 2 diabetic patients with nephropathy. Nephrology Dialysis Transplantation2335393545. doi:10.1093/ndt/gfn351.

    • Search Google Scholar
    • Export Citation
  • WildSRoglicGGreenASicreeRKingH2004Global prevalence of diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care2710471053. doi:10.2337/diacare.27.5.1047.

    • Search Google Scholar
    • Export Citation
  • WuAYKongNCde LeonFAPanCYTaiTYYeungVTYooSJRouillonAWeirMR2005An alarmingly high prevalence of diabetic nephropathy in Asian type 2 diabetic patients: the MicroAlbuminuria Prevalence (MAP) Study. Diabetologia481726. doi:10.1007/s00125-004-1599-9.

    • Search Google Scholar
    • Export Citation
  • YaoYZouRLiuXJiangJHuangQHeYLiMWangSZhouJMaD2008Telmisartan but not valsartan inhibits TGF-β mediated accumulation of extracellular matrix via activation of PPARγ. Journal of Huazhong University of Science and Technology. Medical Sciences28543548. doi:10.1007/s11596-008-0512-z.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 1577 546 47
PDF Downloads 180 105 15
  • View in gallery

    The effects of telmisartan treatment on 24-h (A) urinary albumin, (B) Ccr, (C) serum creatinine, and (D) serum urea nitrogen in rats (n=10, in each group). Data represent mean±s.d. (n=10). #P<0.05, ##P<0.01 vs the vehicle-treated group; *P<0.05, **P<0.01 vs the control group.

  • View in gallery

    Histological staining with periodic acid-Schiff in glomeruli (A, B, and C, original magnification, 200×) shows the glomerular and tubulointerstitial structure of the (A) control group, (B) vehicle-treated group, and (C) TeH group. Expansion of the glomerular matrix was scored using four levels and an average value was obtained from analyses of ten rats in each group and more than 30 glomeruli for each rat (D). Data represent mean±s.d. (n=10). #P<0.05 vs the vehicle-treated group; **P<0.01 vs the control group. Full colour version of this figure available via http://dx.doi.org/10.1530/JME-12-0020.

  • View in gallery

    Renal immunohistochemistry for MDA and NDUFS3 expression (original magnification, 200×) and semiquantitative assessments. (A, B, and C) immunostaining for MDA. (D, E and F) immunostaining for NDUFS3. Kidney tissues were harvested from (A and D) control, (B and E) vehicle, and (C and F) TeH groups. Semiquantitative scores of the immunostaining for (G) MDA and (H) NDUFS3 were scored using four levels, and an average value was obtained from analyses of ten rats in each group and more than 30 glomeruli for each rat. Data represent mean±s.d. (n=10). #P<0.05 vs the vehicle-treated group; *P<0.05, **P<0.01 vs the control group. Full colour version of this figure available via http://dx.doi.org/10.1530/JME-12-0020.

  • BakrisGBurgessEWeirMDavidaiGKovalSAMADEO Study Investigators2008Telmisartan is more effective than losartan in reducing proteinuria in patients with diabetic nephropathy. Kidney International74364369. doi:10.1038/ki.2008.204.

    • Search Google Scholar
    • Export Citation
  • BenjaminiYHochbergY1995Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society. Series B57289300. doi:10.2307/2346101.

    • Search Google Scholar
    • Export Citation
  • BenndorfRAAppelDMaasRSchwedhelmEWenzelUOBogerRH2007Telmisartan improves endothelial function in patients with essential hypertension. Journal of Cardiovascular Pharmacology50367371. doi:10.1097/FJC.0b013e31811dfbe7.

    • Search Google Scholar
    • Export Citation
  • BorderWAOkudaSLanguinoLRSpornMBRuoslahtiE1990Suppression of experimental glomerulonephritis by antiserum against transforming growth factor β1. Nature346371374. doi:10.1038/346371a0.

    • Search Google Scholar
    • Export Citation
  • BrownleeM2001Biochemistry and molecular cell biology of diabetic complications. Nature414813820. doi:10.1038/414813a.

  • BrownleeM2005The pathobiology of diabetic complications: a unifying mechanism. Diabetes5416151625. doi:10.2337/diabetes.54.6.1615.

  • DennisGJrShermanBTHosackDAYangJGaoWLaneHCLempickiRA2003DAVID: database for annotation, visualization, and integrated discovery. Genome Biology4P3doi:10.1186/gb-2003-4-5-p3.

    • Search Google Scholar
    • Export Citation
  • DoublierSSalvidioGLupiaERuotsalainenVVerzolaDDeferrariGCamussiG2003Nephrin expression is reduced in human diabetic nephropathy: evidence for a distinct role for glycated albumin and angiotensin II. Diabetes5210231030. doi:10.2337/diabetes.52.4.1023.

    • Search Google Scholar
    • Export Citation
  • DuXLEdelsteinDDimmelerSJuQSuiCBrownleeM2001Hyperglycemia inhibits endothelial nitric oxide synthase activity by posttranslational modification at the Akt site. Journal of Clinical Investigation10813411348. doi:10.1172/JCI11235.

    • Search Google Scholar
    • Export Citation
  • EisenMBSpellmanPTBrownPOBotsteinD1998Cluster analysis and display of genome-wide expression patterns. PNAS951486314868. doi:10.1073/pnas.95.25.14863.

    • Search Google Scholar
    • Export Citation
  • GalleJSchwedhelmEPinnettiSBogerRHWannerCVIVALDI invstigators2008Antiproteinuric effects of angiotensin receptor blockers: telmisartan vs valsartan in hypertensive patients with type 2 diabetes mellitus and overt nephropathy. Nephrology Dialysis Transplantation2331743183. doi:10.1093/ndt/gfn230.

    • Search Google Scholar
    • Export Citation
  • Ghanaat-PourHHuangZLehtihetMSjoholmA2007Global expression profiling of glucose-regulated genes in pancreatic islets of spontaneously diabetic Goto–Kakizaki rats. Journal of Molecular Endocrinology39135150. doi:10.1677/JME-07-0002.

    • Search Google Scholar
    • Export Citation
  • GrossMLEI-ShakmakASzaboAKochAKuhlmannAMunterKRitzEAmannK2003ACE-inhibitors but not endothelin receptor blockers prevent podocyte loss in early diabetic nephropathy. Diabetologia46856868. doi:10.1007/s00125-003-1106-8.

    • Search Google Scholar
    • Export Citation
  • HanHJLeeYJParkSHLeeJHTaubM2005High glucose-induced oxidative stress inhibits Na+/glucose cotransporter activity in renal proximal tubule cells. American Journal of Physiology. Renal Physiology288F988F996. doi:10.1152/ajprenal.00327.2004.

    • Search Google Scholar
    • Export Citation
  • HosackDADennisGJrShermanBTLaneHCLempickiRA2003Identifying biological themes within lists of genes with EASE. Genome Biology4R70doi:10.1186/gb-2003-4-10-r70.

    • Search Google Scholar
    • Export Citation
  • HuangJHHuangXHChenZYZhengQSSunRY2004Dose conversion among different animals and healthy volunteers in pharmacological study. Chinese Journal of Clinical Pharmacology and Therapeutics910691072.

    • Search Google Scholar
    • Export Citation
  • ImayamaIIchikiTInanagaKOhtsuboHFukuyamaKOnoHHashiguchiYSunagawaK2006Telmisartan downregulates angiotensin II type 1 receptor through activation of peroxisome proliferator-activated receptor γ. Cardiovascular Research72184190. doi:10.1016/j.cardiores.2006.07.014.

    • Search Google Scholar
    • Export Citation
  • KiritoshiSNishikawaTSonodaKKukidomeDSenokuchiTMatsuoTMatsumuraTTokunagaHBrownleeMArakiE2003Reactive oxygen species from mitochondria induce cyclooxygenase-2 gene expression in human mesangial cells: potential role in diabetic nephropathy. Diabetes5225702577. doi:10.2337/diabetes.52.10.2570.

    • Search Google Scholar
    • Export Citation
  • KorshunovSSSkulachevVPStarkovAA1997High protonic potential actuates a mechanism of production of reactive oxygen species in mitochondria. FEBS Letters4161518. doi:10.1016/S0014-5793(97)01159-9.

    • Search Google Scholar
    • Export Citation
  • LakshmananAPWatanabeKThandavarayanRASariFRHarimaMGiridharanVVSoetiknoVKodamaMAizawaY2011Telmisartan attenuates oxidative stress and renal fibrosis in streptozotocin induced diabetic mice with the alteration of angiotensin-(1–7) mas receptor expression associated with its PPAR-γ agonist action. Free Radical Research45575584. doi:10.3109/10715762.2011.560149.

    • Search Google Scholar
    • Export Citation
  • LivakKJSchmittgenTD2001Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta DeltaC(T)) method. Methods25402408. doi:10.1006/meth.2001.1262.

    • Search Google Scholar
    • Export Citation
  • MakinoHHanedaMBabazonoTMoriyaTItoSIwamotoYKawamoriRTakeuchiMKawamoriSINNOVATION Study Group2007Prevention of transition from incipient to overt nephropathy with telmisartan in patients with type 2 diabetes. Diabetes Care3015771578. doi:10.2337/dc06-1998.

    • Search Google Scholar
    • Export Citation
  • MakinoHHanedaMBabazonoTMoriyaTItoSIwamotoYKawamoriRTakeuchiMKatayamaSINNOVATION Study Group2008Microalbuminuria reduction with telmisartan in normotensive and hypertensive Japanese patients with type 2 diabetes: a post-hoc analysis of The Incipient to Overt: Angiotensin II Blocker, Telmisartan, Investigation on Type 2 Diabetic Nephropathy (INNOVATION) study. Hypertension Research31657664. doi:10.1291/hypres.31.657.

    • Search Google Scholar
    • Export Citation
  • NakamuraTFujiwaraNSatoEUedaYSugayaTKoideH2010Renoprotective effects of various angiotensin II receptor blockers in patients with early-stage diabetic nephropathy. Kidney & Blood Pressure Research33213220. doi:10.1159/000316707.

    • Search Google Scholar
    • Export Citation
  • NishikawaTEdelsteinDDuXLYamagishiSMatsumuraTKanedaYYorekMABeebeDOatesPJHammesHP2000Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage. Nature404787790. doi:10.1038/35008121.

    • Search Google Scholar
    • Export Citation
  • OnozatoMLTojoALeiperJFujitaTPalmFWilcoxCS2008Expression of NG, NG-dimethylarginine dimethylaminohydrolase and protein arginine N-methyltransferase isoforms in diabetic rat kidney: effects of angiotensin II receptor blockers. Diabetes57172180. doi:10.2337/db06-1772.

    • Search Google Scholar
    • Export Citation
  • ONTARGET InvestigatorsYusufSTeoKKPogueJDyalLCoplandISchumacherHDagenaisGSleightPAndersonC2008Telmisartan, ramipril, or both in patients at high risk for vascular events. New England Journal of Medicine35815471559. doi:10.1056/NEJMoa0801317.

    • Search Google Scholar
    • Export Citation
  • RitzEOrthSR1999Nephropathy in patients with type 2 diabetes mellitus. New England Journal of Medicine34111271133. doi:10.1056/NEJM199910073411506.

    • Search Google Scholar
    • Export Citation
  • RitzESchmiederREPollockCA2010Renal protection in diabetes: lessons from ONTARGET. Cardiovascular Diabetology960doi:10.1186/1475-2840-9-60.

    • Search Google Scholar
    • Export Citation
  • RoselliSGribouvalOBouteNSichMBenessyFAttieTGublerMCAntignacC2002Podocin localizes in the kidney to the slit diaphragm area. American Journal of Pathology160131139. doi:10.1016/S0002-9440(10)64357-X.

    • Search Google Scholar
    • Export Citation
  • SchlondorffD1990Preparation and study of isolated glomeruli. Methods in Enzymology191130140. doi:10.1016/0076-6879(90)91011-T.

  • SchwarzKSimonsMReiserJSaleemMAFaulCKrizWShawASHolzmanLBMundelP2001Podocin, a raft-associated component of the glomerular slit diaphragm, interacts with CD2AP and nephrin. Journal of Clinical Investigation10816211629. doi:10.1172/JCI12849.

    • Search Google Scholar
    • Export Citation
  • ToyamaKNakamuraTKataokaKYasudaOFukudaMTokutomiYDongYFOgawaHKim-MitsuyamaS2011Telmisartan protects against diabetic vascular complications in a mouse model of obesity and type 2 diabetes, partially through peroxisome proliferator activated receptor-γ-dependent activity. Biochemical and Biophysical Research Communications410508513. doi:10.1016/j.bbrc.2011.06.012.

    • Search Google Scholar
    • Export Citation
  • WhiteKEMarshallSMBilousRW2008Prevalence of atubular glomeruli in type 2 diabetic patients with nephropathy. Nephrology Dialysis Transplantation2335393545. doi:10.1093/ndt/gfn351.

    • Search Google Scholar
    • Export Citation
  • WildSRoglicGGreenASicreeRKingH2004Global prevalence of diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care2710471053. doi:10.2337/diacare.27.5.1047.

    • Search Google Scholar
    • Export Citation
  • WuAYKongNCde LeonFAPanCYTaiTYYeungVTYooSJRouillonAWeirMR2005An alarmingly high prevalence of diabetic nephropathy in Asian type 2 diabetic patients: the MicroAlbuminuria Prevalence (MAP) Study. Diabetologia481726. doi:10.1007/s00125-004-1599-9.

    • Search Google Scholar
    • Export Citation
  • YaoYZouRLiuXJiangJHuangQHeYLiMWangSZhouJMaD2008Telmisartan but not valsartan inhibits TGF-β mediated accumulation of extracellular matrix via activation of PPARγ. Journal of Huazhong University of Science and Technology. Medical Sciences28543548. doi:10.1007/s11596-008-0512-z.

    • Search Google Scholar
    • Export Citation