Characterization of multiple first exons in murine prolactin receptor gene and the effect of prolactin on their expression in the choroid plexus

in Journal of Molecular Endocrinology

Prolactin (Prl) receptor (Prlr) gene is expressed in various brain regions, with the highest level present in the choroid plexus, a site for receptor-mediated PRL transport from the blood to cerebrospinal fluid. We investigated the regulatory mechanism of Prlr gene expression by PRL in the murine choroid plexus. We first examined the organization of the alternative first exons in murine Prlr gene. In addition to the three known first exons, mE11, mE12, and mE13, two first exons, mE14 and mE15, were newly identified by cDNA cloning. Each first exon variant of Prlr mRNA exhibited tissue-specific or generic expression. In the choroid plexus of mice, the expression levels of mE13-, mE14-, and mE15-Prlr mRNAs were increased in the lactating mice compared with those in the diestrus mice. Furthermore, the expression level of mE14-Prlr mRNA was decreased in the PRL-deficient (Prl−/−) mice compared with the PRL-normal (Prl+/+ and Prl+/−) mice. In the ovariectomized Prl−/− mice, the expression level of mE14-Prlr mRNA was significantly increased by PRL administration but not by 17β-estradiol administration. The expression levels of the two last exon variants of Prlr mRNAs, encoding the long and short cytoplasmic regions of PRLR, were also increased in the lactating mice and decreased in the Prl−/− mice. These findings suggest that PRL stimulates the Prlr gene expression through the transcriptional activation of mE14 first exon, leading to increases in the long- and short-form variants of Prlr mRNA in the murine choroid plexus.

Abstract

Prolactin (Prl) receptor (Prlr) gene is expressed in various brain regions, with the highest level present in the choroid plexus, a site for receptor-mediated PRL transport from the blood to cerebrospinal fluid. We investigated the regulatory mechanism of Prlr gene expression by PRL in the murine choroid plexus. We first examined the organization of the alternative first exons in murine Prlr gene. In addition to the three known first exons, mE11, mE12, and mE13, two first exons, mE14 and mE15, were newly identified by cDNA cloning. Each first exon variant of Prlr mRNA exhibited tissue-specific or generic expression. In the choroid plexus of mice, the expression levels of mE13-, mE14-, and mE15-Prlr mRNAs were increased in the lactating mice compared with those in the diestrus mice. Furthermore, the expression level of mE14-Prlr mRNA was decreased in the PRL-deficient (Prl−/−) mice compared with the PRL-normal (Prl+/+ and Prl+/−) mice. In the ovariectomized Prl−/− mice, the expression level of mE14-Prlr mRNA was significantly increased by PRL administration but not by 17β-estradiol administration. The expression levels of the two last exon variants of Prlr mRNAs, encoding the long and short cytoplasmic regions of PRLR, were also increased in the lactating mice and decreased in the Prl−/− mice. These findings suggest that PRL stimulates the Prlr gene expression through the transcriptional activation of mE14 first exon, leading to increases in the long- and short-form variants of Prlr mRNA in the murine choroid plexus.

Keywords:

Introduction

Prolactin (PRL) exhibits many physiological functions, including a number of brain functions such as maternal behavior, stress tolerance, food intake, and sexual behavior (Bole-Feysot et al. 1998, Freeman et al. 2000). All these functions of PRL are mediated by PRL receptor (PRLR). PRLR mRNA expression has been detected in various brain regions in mammals, with the highest level detected in the choroid plexus (Brooks et al. 1992, Chiu et al. 1992, Di Carlo et al. 1992, Ouhtit et al. 1993, Chiu & Wise 1994, Nagano & Kelly 1994, Fujikawa et al. 1995, Brown et al. 2010). It is believed that PRL is transported from the blood to the cerebrospinal fluid (CSF) by a PRLR-mediated system in this brain region (Walsh et al. 1987). In addition, it has been reported that PRL enhances its own uptake in the choroid plexus (Mangurian et al. 1992). Supporting this function, a high level of PRLR expression in the choroid plexus has been observed during lactation when the plasma PRL level is also high (Muccioli & Di Carlo 1994, Escalada et al. 1996, Sugiyama et al. 1996, Pi & Grattan 1999, Augustine et al. 2003, Pi et al. 2003, Nogami et al. 2007, Anderson et al. 2008). Also, PRLR expression in this brain region increases during the stress response, accompanying an increase in the plasma PRL level (Fujikawa et al. 1995). Furthermore, both peripheral and central administration of PRL have been shown to increase the PRLR expression in the choroid plexus (Muccioli & Di Carlo 1994, Fujikawa et al. 2004). These findings suggest that PRL upregulates PRLR gene expression in the choroid plexus.

In mammals such as rats, mice, and humans, PRLR gene expression is regulated by the transcriptional activation of multiple alternative first exons encoding 5′-untranslated regions. In rat Prlr gene, five alternative first exons, E11, E12, E13, E14, and E15, have been identified previously (Hu et al. 1996, Moldrup et al. 1996, Tanaka et al. 2002, 2005). In rats, the E11 variant of Prlr mRNA is specifically expressed in the gonadal tissues (Hu et al. 1997) and the E12 variant is transcribed in the liver and kidney (Moldrup et al. 1996, Tanaka et al. 2005). In addition, the E13 variant is expressed in a wide range of tissues (Hu et al. 1998), whereas the E14 variant is preferentially expressed in the brain (Tanaka et al. 2002). Finally, the E15 variant is used in the brain, liver, and kidney (Tanaka et al. 2005). In murine Prlr gene, three first exons homologous to rat E11, E12, and E13 (referred to as mE11, mE12, and mE13 respectively) have been detected to date (Davis & Linzer 1989, Hu et al. 1997, 1998). In human PRLR gene, six alternative first exons, hE13, hE1N1, hE1N2, hE1N3, hE1N4, and hE1N5, have been identified (Hu et al. 1999, 2002).

In addition to the alternative first exons, mammalian PRLR genes also contain alternative last exons encoding the C-terminal regions of the long or short forms of PRLR proteins. In rats and humans, the two last exon variants of PRLR mRNA, one for the long form of protein and another for the short form, are present (Boutin et al. 1989, Shirota et al. 1990, Nagano & Kelly 1994, Trott et al. 2003). In murine Prlr mRNA, the four last exon variants, one long form (Prlr-L) and three short forms (Prlr-S1, -S2, and -S3), have been identified by cDNA cloning (Davis & Linzer 1989, Clarke & Linzer 1993, Moore & Oka 1993). However, the nucleotide sequence of PRLR-S3 contains one nucleotide deletion in codon 78, which results in the appearance of a stop codon after the following 19 amino acid residues. Therefore, PRLR-S3 encodes a truncated form of PRLR protein and is considered to be a transcript of a pseudogene (Davis & Linzer 1989). In rats and mice, the long-form PRLR is the predominant form in most tissues except for the liver where the short form is abundant (Davis & Linzer 1989, Shirota et al. 1990). Intracellular signaling of the long form is mainly mediated by the JAK2/STAT5 pathway (Bole-Feysot et al. 1998, Freeman et al. 2000). Although, short-form PRLR can activate the MAP kinase pathway (Das & Vonderhaar 1995), its intracellular signaling system is poorly understood.

To gain a better understanding of the molecular mechanisms of PRL function in the choroid plexus, it is essential to clarify the regulatory mechanisms involved in Prlr gene expression in the choroid plexus. In this study, we first demonstrated the presence of the five distinct first exons, including two newly identified first exons in murine Prlr gene, and then examined the tissue expression patterns of the individual first exon variants of Prlr mRNA. Subsequently, we used hyperprolactinemic (lactating) and PRL-deficient mice to examine the effects of PRL on the expression of the first exon variants together with the expression of the last exon variants of Prlr mRNA encoding long- or short-form PRLR in the choroid plexus.

Materials and methods

Animals and hormone treatments

C57BL/6j mice were purchased from Oriental Yeast (Tokyo, Japan). PRL-deficient (Prl−/−) mice were generated as described previously (Horseman et al. 1997). The mice were housed under controlled temperature (22 °C) and lighting conditions (12 h light:12 h darkness, lights were turned on at 0700 h). Food and water were given to the mice ad libitum. The presence of estrus cycle in the mice was determined by performing vaginal smears. Ovariectomy was performed on the mice at 5 weeks of age under pentobarbital anesthesia, and the hormone treatment was started on the mice after 2 weeks of their recovery. 17β-estradiol (E2; Nacalai Tesque, Kyoto, Japan) and human PRL (Shikibo Lifetech, Inc., Osaka, Japan) were individually dissolved in sesame oil and PBS respectively. E2 (1.25 mg/kg body weight) was injected s.c. into the back of the necks of the mice daily for 7 days, and PRL (2.5 mg/kg body weight) was s.c. injected twice daily (at 0900 and 1800 h) for 3 days. The effective doses and frequencies of E2 and PRL were determined by preliminary experiments. The animals were killed by decapitation 24 h after the last injection. All procedures were performed in accordance with the National Institutes for Health's guidelines regarding the principles of animal care.

RNA isolation

After the mice were killed, their tissues were rapidly removed and frozen in liquid nitrogen. The choroid plexus of each mouse was carefully removed from the forebrain. Total RNA was extracted from the tissues with TRIzol (Invitrogen). Poly(A)+ RNA was prepared from the total RNA of the forebrain with OligoTex Super-dT30 (Takara, Shiga, Japan) according to the manufacturer's instructions.

cDNA cloning of the first and last exon variants of Prlr mRNA

The 5′-end of the Prlr cDNA was synthesized from the poly(A)+ RNA prepared from the forebrain by the oligo-capping method (Maruyama & Sugano 1994) using Cap Site cDNA dT kit (Nippon Gene, Toyama, Japan). Briefly, the cap structure of poly(A)+ RNA was removed with tobacco acid pyrophosphatase, and the decapped mRNA was recapped with an oligonucleotide RNA linker. Subsequently, the oligo-capped mRNA was reverse transcribed with oligo-dT primer, and the resultant cDNA was subjected to the first PCR using a combination of 1RDT linker primer supplied in the kit and murine PRLR-specific antisense primer. Then, the PCR products were subjected to nested PCR using a combination of 2RDT linker primer supplied in the kit and another murine PRLR-specific antisense primer. Prlr-S4 cDNA was amplified from the cDNA with a sense primer and an antisense primer derived from the reported Prlr-S3 cDNA sequence. The sequences of primers used are shown in Table 1. The amplified DNA was cloned into the pGEM-T Easy vector (Promega) and sequenced with the BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) and the ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

Table 1

PCR primers

ApplicationcDNAForward (5′–3′)Accession no.Reverse (5′–3′)Accession no.
cDNA cloning5′-variantsgatgctagctgcgagtcaagtc1RDTaggtaggtggcaaccattttaccL13593
5′-variantscgagtcaagtcgacgaagtgc2RDTaccgaggaggctctggttcaacL13593
mPRLR-S4tagggaaacgtagaagagcaM22957tcagaaaacccacactgcagM22957
Real-time PCRmE12-PRLRactgtctgctcttttcagaagtctM22959ggacaagcagcatgtaagcaL13593
mE13-PRLRattttacacggggctcaggBC005555caggggaacgacatttgtgL13593
mE14-PRLRagagaggcaccctccacagbcaggggaacgacatttgtgL13593
mE15-PRLRcaggctgtgactccatgtgtccaggggaacgacatttgtgL13593
Total PRLRtgccatctgcacttgcttacL13593caggggaacgacatttgtgL13593
mPRLR-LatcattcaccggccgttctctcL13593ccagcaagtcctcacagtcaL13593
mPRLR-S1gcagtggctttgaagggttaL13593ccagggaagtcaactggagaM22958
mPRLR-S2atcattcaccggccgttctctcL13593ggctgtggtcgagtgggtaaM22959
mPRLR-S4atcattcaccggccgttctctcL13593gtatttgcttggagagccagtAB643813
mGAPDHtgtcagcaatgcatcctgcaNM_008084ccgttcagctctgggatgacNM_008084

Primers supplied with the Cap Site cDNA kit.

Sequences in the Fig. 1A.

Sequences in the Fig. 1B.

Real-time PCR analysis

Total RNA (5 μg) was reverse transcribed at 50 °C for 60 min in 20 μl reaction mixture containing 200 units of Superscript III transcriptase (Invitrogen), 0.5 mM dNTPs, 10 mM dithiothreitol, 50 μM random primers, and 1× first-strand buffer supplied by the manufacturer. After the inactivation of the reverse transcriptase by heating at 70 °C for 15 min, the cDNA product was subjected to real-time PCR with the Real-time PCR system 7500 (Applied Biosystems, Tokyo, Japan). PCR was carried out with a thermal protocol consisting of 95 °C for 15 s and 60 °C for 35 s in 25 μl buffer containing 1× Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen) and 0.2 μM each of the forward and reverse primers listed in Table 1. Quantitative measurement was performed by establishing a linear amplification of serial dilutions of the plasmid DNA (pGEM-T Easy vector) containing each cDNA fragment amplified by the PCR with the first- or last exon-specific primers.

Statistical analysis

All data were analyzed by one-way ANOVA and are expressed as mean±s.d. The significance of the F values obtained was confirmed by Tukey's post-hoc test. All analyses were performed using GraphPad Prism Software version 4 (GraphPad Software, San Diego, CA, USA).

Results

Identification and genomic organization of multiple first exons in murine Prlr gene

Both the mE14- and the mE15-Prlr cDNAs were cloned from the brain by the oligo-capping method. The sequences of mE14- and mE15-first exons are shown in Fig. 1A. mE14 and mE15 shared 69.4 and 91.8% sequence identities with rat E14 and E15 respectively. A computer-assisted sequence search revealed the positions of the five first exons in Prlr gene (NT 039618) located in chromosome 15 of the C57BL/6 mouse strain. Figure 1B shows a schematic representation of the organization of these first exons together with exons 2 and 3 in Prlr gene. mE14 was located downstream of exon 2, accounting for the lack of the exon 2 sequence in the mE14-cDNA (data not shown).

Figure 1
Figure 1

Nucleotide sequences of mE14 and mE15 first exons and schematic representation of the organization of the five first exons of murine Prlr gene. (A) The sequences of the first exon portions of mE14- and mE15-Prlr cDNAs are shown. The sequence spanning exon 1 to exon 3 of murine Prlr gene was obtained from the Mouse Genome Database (NT 039618.3). (B) The diagrams show arrangement of the five first exons. The exons in gene are represented by vertical bars.

Citation: Journal of Molecular Endocrinology 48, 2; 10.1530/JME-11-0122

Expression levels of the first exon variants of Prlr mRNAs in murine tissues

The expression levels of Prlr mRNAs containing each of the first exons in the tissues of the diestrus mice were examined by real-time PCR (Fig. 2). The expression of mE11-Prlr mRNA was not observed in any tissues under the experimental conditions we used. However, mE12-Prlr mRNA was expressed in both the liver and the kidney, with higher levels present in the liver. The mE13-Prlr mRNA expression was observed in all the tissues examined, with markedly high levels in the liver and choroid plexus and moderately high levels in the adrenal gland. The mE14-Prlr mRNA was expressed in the choroid plexus and forebrain, with remarkably high levels present in the choroid plexus. Finally, mE15-Prlr mRNA expression was observed in the choroid plexus, forebrain, liver, and kidney, with the most abundant levels apparent in the choroid plexus. The expression levels of total Prlr mRNA were markedly high in the liver and choroid plexus, moderately high in the kidney, and relatively low in the other tissues; this reflects the expression levels of each of the first exon in the respective tissues.

Figure 2
Figure 2

Tissue distributions of the first exon variants of murine Prlr mRNA. Expression levels of (A) mE12-, (B) mE13-, (C) mE14-, (D) mE15-, and (E) total Prlr mRNAs in the liver (Li), kidney (Ki), spleen (Sp), adrenal gland (Ad), ovary (Ov), forebrain (FB), and choroid plexus (CP) in diestrus mice were determined by real-time PCR. Values are expressed as relative to the value of Gapdh mRNA, and they represent mean±s.d. (n=4). Data for each mRNA variant are shown in the tissues where each mRNA was detected.

Citation: Journal of Molecular Endocrinology 48, 2; 10.1530/JME-11-0122

Expression levels of the first exon variants of Prlr mRNAs in the choroid plexus of diestrus, lactating, and PRL-deficient mice

As the expression of mE11- and mE12-Prlr mRNAs were not observed in the choroid plexus at day 3 of lactation mice as well as the diestrus mice by RT-PCR analysis (data not shown), the expression levels of mE13-, mE14-, and mE15-Prlr mRNAs in the choroid plexus were examined in the diestrus, lactating, and Prl−/− mice (Fig. 3). In the wild-type (Prl+/+) mice, the levels of mE13-, mE14-, and mE15-Prlr mRNAs were significantly increased at day 3 of lactation compared with those at the diestrus state, with the most prominent difference occurring in mE14-Prlr mRNA. Reflecting these results, the level of total Prlr mRNA was markedly increased at the lactation state. The mE14-Prlr mRNA level was significantly lower in the diestrus Prl−/− mice than in the diestrus Prl+/− mice, whereas no significant difference was observed in the levels of mE13- and mE15-Prlr mRNAs. In addition, the total Prlr mRNA level was significantly lower in the diestrus Prl−/− mice than in the diestrus Prl+/− mice.

Figure 3
Figure 3

Expression levels of the first exon variants of Prlr mRNA in the choroid plexus of diestrus, lactating, and PRL-deficient mice. The expression levels of (A) mE13-, (B) mE14-, (C) mE15-, and (D) total Prlr mRNAs in diestrus (Di) and day 3 lactating (Lac) Prl+/+ mice, and diestrus Prl+/− and Prl−/− mice were determined by real-time PCR. Values are expressed as relative to the value of Gapdh mRNA, and they represent mean±s.d. (n=4). Values with different letters are significantly different (P<0.05).

Citation: Journal of Molecular Endocrinology 48, 2; 10.1530/JME-11-0122

Effects of PRL and E2 on expression levels of the first exon variants of Prlr mRNA in the choroid plexus

The effects of PRL and E2 on the expression levels of mE13-, mE14-, and mE15-Prlr mRNAs in the choroid plexus were examined in the sham-operated or ovariectomized Prl+/− and Prl−/− mice (Fig. 4). Neither the ovariectomy nor the administration of PRL or E2 had a significant effect on the expression levels of mE13- or mE15-Prlr mRNAs in the Prl+/− or Prl−/− mice. However, in the Prl+/− mice, the expression level of mE14-Prlr mRNA was markedly decreased by the ovariectomy and was recovered by the E2 administration. In the Prl−/− mice, neither the ovariectomy nor the E2 administration had an effect on the expression level of mE14-Prlr mRNA, although the PRL administration significantly increased the expression level. No additive effect was observed by the simultaneous administration of PRL and E2.

Figure 4
Figure 4

Effects of PRL and estrogen treatment on the expression levels of the first exon variants of Prlr mRNAs in the choroid plexus of Prl+/− and Prl−/− mice. Expression levels of (A) mE13-, (B) mE14-, and (C) mE15-Prlr mRNAs in the choroid plexus of sham-operated (Sham) mice, ovariectomized (Ovx) mice, estrogen-treated ovariectomized (Ovx+E2) mice, PRL-treated ovariectomized (Ovx+PRL) mice, and estrogen- and PRL-treated ovariectomized (Ovx+E2+PRL) mice are presented. Values represent mean±s.d. (n=4). Values with different letters are significantly different (P<0.05).

Citation: Journal of Molecular Endocrinology 48, 2; 10.1530/JME-11-0122

Identification of the murine ortholog for rat short-form Prlr mRNA and genomic organization of the multiple last exons in murine Prlr gene

A cDNA that encodes the mouse ortholog for the rat short-form PRLR was cloned from the choroid plexus of a C57BL/6 mouse (Fig. 5A). The obtained cDNA, which is referred to as Prlr-S4, encoded a protein consisting of 310 amino acids (accession no. AB643813), showing 93% overall sequence identity with the rat short-form PRLR. The nucleotide sequence of Prlr-S4 was similar to that of Prlr-S3 cDNA cloned from a Swiss Webster mouse (Davis & Linzer 1989), but there are considerable mismatches including the deletion of a single nucleotide at codon 78, which is the cause for the truncated amino acid sequence of PRLR-S3. Four alternative last exons encoding the 3′-end sequences of Prlr-L, -S1, -S2, or -S4 mRNAs were found in Prlr gene of the C57BL/6 mouse (NT 039618). The arrangement of the alternative last exons is shown in Fig. 5B.

Figure 5
Figure 5

Nucleotide sequence of Prlr-S4 cDNA that encodes short-form PRLR. (A) The deduced amino acid sequence is shown under the cDNA sequence. The transmembrane domain is denoted with a thick underline. The unique region encoded by an alternative last exon is boxed. (B) The diagrams show arrangement of the four last exons. The exons in the gene are represented by vertical bars.

Citation: Journal of Molecular Endocrinology 48, 2; 10.1530/JME-11-0122

Expression levels of the last exon variants of Prlr mRNAs in the choroid plexus of diestrus, lactating, and PRL-deficient mice

The expression levels of the last exon variants of Prlr mRNAs in the choroid plexus were examined by real-time PCR (Fig. 6). These results revealed that Prlr-L mRNA was abundantly expressed, but among the three short-form variants, only Prlr-S4 mRNA was detected at a measurable level. In the Prl+/+ mice, the expression level of PRLR-L mRNA was markedly higher in the lactation state than in the diestrus state. The expression levels of Prlr-S4 mRNA in the lactating mice were also significantly higher than those in the diestrus mice. The expression levels of Prlr-L and Prlr-S4 mRNAs in the diestrus Prl+/− mice were similar to those in the diestrus Prl+/+ mice and significantly decreased in the diestrus Prl−/− mice.

Figure 6
Figure 6

Expression levels of the last exon variants of Prlr mRNA in the choroid plexus of diestrus, lactating, and PRL-deficient mice. The expression levels of (A) Prlr-L and (B) Prlr-S4 mRNAs in diestrus (Di), day 3 lactating (Lac) Prl+/+, Prl+/−, and Prl−/− mice were determined by real-time PCR. Values are expressed as relative to the value of Gapdh mRNA, and they represent mean±s.d. (n=4). Values with different letters are significantly different (P<0.05).

Citation: Journal of Molecular Endocrinology 48, 2; 10.1530/JME-11-0122

Discussion

In addition to the three known first exons, two other distinct first exons were identified in murine Prlr gene. These five first exons are similar to the rat counterparts in terms of both their sequence and positional arrangement in Prlr gene (Hu et al. 1996, Kobayashi et al. 2007). The tissue expression patterns of each of the first exon variants of murine Prlr mRNA were also comparable to those of the rat counterparts, except for the silent expression of mE11-Prlr mRNA in all the tissues analyzed. In rats, E11 has been shown to be a gonad-specific first exon activated by steroidogenic factor 1 (SF-1 (NR5A1); Hu et al. 1997). Although, mE11-Prlr mRNA has been detected in a murine Leydig tumor cell line, the expression level was very low due to the absence of the functional SF-1 binding element in the promoter region (Hu et al. 1997, 1998). In our present study, mE13-PRLR was the only Prlr mRNA detected in the ovary, suggesting that the Prlr gene expression in the mouse ovary depends on the transcription of mE13.

In the murine choroid plexus, mE13-, mE14-, and mE15-Prlr mRNAs were expressed in a similar manner as in the rat choroid plexus. It has been previously demonstrated that the expression level of Prlr mRNA in the rat choroid plexus increases to the highest level during lactation (Augustine et al. 2003, Anderson et al. 2008) and is accompanied by a high serum PRL level (Escalada et al. 1996, Augustine et al. 2003). These findings suggest that Prlr gene expression in the choroid plexus is upregulated by PRL. Our present study showed that the expression levels of mE13-, mE14-, and mE15-Prlr mRNAs in the murine choroid plexus were more increased in the lactating mice than in the diestrus mice, with a particularly large increase in the levels of mE14-Prlr mRNA. Furthermore, the expression level of mE14-Prlr mRNA but not mE13- or mE15-Prlr mRNAs were decreased in the Prl−/− mice compared with the corresponding levels in the Prl+/− mice. These results indicate that PRL upregulates the expression of mE14-Prlr mRNA in the murine choroid plexus and that the increased expression of mE13- and mE15-Prlr mRNAs at lactation may depend on factors other than PRL. It has been previously shown that estrogen upregulates Prlr gene expression in the choroid plexus (Pi et al. 2003) as well as Prl gene expression in the pituitary gland (Shull & Gorski 1990, Kansra et al. 2005). Our experiments in this study involving the ovariectomized mice showed that estrogen upregulates the expression of mE14-Prlr mRNAs in the Prl+/− mice but not in the Prl−/− mice. These findings indicate that the upregulating effect of estrogen on the expression of murine Prlr gene is mediated through the transcriptional activation of mE14 by PRL, whose production is stimulated by estrogen.

The expression of the long- and short-form Prlr mRNAs has been observed previously in the rat choroid plexus. Similarly, PRLR-L, the long-form variant, and PRLR-S4, the murine ortholog of the rat short-form PRLR, were expressed in the mouse choroid plexus. Prlr-S3 cDNA cloned from the liver of a Swiss Webster strain showed high sequence similarity with the rat short-form PRLR, but it encoded a truncated form of PRLR consisting of 97 amino acids and, therefore, is considered as a product of a pseudogene (Davis & Linzer 1989). However, the sequence of Prlr-S4 cDNA was completely identical with that of the corresponding regions of Prlr gene of the C57BL/6 strain, and no pseudogene sequence was found in this mouse strain. In the rat choroid plexus, the expression levels of both the mRNAs increase during lactation (Ouhtit et al. 1993, Bakowska & Morrell 1997, Augustine et al. 2003, Nogami et al. 2007). In this study, the expression levels of the PRLR-L and PRLR-S4 variants were significantly increased in the lactating mice compared with those in the diestrus mice and were decreased in the PRL-deficient mice compared with the levels in the PRL-normal (i.e. Prl+/+ and Prl+/−) mice. These expression patterns are similar to those of mE14-Prlr mRNA, indicating that the expression of Prlr-L and Prlr-S4 mRNAs in the choroid plexus largely depend on the transcriptional activation of mE14 first exon by PRL.

It is well known that the JAK2/STAT5 pathway is a major intracellular signaling pathway of the long-form PRLR. In this pathway, binding of PRL to the long-form receptor activates the kinase JAK2 and subsequently the transcription factor STAT5 by phosphorylation. In the murine choroid plexus, the amount of phosphorylated STAT5 is increased by the administration of PRL (Brown et al. 2010). Collectively, these findings suggest that the JAK2/STAT5 pathway is activated by PRL action on the long-form PRLR, and the activated STAT5 stimulates the Prlr gene expression by transcriptional activation of mE14 in the murine choroid plexus. In addition, they also suggest that the increased long and/or short forms of PRLR facilitate the uptake of blood PRL into the CSF by the receptor-mediated transport system. However, the molecular mechanisms of transcriptional activation of mE14 first exon and the PRLR-mediated transport system of PRL in the choroid plexus remain to be elucidated.

In conclusion, our present study demonstrated the presence of mE14, and mE15 first exons in addition to the known mE11, mE12, and mE13 first exons in murine Prlr gene. Our experiments also revealed the tissue expression pattern of each first exon variant of Prlr mRNA. The expression level of mE14-Prlr mRNA in the choroid plexus was markedly increased in the lactating mice and was significantly decreased in the PRL-deficient mice. PRL administration, but not estrogen, to the ovariectomized PRL-deficient mice significantly recovered the expression level of mE14-Prlr mRNA. The expression levels of long- and short-form Prlr mRNAs were closely related to those of mE14-Prlr. These data suggest that PRL upregulates transcription of mE14 first exon mainly through the long-form PRLR signaling pathway in the murine choroid plexus.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported in part by the Japan Pet Care Association.

References

  • AndersonGMKieserDCSteynFJGrattanDR2008Hypothalamic prolactin receptor messenger ribonucleic acid levels, prolactin signaling, and hyperprolactinemic inhibition of pulsatile luteinizing hormone secretion are dependent on estradiol. Endocrinology14915621570. doi:10.1210/en.2007-0867.

    • Search Google Scholar
    • Export Citation
  • AugustineRAKokayICAndrewsZBLadymanSRGrattanDR2003Quantitation of prolactin receptor mRNA in the maternal rat brain during pregnancy and lactation. Journal of Molecular Endocrinology31221232. doi:10.1677/jme.0.0310221.

    • Search Google Scholar
    • Export Citation
  • BakowskaJCMorrellJI1997Atlas of the neurons that express mRNA for the long form of the prolactin receptor in the forebrain of the female rat. Journal of Comparative Neurology386161177. doi:10.1002/(SICI)1096-9861(19970922)386:2<161::AID-CNE1>3.0.CO;2-#.

    • Search Google Scholar
    • Export Citation
  • Bole-FeysotCGoffinVEderyMBinartNKellyPA1998Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocrine Reviews19225268. doi:10.1210/er.19.3.225.

    • Search Google Scholar
    • Export Citation
  • BoutinJMEderyMShirotaMJolicoeurCLesueurLAliSGouldDDjianeJKellyPA1989Identification of a cDNA encoding a long form of prolactin receptor in human hepatoma and breast cancer cells. Molecular Endocrinology314551461. doi:10.1210/mend-3-9-1455.

    • Search Google Scholar
    • Export Citation
  • BrownRSKokayICHerbisonAEGrattanDR2010Distribution of prolactin-responsive neurons in the mouse forebrain. Journal of Comparative Neurology51892102. doi:10.1002/cne.22208.

    • Search Google Scholar
    • Export Citation
  • BrooksPJFunabashiTKleopoulosSPMobbsCVPfaffDW1992Prolactin receptor messenger RNA is synthesized by the epithelial cells of the choroid plexus. Brain Research. Molecular Brain Research16163167. doi:10.1016/0169-328X(92)90207-R.

    • Search Google Scholar
    • Export Citation
  • ChiuSWisePM1994Prolactin receptor mRNA localization in the hypothalamus by in situ hybridization. Journal of Neuroendocrinology6191199. doi:10.1111/j.1365-2826.1994.tb00572.x.

    • Search Google Scholar
    • Export Citation
  • ChiuSKoosRDWisePM1992Detection of prolactin receptor (PRL-R) mRNA in the rat hypothalamus and pituitary gland. Endocrinology13017471749. doi:10.1210/en.130.3.1747.

    • Search Google Scholar
    • Export Citation
  • ClarkeDLLinzerDI1993Changes in prolactin receptor expression during pregnancy in the mouse ovary. Endocrinology133224232. doi:10.1210/en.133.1.224.

    • Search Google Scholar
    • Export Citation
  • DasRVonderhaarBK1995Transduction of prolactin's (PRL) growth signal through both long and short forms of the PRL receptor. Molecular Endocrinology917501759. doi:10.1210/me.9.12.1750.

    • Search Google Scholar
    • Export Citation
  • DavisJALinzerDI1989Expression of multiple forms of the prolactin receptor in mouse liver. Molecular Endocrinology3674680. doi:10.1210/mend-3-4-674.

    • Search Google Scholar
    • Export Citation
  • Di CarloRMuccioliGPapottiMBussolatiG1992Characterization of prolactin receptor in human brain and choroid plexus. Brain Research570341346. doi:10.1016/0006-8993(92)90599-5.

    • Search Google Scholar
    • Export Citation
  • EscaladaJCacicedoLOrtegoJMelianESánchez-FrancoF1996Prolactin gene expression and secretion during pregnancy and lactation in the rat: role of dopamine and vasoactive intestinal peptide. Endocrinology137631637. doi:10.1210/en.137.2.631.

    • Search Google Scholar
    • Export Citation
  • FreemanMEKanyicskaBLerantANagyG2000Prolactin: structure, function, and regulation of secretion. Physiological Reviews8015231631.

  • FujikawaTSoyaHYoshizatoHSakaguchiKDoh-UraKTanakaMNakashimaK1995Restraint stress enhances the gene expression of prolactin receptor long form at the choroid plexus. Endocrinology13656085613. doi:10.1210/en.136.12.5608.

    • Search Google Scholar
    • Export Citation
  • FujikawaTSoyaHTamashiroKLSakaiRRMcEwenBSNakaiNOgataMSuzukiINakashimaK2004Prolactin prevents acute stress-induced hypocalcemia and ulcerogenesis by acting in the brain of rat. Endocrinology14520062013. doi:10.1210/en.2003-1446.

    • Search Google Scholar
    • Export Citation
  • HorsemanNDZhaoWMontecino-RodriguezETanakaMNakashimaKEngleSJSmithFMarkoffEDorshkindK1997Defective mammopoiesis, but normal hematopoiesis, in mice with a targeted disruption of the prolactin gene. EMBO Journal1669266935. doi:10.1093/emboj/16.23.6926.

    • Search Google Scholar
    • Export Citation
  • HuZZhuangLDufauML1996Multiple and tissue-specific promoter control of gonadal and non-gonadal prolactin receptor gene expression. Journal of Biological Chemistry271110242110246. doi:10.1074/jbc.271.17.10242.

    • Search Google Scholar
    • Export Citation
  • HuZZhuangLGuanXMengJDufauM1997Steroidgenic factor-1 is an essential transcriptional activator for gonad-specific expression of promoter I of the rat prolactin receptor gene. Journal of Biological Chemistry2721426314271. doi:10.1074/jbc.272.22.14263.

    • Search Google Scholar
    • Export Citation
  • HuZZhuangLMengJDufauML1998Transcriptional regulation of the generic promoter III of the rat prolactin receptor gene by C/EBPβ and SP1. Journal of Biological Chemistry2732622526235. doi:10.1074/jbc.273.40.26225.

    • Search Google Scholar
    • Export Citation
  • HuZZhuangLMengJLeondiresMDufauML1999The human prolactin receptor gene structure and alternative promoter utilization: the generic promoter hPIII and a novel human promoter hP(N). Journal of Clinical Endocrinology and Metabolism8411531156. doi:10.1210/jc.84.3.1153.

    • Search Google Scholar
    • Export Citation
  • HuZZZhuangLMengJTsai-MorrisCHDufauML2002Complex 5′ genomic structure of the human prolactin receptor: multiple alternative exons 1 and promoter utilization. Endocrinology14321392142. doi:10.1210/en.143.6.2139.

    • Search Google Scholar
    • Export Citation
  • KansraSYamagataSSneadeLFosterLBen-JonathanN2005Differential effects of estrogen receptor antagonists on pituitary lactotroph proliferation and prolactin release. Molecular and Cellular Endocrinology2392736. doi:10.1016/j.mce.2005.04.008.

    • Search Google Scholar
    • Export Citation
  • KobayashiMSuzukiMSaitoTRTanakaM2007Developmental changes in the expression levels of alternative first exons of prolactin receptor gene in rat brain. Endocrine Research32143151. doi:10.1080/07435800701764022.

    • Search Google Scholar
    • Export Citation
  • MangurianLPWalshRJPosnerBI1992Prolactin enhancement of its own uptake at the choroid plexus. Endocrinology131698702. doi:10.1210/en.131.2.698.

    • Search Google Scholar
    • Export Citation
  • MaruyamaKSuganoS1994Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene138171174. doi:10.1016/0378-1119(94)90802-8.

    • Search Google Scholar
    • Export Citation
  • MoldrupAOrmandyCNaganoMMurthyKBanvilleDTroncheFKellyPA1996Differential promoter usage in prolactin receptor gene expression: hepatocyte nuclear factor 4 binds to and activates the promoter preferentially active in the liver. Molecular Endocrinology10661671. doi:10.1210/me.10.6.661.

    • Search Google Scholar
    • Export Citation
  • MooreRCOkaT1993Cloning and sequencing of the cDNA encoding the murine mammary gland long-form prolactin receptor. Gene134263265. doi:10.1016/0378-1119(93)90104-B.

    • Search Google Scholar
    • Export Citation
  • MuccioliGDi CarloR1994Modulation of prolactin receptors in the rat hypothalamus in response to changes in serum concentration of endogenous prolactin or to ovine prolactin administration. Brain Research663244250. doi:10.1016/0006-8993(94)91269-6.

    • Search Google Scholar
    • Export Citation
  • NaganoMKellyPA1994Tissue distribution and regulation of rat prolactin receptor gene expression. Quantitative analysis by polymerase chain reaction. Journal of Biological Chemistry2691333713345.

    • Search Google Scholar
    • Export Citation
  • NogamiHHoshinoROgasawaraKMiyamotoSHisanoS2007Region-specific expression and hormonal regulation of the first exon variants of rat prolactin receptor mRNA in rat brain and anterior pituitary gland. Journal of Neuroendocrinology19583593. doi:10.1111/j.1365-2826.2007.01565.x.

    • Search Google Scholar
    • Export Citation
  • OuhtitAMorelGKellyPA1993Visualization of gene expression of short and long forms of prolactin receptor in the rat. Endocrinology133135144. doi:10.1210/en.133.1.135.

    • Search Google Scholar
    • Export Citation
  • PiXJGrattanDR1999Increased expression of both short and long forms of prolactin receptor mRNA in hypothalamic nuclei of lactating rats. Journal of Molecular Endocrinology231322. doi:10.1677/jme.0.0230013.

    • Search Google Scholar
    • Export Citation
  • PiXZhangBLiJVoogtJL2003Promoter usage and estrogen regulation of prolactin receptor gene in the brain of the female rat. Neuroendocrinology77187197. doi:10.1159/000069510.

    • Search Google Scholar
    • Export Citation
  • ShirotaMBanvilleDAliSJolicoeurCBoutinJMEderyMDjianeJKellyPA1990Expression of two forms of prolactin receptor in rat ovary and liver. Molecular Endocrinology411361143. doi:10.1210/mend-4-8-1136.

    • Search Google Scholar
    • Export Citation
  • ShullJDGorskiJ1990Regulation of prolactin gene transcription in vivo: interactions between estrogen, pimozide, and alpha-ergocryptine. Molecular Pharmacology37215221.

    • Search Google Scholar
    • Export Citation
  • SugiyamaTMinouraHToyodaNSakaguchiKTanakaMSudoSNakashimaK1996Pup contact induces the expression of long form prolactin receptor mRNA in the brain of female rats: effects of ovariectomy and hypophysectomy on receptor gene expression. Journal of Endocrinology149335340. doi:10.1677/joe.0.1490335.

    • Search Google Scholar
    • Export Citation
  • TanakaMHayashidaYIguchiTNakaoNSuzukiMNakaiNNakashimaK2002Identification of a novel first exon of prolactin receptor gene expressed in the rat brain. Endocrinology14320802084. doi:10.1210/en.143.6.2080.

    • Search Google Scholar
    • Export Citation
  • TanakaMSuzukiMKawanaTSegawaMYoshikawaMMoriMKobayashiMNakaiNSaitoTR2005Differential effects of sex steroid hormones on the expressions of multiple first exons including a novel first exon of prolactin receptor gene in the rat liver. Journal of Molecular Endocrinology34667673. doi:10.1677/jme.1.01702.

    • Search Google Scholar
    • Export Citation
  • TrottJFHoveyRCKoduriSVonderhaarBK2003Alternative splicing to exon 11 of human prolactin receptor gene results in multiple isoforms including a secreted prolactin-binding protein. Journal of Molecular Endocrinology303147. doi:10.1677/jme.0.0300031.

    • Search Google Scholar
    • Export Citation
  • WalshRJSlabyFJPosnerBI1987A receptor-mediated mechanism for the transport of prolactin from blood to cerebrospinal fluid. Endocrinology12018461850. doi:10.1210/endo-120-5-1846.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 330 202 5
PDF Downloads 148 119 5
  • View in gallery

    Nucleotide sequences of mE14 and mE15 first exons and schematic representation of the organization of the five first exons of murine Prlr gene. (A) The sequences of the first exon portions of mE14- and mE15-Prlr cDNAs are shown. The sequence spanning exon 1 to exon 3 of murine Prlr gene was obtained from the Mouse Genome Database (NT 039618.3). (B) The diagrams show arrangement of the five first exons. The exons in gene are represented by vertical bars.

  • View in gallery

    Tissue distributions of the first exon variants of murine Prlr mRNA. Expression levels of (A) mE12-, (B) mE13-, (C) mE14-, (D) mE15-, and (E) total Prlr mRNAs in the liver (Li), kidney (Ki), spleen (Sp), adrenal gland (Ad), ovary (Ov), forebrain (FB), and choroid plexus (CP) in diestrus mice were determined by real-time PCR. Values are expressed as relative to the value of Gapdh mRNA, and they represent mean±s.d. (n=4). Data for each mRNA variant are shown in the tissues where each mRNA was detected.

  • View in gallery

    Expression levels of the first exon variants of Prlr mRNA in the choroid plexus of diestrus, lactating, and PRL-deficient mice. The expression levels of (A) mE13-, (B) mE14-, (C) mE15-, and (D) total Prlr mRNAs in diestrus (Di) and day 3 lactating (Lac) Prl+/+ mice, and diestrus Prl+/− and Prl−/− mice were determined by real-time PCR. Values are expressed as relative to the value of Gapdh mRNA, and they represent mean±s.d. (n=4). Values with different letters are significantly different (P<0.05).

  • View in gallery

    Effects of PRL and estrogen treatment on the expression levels of the first exon variants of Prlr mRNAs in the choroid plexus of Prl+/− and Prl−/− mice. Expression levels of (A) mE13-, (B) mE14-, and (C) mE15-Prlr mRNAs in the choroid plexus of sham-operated (Sham) mice, ovariectomized (Ovx) mice, estrogen-treated ovariectomized (Ovx+E2) mice, PRL-treated ovariectomized (Ovx+PRL) mice, and estrogen- and PRL-treated ovariectomized (Ovx+E2+PRL) mice are presented. Values represent mean±s.d. (n=4). Values with different letters are significantly different (P<0.05).

  • View in gallery

    Nucleotide sequence of Prlr-S4 cDNA that encodes short-form PRLR. (A) The deduced amino acid sequence is shown under the cDNA sequence. The transmembrane domain is denoted with a thick underline. The unique region encoded by an alternative last exon is boxed. (B) The diagrams show arrangement of the four last exons. The exons in the gene are represented by vertical bars.

  • View in gallery

    Expression levels of the last exon variants of Prlr mRNA in the choroid plexus of diestrus, lactating, and PRL-deficient mice. The expression levels of (A) Prlr-L and (B) Prlr-S4 mRNAs in diestrus (Di), day 3 lactating (Lac) Prl+/+, Prl+/−, and Prl−/− mice were determined by real-time PCR. Values are expressed as relative to the value of Gapdh mRNA, and they represent mean±s.d. (n=4). Values with different letters are significantly different (P<0.05).

  • AndersonGMKieserDCSteynFJGrattanDR2008Hypothalamic prolactin receptor messenger ribonucleic acid levels, prolactin signaling, and hyperprolactinemic inhibition of pulsatile luteinizing hormone secretion are dependent on estradiol. Endocrinology14915621570. doi:10.1210/en.2007-0867.

    • Search Google Scholar
    • Export Citation
  • AugustineRAKokayICAndrewsZBLadymanSRGrattanDR2003Quantitation of prolactin receptor mRNA in the maternal rat brain during pregnancy and lactation. Journal of Molecular Endocrinology31221232. doi:10.1677/jme.0.0310221.

    • Search Google Scholar
    • Export Citation
  • BakowskaJCMorrellJI1997Atlas of the neurons that express mRNA for the long form of the prolactin receptor in the forebrain of the female rat. Journal of Comparative Neurology386161177. doi:10.1002/(SICI)1096-9861(19970922)386:2<161::AID-CNE1>3.0.CO;2-#.

    • Search Google Scholar
    • Export Citation
  • Bole-FeysotCGoffinVEderyMBinartNKellyPA1998Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocrine Reviews19225268. doi:10.1210/er.19.3.225.

    • Search Google Scholar
    • Export Citation
  • BoutinJMEderyMShirotaMJolicoeurCLesueurLAliSGouldDDjianeJKellyPA1989Identification of a cDNA encoding a long form of prolactin receptor in human hepatoma and breast cancer cells. Molecular Endocrinology314551461. doi:10.1210/mend-3-9-1455.

    • Search Google Scholar
    • Export Citation
  • BrownRSKokayICHerbisonAEGrattanDR2010Distribution of prolactin-responsive neurons in the mouse forebrain. Journal of Comparative Neurology51892102. doi:10.1002/cne.22208.

    • Search Google Scholar
    • Export Citation
  • BrooksPJFunabashiTKleopoulosSPMobbsCVPfaffDW1992Prolactin receptor messenger RNA is synthesized by the epithelial cells of the choroid plexus. Brain Research. Molecular Brain Research16163167. doi:10.1016/0169-328X(92)90207-R.

    • Search Google Scholar
    • Export Citation
  • ChiuSWisePM1994Prolactin receptor mRNA localization in the hypothalamus by in situ hybridization. Journal of Neuroendocrinology6191199. doi:10.1111/j.1365-2826.1994.tb00572.x.

    • Search Google Scholar
    • Export Citation
  • ChiuSKoosRDWisePM1992Detection of prolactin receptor (PRL-R) mRNA in the rat hypothalamus and pituitary gland. Endocrinology13017471749. doi:10.1210/en.130.3.1747.

    • Search Google Scholar
    • Export Citation
  • ClarkeDLLinzerDI1993Changes in prolactin receptor expression during pregnancy in the mouse ovary. Endocrinology133224232. doi:10.1210/en.133.1.224.

    • Search Google Scholar
    • Export Citation
  • DasRVonderhaarBK1995Transduction of prolactin's (PRL) growth signal through both long and short forms of the PRL receptor. Molecular Endocrinology917501759. doi:10.1210/me.9.12.1750.

    • Search Google Scholar
    • Export Citation
  • DavisJALinzerDI1989Expression of multiple forms of the prolactin receptor in mouse liver. Molecular Endocrinology3674680. doi:10.1210/mend-3-4-674.

    • Search Google Scholar
    • Export Citation
  • Di CarloRMuccioliGPapottiMBussolatiG1992Characterization of prolactin receptor in human brain and choroid plexus. Brain Research570341346. doi:10.1016/0006-8993(92)90599-5.

    • Search Google Scholar
    • Export Citation
  • EscaladaJCacicedoLOrtegoJMelianESánchez-FrancoF1996Prolactin gene expression and secretion during pregnancy and lactation in the rat: role of dopamine and vasoactive intestinal peptide. Endocrinology137631637. doi:10.1210/en.137.2.631.

    • Search Google Scholar
    • Export Citation
  • FreemanMEKanyicskaBLerantANagyG2000Prolactin: structure, function, and regulation of secretion. Physiological Reviews8015231631.

  • FujikawaTSoyaHYoshizatoHSakaguchiKDoh-UraKTanakaMNakashimaK1995Restraint stress enhances the gene expression of prolactin receptor long form at the choroid plexus. Endocrinology13656085613. doi:10.1210/en.136.12.5608.

    • Search Google Scholar
    • Export Citation
  • FujikawaTSoyaHTamashiroKLSakaiRRMcEwenBSNakaiNOgataMSuzukiINakashimaK2004Prolactin prevents acute stress-induced hypocalcemia and ulcerogenesis by acting in the brain of rat. Endocrinology14520062013. doi:10.1210/en.2003-1446.

    • Search Google Scholar
    • Export Citation
  • HorsemanNDZhaoWMontecino-RodriguezETanakaMNakashimaKEngleSJSmithFMarkoffEDorshkindK1997Defective mammopoiesis, but normal hematopoiesis, in mice with a targeted disruption of the prolactin gene. EMBO Journal1669266935. doi:10.1093/emboj/16.23.6926.

    • Search Google Scholar
    • Export Citation
  • HuZZhuangLDufauML1996Multiple and tissue-specific promoter control of gonadal and non-gonadal prolactin receptor gene expression. Journal of Biological Chemistry271110242110246. doi:10.1074/jbc.271.17.10242.

    • Search Google Scholar
    • Export Citation
  • HuZZhuangLGuanXMengJDufauM1997Steroidgenic factor-1 is an essential transcriptional activator for gonad-specific expression of promoter I of the rat prolactin receptor gene. Journal of Biological Chemistry2721426314271. doi:10.1074/jbc.272.22.14263.

    • Search Google Scholar
    • Export Citation
  • HuZZhuangLMengJDufauML1998Transcriptional regulation of the generic promoter III of the rat prolactin receptor gene by C/EBPβ and SP1. Journal of Biological Chemistry2732622526235. doi:10.1074/jbc.273.40.26225.

    • Search Google Scholar
    • Export Citation
  • HuZZhuangLMengJLeondiresMDufauML1999The human prolactin receptor gene structure and alternative promoter utilization: the generic promoter hPIII and a novel human promoter hP(N). Journal of Clinical Endocrinology and Metabolism8411531156. doi:10.1210/jc.84.3.1153.

    • Search Google Scholar
    • Export Citation
  • HuZZZhuangLMengJTsai-MorrisCHDufauML2002Complex 5′ genomic structure of the human prolactin receptor: multiple alternative exons 1 and promoter utilization. Endocrinology14321392142. doi:10.1210/en.143.6.2139.

    • Search Google Scholar
    • Export Citation
  • KansraSYamagataSSneadeLFosterLBen-JonathanN2005Differential effects of estrogen receptor antagonists on pituitary lactotroph proliferation and prolactin release. Molecular and Cellular Endocrinology2392736. doi:10.1016/j.mce.2005.04.008.

    • Search Google Scholar
    • Export Citation
  • KobayashiMSuzukiMSaitoTRTanakaM2007Developmental changes in the expression levels of alternative first exons of prolactin receptor gene in rat brain. Endocrine Research32143151. doi:10.1080/07435800701764022.

    • Search Google Scholar
    • Export Citation
  • MangurianLPWalshRJPosnerBI1992Prolactin enhancement of its own uptake at the choroid plexus. Endocrinology131698702. doi:10.1210/en.131.2.698.

    • Search Google Scholar
    • Export Citation
  • MaruyamaKSuganoS1994Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene138171174. doi:10.1016/0378-1119(94)90802-8.

    • Search Google Scholar
    • Export Citation
  • MoldrupAOrmandyCNaganoMMurthyKBanvilleDTroncheFKellyPA1996Differential promoter usage in prolactin receptor gene expression: hepatocyte nuclear factor 4 binds to and activates the promoter preferentially active in the liver. Molecular Endocrinology10661671. doi:10.1210/me.10.6.661.

    • Search Google Scholar
    • Export Citation
  • MooreRCOkaT1993Cloning and sequencing of the cDNA encoding the murine mammary gland long-form prolactin receptor. Gene134263265. doi:10.1016/0378-1119(93)90104-B.

    • Search Google Scholar
    • Export Citation
  • MuccioliGDi CarloR1994Modulation of prolactin receptors in the rat hypothalamus in response to changes in serum concentration of endogenous prolactin or to ovine prolactin administration. Brain Research663244250. doi:10.1016/0006-8993(94)91269-6.

    • Search Google Scholar
    • Export Citation
  • NaganoMKellyPA1994Tissue distribution and regulation of rat prolactin receptor gene expression. Quantitative analysis by polymerase chain reaction. Journal of Biological Chemistry2691333713345.

    • Search Google Scholar
    • Export Citation
  • NogamiHHoshinoROgasawaraKMiyamotoSHisanoS2007Region-specific expression and hormonal regulation of the first exon variants of rat prolactin receptor mRNA in rat brain and anterior pituitary gland. Journal of Neuroendocrinology19583593. doi:10.1111/j.1365-2826.2007.01565.x.

    • Search Google Scholar
    • Export Citation
  • OuhtitAMorelGKellyPA1993Visualization of gene expression of short and long forms of prolactin receptor in the rat. Endocrinology133135144. doi:10.1210/en.133.1.135.

    • Search Google Scholar
    • Export Citation
  • PiXJGrattanDR1999Increased expression of both short and long forms of prolactin receptor mRNA in hypothalamic nuclei of lactating rats. Journal of Molecular Endocrinology231322. doi:10.1677/jme.0.0230013.

    • Search Google Scholar
    • Export Citation
  • PiXZhangBLiJVoogtJL2003Promoter usage and estrogen regulation of prolactin receptor gene in the brain of the female rat. Neuroendocrinology77187197. doi:10.1159/000069510.

    • Search Google Scholar
    • Export Citation
  • ShirotaMBanvilleDAliSJolicoeurCBoutinJMEderyMDjianeJKellyPA1990Expression of two forms of prolactin receptor in rat ovary and liver. Molecular Endocrinology411361143. doi:10.1210/mend-4-8-1136.

    • Search Google Scholar
    • Export Citation
  • ShullJDGorskiJ1990Regulation of prolactin gene transcription in vivo: interactions between estrogen, pimozide, and alpha-ergocryptine. Molecular Pharmacology37215221.

    • Search Google Scholar
    • Export Citation
  • SugiyamaTMinouraHToyodaNSakaguchiKTanakaMSudoSNakashimaK1996Pup contact induces the expression of long form prolactin receptor mRNA in the brain of female rats: effects of ovariectomy and hypophysectomy on receptor gene expression. Journal of Endocrinology149335340. doi:10.1677/joe.0.1490335.

    • Search Google Scholar
    • Export Citation
  • TanakaMHayashidaYIguchiTNakaoNSuzukiMNakaiNNakashimaK2002Identification of a novel first exon of prolactin receptor gene expressed in the rat brain. Endocrinology14320802084. doi:10.1210/en.143.6.2080.

    • Search Google Scholar
    • Export Citation
  • TanakaMSuzukiMKawanaTSegawaMYoshikawaMMoriMKobayashiMNakaiNSaitoTR2005Differential effects of sex steroid hormones on the expressions of multiple first exons including a novel first exon of prolactin receptor gene in the rat liver. Journal of Molecular Endocrinology34667673. doi:10.1677/jme.1.01702.

    • Search Google Scholar
    • Export Citation
  • TrottJFHoveyRCKoduriSVonderhaarBK2003Alternative splicing to exon 11 of human prolactin receptor gene results in multiple isoforms including a secreted prolactin-binding protein. Journal of Molecular Endocrinology303147. doi:10.1677/jme.0.0300031.

    • Search Google Scholar
    • Export Citation
  • WalshRJSlabyFJPosnerBI1987A receptor-mediated mechanism for the transport of prolactin from blood to cerebrospinal fluid. Endocrinology12018461850. doi:10.1210/endo-120-5-1846.

    • Search Google Scholar
    • Export Citation