Aromatase expression in Xenopus oocytes: a three cell-type model for the ovarian estradiol synthesis

in Journal of Molecular Endocrinology

In contrast to the classical model describing the synthesis of androgens and estrogens as restricted to somatic cells, a previous study demonstrated that Xenopus laevis oocytes participate in androgen synthesis. The objective of our study was to determine whether Xenopus oocytes are also involved in estrogen synthesis. More precisely, we analyzed aromatase expression by in situ hybridization and RT-QPCR and measured aromatase activity. Aromatase, the enzyme responsible for estrogen synthesis, appears to be expressed and active not only in the follicular cells but also in the vitellogenic oocytes. During late oogenesis, aromatase oocyte expression and activity decreased concomitantly with the trend observed in surrounding follicular layers. In order to investigate the role of estradiol-17β (E2), we studied its effect on oocyte meiotic resumption. It appears that, as in Rana pipiens, E2 inhibited the follicle-enclosed maturation of Xenopus oocytes, likely through inhibition of LH-induced maturation-inducing steroid synthesis. In addition, E2 exerted a slight enhancing action on denuded oocyte maturation whose biological significance remains unclear. Together, our results demonstrate that Xenopus oocyte significantly participates in ovarian E2 synthesis and this may be a common feature of vitellogenic vertebrates.

Abstract

In contrast to the classical model describing the synthesis of androgens and estrogens as restricted to somatic cells, a previous study demonstrated that Xenopus laevis oocytes participate in androgen synthesis. The objective of our study was to determine whether Xenopus oocytes are also involved in estrogen synthesis. More precisely, we analyzed aromatase expression by in situ hybridization and RT-QPCR and measured aromatase activity. Aromatase, the enzyme responsible for estrogen synthesis, appears to be expressed and active not only in the follicular cells but also in the vitellogenic oocytes. During late oogenesis, aromatase oocyte expression and activity decreased concomitantly with the trend observed in surrounding follicular layers. In order to investigate the role of estradiol-17β (E2), we studied its effect on oocyte meiotic resumption. It appears that, as in Rana pipiens, E2 inhibited the follicle-enclosed maturation of Xenopus oocytes, likely through inhibition of LH-induced maturation-inducing steroid synthesis. In addition, E2 exerted a slight enhancing action on denuded oocyte maturation whose biological significance remains unclear. Together, our results demonstrate that Xenopus oocyte significantly participates in ovarian E2 synthesis and this may be a common feature of vitellogenic vertebrates.

Keywords:

Introduction

Estradiol-17β (E2) is known to have pleiotropic effects and important roles in female reproductive function in vertebrates, and characterizing the regulation and function of E2 synthesis during ovarian follicular growth is a major challenge in reproductive biology. Throughout oogenesis, E2 is synthesized by ovarian follicles and secreted into the blood. Growth and development of Xenopus laevis follicles are accompanied by shifts in steroidogenic abilities, with E2 produced by medium-sized follicles and androgen and progesterone secreted by large, postvitellogenic follicles (Fortune 1983). In non-mammalian vertebrates, the best-known endocrine effect of E2 is the stimulation of yolk synthesis through hepatic vitellogenins synthesis and secretion into blood circulation. Circulating vitellogenins are taken up by the oocyte leading to oocyte yolk accumulation and growth (Rasar & Hammes 2006). Yolk will provide nutritional reserves necessary for embryo development. More recently, E2 was also shown to enhance progesterone-induced ovulation, possibly through a stimulatory effect on gonadotropin synthesis (Ogawa et al. 2011). In addition to E2 endocrine effects, E2 may have autocrine and/or paracrine effects, as E2 inhibits follicle-enclosed oocyte maturation through inhibition of maturation-inducing steroid (MIS) synthesizing enzymes in vitellogenic species such as Rana pipiens (Schuetz 1972, Spiegel et al. 1978, Lin & Schuetz 1983, 1985) or Oncorhynchus mykiss (Jalabert et al. 1984). This steroid may also activate transcription of particular genes within the oocyte that would play a role in oocyte development, such as IGFBP3, the expression of which has been shown to be positively regulated by E2 in trout oocytes (Kamangar et al. 2006).

E2 is synthesized by the cytochrome P450 aromatase enzyme that converts androstenedione and testosterone into estrone (E1) and E2 respectively. In Xenopus, two variants are expressed in the gonads and a third variant is expressed in the brain (Iwabuchi et al. 2007). As for mammals (Gore-Langton & Amstrong 1988) and fish (Nagahama et al. 1995), a two cell-type model has been proposed to describe amphibian E2 synthesis by the whole follicle (Kwon & Ahn 1994, Ahn et al. 1999). According to this classical model, theca cells provide androgens to granulosa cells that, in turn, aromatize androgens into estrogens. Nevertheless, in Xenopus laevis, some steroidogenic activity had been previously reported in oocytes (Yang et al. 2003). Besides oocyte ability to metabolize exogenous steroid precursors (Reynhout & Smith 1973, Sanyal et al. 1973, Fouchet et al. 1975, Thibier-Fouchet et al. 1976), 17-hydroxylase/17,20-lyase (Cyp17) appeared to be expressed only by the oocyte in Xenopus ovary (Yang et al. 2003). Cyp17 is a key enzyme mediating androgen production, suggesting that Xenopus oocytes participate in synthesis of estrogen precursors. Moreover, Xenopus oocytes were shown to be required for E2 production by growing stage IV follicles in response to gonadotropin (Sretarugsa & Wallace 1997). Thus, the objective of this study was to determine oocyte contribution to E2 synthesis in Xenopus laevis by characterizing the expression and activity of the estrogenic enzyme, the aromatase. Moreover, contradictory results have been reported concerning E2 effects on progesterone-induced oocyte maturation in Xenopus laevis. Some authors have shown less potentiating effects after E2 pretreatment on in vitro denuded oocyte maturation (Hanocq-Quertier & Baltus 1981, Pickford & Morris 1999), while antagonistic effects have also been reported (Baulieu et al. 1978). Therefore, we finally investigated the effect of E2 on meiotic resumption of either follicle-enclosed or denuded oocytes.

Materials and Methods

Animals and tissue collections

Investigation and animal care were conducted in compliance with French and European regulations on the care and use of laboratory animals. Xenopus laevis ovarian pieces were surgically removed from anesthetized adult females, purchased from NASCO (Fort Atkinson, WI, USA). Stage IV (st IV, ∼800 μm diameter (Dumont 1972)), and stage VI (st VI PI, >1200 μm diameter, in prophase I of meiosis) ovarian follicles were manually isolated from ovarian pieces of each female in modified OR2 buffer (83 mM NaCl, 2.5 mM KCl, 1 mM CaCl2, 1 mM MgCl2, and 5 mM HEPES, pH 7.4). Corresponding oocytes and follicular cells were manually isolated from ovarian pieces or from individual follicles after incubation in calcium-free OR2 buffer supplemented with collagenase (type 1A, Sigma–Aldrich; final concentration=275 IU/ml). Ovarian tissues were frozen in liquid nitrogen and stored at −80 °C until use. For in situ hybridization, ovarian tissues were fixed in Dietrich's fixative (10% formaldehyde 40%, 29% ethanol 95%, and 2% glacial acetic acid) overnight at 4 °C, rinsed in diethylpyrocarbonate (DEPC) water five times for 10 min, and then stored at 4 °C in 50% ethanol until paraffin embedding.

In vitro oocyte maturation

Follicle-enclosed and denuded oocytes were incubated for 15 h at 20 °C in modified OR2 buffer supplemented with 40 IU/ml human chorionic gonadotropin (hCG; Organon, Puteaux, France; LaMarca et al. 1985) or with 0.1–1 μM progesterone (Baulieu et al. 1978). E2 (1 μM final concentration; Steraloids, Newport, RI, USA) was added simultaneously. Approximately 30 pg E2 diluted in PBS with 1 mg/ml BSA and 10% ethanol were injected directly into stage VI PI oocytes. Oocytes injected with equivalent volume of steroid vehicle (∼15 nl PBS containing 10% ethanol and BSA 1 mg/ml) were used as control. After incubation, germinal vesicle breakdown (GVBD), which reflects meiosis resumption, was assessed by direct observation under a stereomicroscope of the appearance of a white spot on the animal pole of the follicle-enclosed or denuded oocytes.

In situ hybridization

In situ hybridization was performed as described previously (Mourot et al. 2006, Vizziano et al. 2007). In brief, ovarian tissue was processed in a citadel 1000 tissue processor (Shandon, Pittsburgh, PA, USA). Dehydrated tissues were embedded in paraffin in plastic molds using a HistoEmbedder (TBS88; Medite, Burgdorf, Germany). In situ hybridization was performed using the In situ Pro, Intavis AG robotic station on 10 μm sections. P450-arom sense and antisense probes were synthesized from Xenopus cDNA clone (BC079750.1) using Riboprobe Combination System (Promega). PCR products were generated using M13 reverse and forward primers (CCCAGTCACGACGTTGTAAAACGA/AGCGGATAACAATTTCACACAGGA) and were incubated (300 ng) for 2 h at 37 °C with sense (SP6) or antisense (T7) primers in transcription buffer as described previously (Gohin et al. 2011). Probe concentration and quality were assessed using nanodrop ND-1000 spectrophotometer (NanoDrop, Wilmington, DE, USA). Hybridization specificity was controlled by comparing signals obtained with the antisense and the sense probes on adjacent sections. Mounted sections were photographed with an ECLIPSE 90i microscope and NIS Advanced Research Software (Nikon Instruments, Amstelveen, The Netherlands).

P450-arom mRNA synthesis and injection

The cDNA corresponding to Xenopus laevis p450-arom open reading frame (ORF; GenBank accession number: NM_001085653) was subcloned into the pCS2+ expression vector (Rupp et al. 1994, Turner & Weintraub 1994). Capped p450-arom RNA was prepared after NotI linearization using mMessage mMachine Kit (Ambion) and purified according to the manufacturer's instructions. In vitro transcribed capped p450-arom RNA was injected into stage VI prophase I denuded oocytes (∼15 nl of a 1 μg/μl solution). Microinjected oocytes were then incubated at room temperature (20 °C) for 12–24 h in modified OR2 buffer before any treatment or freezing.

RNA purification, RT, and real-time quantitative PCR

Total RNA was extracted from Xenopus follicles or denuded oocytes using Tri-Reagent (Molecular Research Center, Cincinnati, OH, USA) according to the manufacturer's instructions. Total RNA was repurified using a Nucleospin RNA II kit (Macherey Nagel, Germany) and 2 μg RNA were reverse transcribed using 200 units Moloney murine leukemia virus reverse transcriptase (Promega) and 1 μg random hexamers (Promega) in a master mix containing 2 mM dNTPs, 50 mM Tris–HCl, 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, pH 8.3, and supplemented with 25 units of RNase inhibitor (RNasin, Promega) as described previously (Bobe et al. 2006). Control reactions were run without enzyme and used as negative controls in the real-time PCR study.

QPCR was carried out using a real-time PCR Step One Plus system (Applied Biosystems, Foster City, CA, USA). RT products were diluted to 1/25. Triplicates were run for each RT product. Real-time PCR was performed using a kit provided with a SYBR Green fluorophore (Fast SYBR Green Master Mix, Applied Biosystems). Primer concentrations were 200 nM for 18S and 600 nM for p450-arom, star, E2 receptor 1 (esr1a and esr1b). A pool of reverse-transcribed RNA was serially diluted and used to calculate a standard curve for each gene. 18S was used as an internal standard to normalize QPCR signal. Amplification cycle and fusion curve protocol followed the same steps as described previously (Gohin et al. 2010). The primers used are presented in Table 1.

Table 1

QPCR primer 5′-sequences-3′ and corresponding GenBank accession number

GeneAccession numberForward primerReverse primer
Cyp19NM_001085653CTTCGGGGAGCAGTTTGTTACCTGTCATGCACAACCATCT
StarAF220437ACGGAGAACTGGTGGACAACCTCTGCTGCTTTCTCGTGTG
Esr1aNM_001089617.1TAGCTGGAACAGTGGACAGCTCCAGTGGTTTTGTTGGGTAG
Esr1bNM_001089615TGGGGTAAACCCCTTATGTGGTCCTCTTCAATTCCGATGC
18SX02995.1CGGAGGTTCGAAGACGATCATTCACGCCCTCTTGAACTCT

Aromatase activity assay

A tritiated water release assay was used to measure aromatase activity using androstenedione as a precursor. One hundred stage IV and 50 stage VI PI follicles, denuded oocytes, and corresponding follicular layers were homogenized in 1.5 ml phosphate buffer (20 mM Na2HPO4, 0.2 M NaCl, 0.15 M KCl, 0.25 M saccharose, 5 mM dithiothreitol, and 1 mM 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride (Sigma–Aldrich), pH 7.55) using an ultra-turrax. Extracts were centrifuged at 12 800 g for 15 min at 4 °C and the assay was performed using the supernatants.

The tritiated water release assay for aromatase activity determination was adapted from previous studies (Gore-Langton & Dorrington 1981, Monod et al. 1993) using 450 μl Xenopus extracts in duplicates adjusted to 500 μl after adding the cofactor NADPH (1 mM, Sigma–Aldrich) and 1β 3H-androstenedione (s.a.=0.87 TBq/mmol, PerkinElmer, Boston, MA, USA; 19 kBq to a final concentration of 50 nM). The reaction was performed at 16 °C under agitation for 20 h and terminated by adding 50 μl 3 M trichloroacetic acid. After adding 450 μl water, samples were centrifuged (3500 g, 15 min, 4 °C). Supernatants (700 μl) were transferred to 5 ml glass tubes containing a charcoal pellet (50 mg/tube). Tubes were shaken for 7 h at 4 °C and then centrifuged (3500 g, 15 min, 4 °C). Duplicates of 400 μl supernatants were mixed with 4 ml liquid scintillation fluid (Pico-Fluor 40, PerkinElmer) for radioactivity counting for 10 min.

Steroid extraction

One hundred stage IV and 50 stage VI PI denuded oocytes were homogenized in 1 ml phosphate buffer. A tracer quantity of tritiated E2 (2,4,6,7 3H-E2 Amersham, GE Healthcare Europe Gmbh, Saclay, France; s.a.=3.26 TBq/mmol; 4000 d.p.m. in 100 μl buffer) was added to estimate steroid recovery. Homogenates were placed in 15 ml glass tubes, supplemented with 5 ml of 100% ethanol, and vortexed. After centrifugation at 3500 g for 15 min at 4 °C, supernatants were collected and placed into 10 ml glass tubes. Ethanol was evaporated at 50 °C under air and the aqueous phases were extracted three times with 5 ml dichloromethane. After evaporation of the organic phase under air, dry residues were stored overnight at −20 °C. E2 was further purified by a solvent partition into aqueous NaOH (Chatterton et al. 2004). Dry residues were dissolved in 1 ml xylene and E2 was extracted twice with 1.5 ml NaOH 1 N. The alkaline solutions were neutralized with 0.8 ml HCl 4 M and E2 was re-extracted twice with 5 ml dichloromethane. The final organic phases were evaporated and extracts were dissolved in 500 μl phosphate RIA buffer (NaH2PO4 10 mM, Na2HPO4 10 mM, and NaCl 150 mM, pH 7.25). One hundred microliters were used for radioactivity counting in 4 ml Picofluor (PerkinElmer) for 10 min per sample to determine extraction yield and 100 μl duplicates were used for E2 RIA.

E2 RIA

E2 was measured by RIA as described previously (Fostier et al. 1982) using an anti-E2 rabbit antibody, 30 000 d.p.m./tube of 2,4,6,7 3H-E2 (s.a.=3.26 TBq/mmol, PerkinElmer) as tracer and 5–3000 pg/tube unlabeled E2 (Steraloids) as a reference.

Statistical analysis

Results are expressed as mean±s.e.m. Statistical analyses were performed using Statistica 7.0 Software (Statsoft, Tulsa, OK, USA). Differences among groups were analyzed using Mann–Whitney U test or χ2 test for non-parametric samples. Differences between groups were considered significant when P<0.05.

Results

Aromatase is expressed in late vitellogenic oocytes and transcript levels dramatically decrease during late oogenesis in follicle-enclosed and denuded oocytes

Aromatase transcript was detected in follicular cells of Xenopus vitellogenic follicles and appeared not homogenously distributed (Fig. 1A and C). Under our experimental conditions, it was difficult to distinguish granulosa from theca cells. Aromatase transcript was also detected in the cytoplasm of previtellogenic stage I (100 μm diameter; Fig. 1E) to vitellogenic stage III and IV oocytes (600 μm diameter; Fig. 1A). Consistently with in situ hybridization results, aromatase was detected by RT-QPCR in Xenopus vitellogenic stage IV (st IV) oocytes (Fig. 2, left panel). During late vitellogenesis, the amount of aromatase transcript represented 25% of the signal in whole follicles. During oocyte maturation, aromatase expression dramatically decreased in both whole follicles and oocytes (Fig. 2, left panel: st VI MII).

Figure 1
Figure 1

Localization of aromatase transcripts in Xenopus laevis ovaries. Xenopus p450-arom antisense (A, C, and E) and sense (B, D, and F) probes were hybridized on adjacent ovarian sections. Xenopus p450-arom transcripts were present in stage III oocytes (st III, >500 μm diameter) and in the corresponding follicular cells (st III foll) but not in the stage V oocytes (st V oo >1000 μm diameter). Gv, germinal vesicle; bv, blood vessel; me, melanosomes; fc, follicular cells.

Citation: Journal of Molecular Endocrinology 47, 2; 10.1530/JME-11-0080

Figure 2
Figure 2

QPCR analysis of aromatase and star mRNA expression in whole Xenopus follicles and oocytes during late oogenesis. The mRNA levels of p450-arom (left panel), star (middle panel), and 18S (right panel) were monitored in whole follicles and denuded oocytes sampled during vitellogenic stage IV (st IV) and matured stage VI (st VI MII). For each sample, three separate RT reactions were carried out using three separate RNA samples originating from three different animals. Analysis of mRNA levels was standardized to levels of 18S rRNA. Mean±s.e.m. are shown (n=3). Different letters indicate significant differences (non-parametric Mann–Whitney U test at P<0.05). #Not significantly different from background levels. For each gene, the mRNA abundance was arbitrarily set to 100 for stage IV follicles.

Citation: Journal of Molecular Endocrinology 47, 2; 10.1530/JME-11-0080

In order to explore a possible contamination of oocyte extracts by follicle cell material, star expression was monitored under the same conditions in whole follicles and oocytes (Fig. 2, middle panel), as star has been described as expressed exclusively by the follicular cells in another non-mammalian vertebrate, the rainbow trout (Kusakabe et al. 2002, Gohin et al. 2011). Although star expression reached a very high level in Xenopus, no oocyte expression was detected significantly above background level (amplification from RT products without reverse transcriptase). As a control, 18S expression appeared stable among tissues (Fig. 2, right panel).

Aromatase is active in oocytes and aromatase activity in follicle-enclosed and denuded oocytes dramatically decreases during late oogenesis

To determine whether the corresponding protein was expressed in oocytes and because none of the custom-made or commercially available antibodies that we tested cross-reacted with Xenopus aromatase, an enzyme activity assay was performed. From vitellogenic stage to postvitellogenic stage VI PI, a 70-fold decrease in aromatase activity occurred in the whole follicles (Fig. 3A). High levels of aromatase activity were also detected in Xenopus isolated follicular layers (follicular cells only). A significant activity was also detected in Xenopus late vitellogenic oocytes. In agreement with RT-QPCR data, Xenopus aromatase activity in the oocyte represented nearly 25% of the activity in the whole follicle. Finally, a low but significant level of aromatase activity (1.14±0.24 vs 0.53±0.12 fmol/20 h in control) was measured in postvitellogenic, stage VI, follicles but no activity was detected in the corresponding denuded oocytes (0.98±0.2 fmol/20 h; Fig. 3A). In order to demonstrate the specificity of the aromatase assay used in this study, we further showed that the activity measured by this assay was significantly increased in extracts of stage VI – prophase I arrested – oocytes previously (12–24 h) injected with 15 ng in vitro synthesized and capped mRNA encoding Xl p450-arom ORF whereas no significant activity was detected in non-injected or water-injected oocytes (Fig. 3B).

Figure 3
Figure 3

Aromatase activity in Xenopus whole follicles and denuded oocytes during late oogenesis. (A) Aromatase activity was measured by tritiated water release assay from whole follicles (foll) and denuded oocytes (oo) sampled at stage IV (st IV) and stage VI prior to meiosis resumption (st VI PI), and follicular layers (f.l.) from stage IV follicles. Activity is expressed as femtomoles of estrone (E1) synthesized over 20 h from three females in duplicates. (B) Aromatase activity in non-injected stage VI oocytes (not inj.), after injection of water (H2O), or after 12–24 h following the injection of 15 ng p450-arom mRNA (12 h p450-arom and 24 h p450-arom). Activity was measured in 50 prophase I stage VI oocytes from three females in duplicates. The controls (ctrl) correspond to phosphate buffer processed under the same conditions. Mean±s.e.m. are shown (n=3). Different letters indicate significant differences (non-parametric Mann–Whitney U test at P<0.05).

Citation: Journal of Molecular Endocrinology 47, 2; 10.1530/JME-11-0080

E2 inhibits follicle-enclosed oocyte gonadotropin-induced maturation but facilitates progesterone-induced maturation of denuded oocytes

In order to further understand E2 function in the oocyte, we measured E2 concentrations in Xenopus oocytes. E2 concentration in denuded oocytes (100 stage IV versus 50 stage VI PI oocytes from one female in duplicates) slightly decreased during late oogenesis from 7 to 5 pg per oocyte. Thus, in stage IV (800 μm diameter and 0.3 μl volume) and stage VI (1250 μm diameter and 1 μl volume) oocytes, E2 concentration may be estimated to be 100 and 20 nM respectively. E2 added simultaneously in culture medium dramatically inhibited Xenopus follicle-enclosed oocyte maturation induced by 40 units/ml hCG: only 8% of follicle-enclosed oocytes resumed meiosis after incubation with hCG supplemented with 1 μM E2 while 65% matured in absence of E2 (Fig. 4A). To address the direct effect of E2 on the oocyte, we then checked its action on denuded oocytes (Fig. 4B and C). Female maturational competence was evaluated by the maturing response to 1 μM progesterone after a 12 h treatment. Females in whom more than 50% of oocytes resumed meiosis were classified as highly responsive to progesterone stimulation, while females in whom <50% of oocytes resumed meiosis were classified as poorly responsive. First, in neither group did 1 μM E2 inhibit resumption of meiosis of denuded oocytes contrarily to the results obtained with whole follicles. In contrast, it rather potentiated oocyte maturation induced by a sub-saturating dose of progesterone (0.1 μM; Fig. 4B and C). At high progesterone concentration (1 μM=saturating dose), E2 also exerted a slight but significant potentiating effect only in poorly responsive females (Fig. 4C). Finally, E2 alone did not stimulate oocyte maturation in any of the two groups (data not shown).

Figure 4
Figure 4

Effect of estradiol-17β (E2) on resumption of meiosis of follicle-enclosed or denuded Xenopus oocytes induced by gonadotropin and progesterone respectively. Follicle-enclosed or denuded oocytes were incubated for 15 h in modified OR2 buffer supplemented with 40 IU/ml of human chorionic gonadotropin (hCG) (A) or with 0.1–1 μM progesterone (Pg; B and C). 1 μM E2 was added simultaneously. Females with more than 50% of maturing oocytes were classified as highly responsive to progesterone stimulation (B), while females with <50% of maturing oocytes were classified as poorly responsive (C). After incubation, germinal vesicle breakdown (GVBD) was assessed by direct observation under a stereomicroscope of the appearance of a white spot on the animal pole. Mean±s.e.m. are shown. Different letters indicate significant differences (non-parametric χ2 test at P<0.05).

Citation: Journal of Molecular Endocrinology 47, 2; 10.1530/JME-11-0080

In order to confirm this slight but reproducible effect of E2 on oocyte maturation, 30 pg E2 (which represent around four times the physiological concentration in stage IV according to the results reported here and in previous studies (Fortune 1983)) were directly injected in 50 stage VI oocytes of three females. Oocytes were then stimulated with progesterone within 30 min following microinjection. No significant effect was detected on the final GVBD rates after 12 h incubation, but a potentiation was reproducibly observed during the time course of progesterone-induced oocyte maturation (Fig. 5) as sometimes evidenced in our E2 balneation experiments, especially with oocytes from low responsive females (data not shown).

Figure 5
Figure 5

Effect of estradiol (E2) microinjection on progesterone-induced resumption of meiosis of Xenopus denuded oocytes. Fifty stage VI prophase I oocytes were microinjected with 30 pg E2 or with vehicle buffer (veh.) and then incubated at room temperature in modified OR2 buffer completed with 1 μM progesterone (Pg+E2 or Pg+veh. respectively), whereas 50 oocytes were only incubated with or without 1 μM progesterone (Pg (n.i.) or cont. respectively). Germinal vesicle breakdown (GVBD) was assessed by direct observation under a stereomicroscope of the appearance of a white spot on the oocyte animal pole. Results are representative of three independent experiments.

Citation: Journal of Molecular Endocrinology 47, 2; 10.1530/JME-11-0080

ESR1a and b are expressed by the Xenopus oocyte

In order to address whether E2 may exert its effect through ligand activation of the major estrogen receptor (ERα; Esr1; two described isoforms in Xenopus: Esr1a and b), we analyzed their mRNA expression by RT-QPCR in follicle-enclosed and denuded oocytes (Fig. 6). Both receptors were expressed in oocytes and their mRNA level, which represented 50% of the signal measured in whole follicles, remained stable at least throughout late oogenesis.

Figure 6
Figure 6

QPCR analysis of estradiol (E2) receptor 1 (esr1a and b) mRNA expression in whole follicles and oocytes during late oogenesis. The mRNA levels of E2 receptor 1 (esr1a and b) were monitored in whole follicles and denuded oocytes sampled during vitellogenic stage IV (st IV) and matured stage VI (st VI MII). For each sample, three separate RT reactions were carried out using three separate RNA samples originating from three different animals. Analysis of mRNA levels was standardized to levels of 18S rRNA. The mRNA abundance was arbitrarily set to 100 for stage IV follicle. Mean±s.e.m. are shown (n=3). No significant difference could be detected (using non-parametric Mann–Whitney U test).

Citation: Journal of Molecular Endocrinology 47, 2; 10.1530/JME-11-0080

Discussion

Our results showed that in addition to the follicular cells, aromatase, the enzyme responsible of E2 synthesis is also expressed and active in Xenopus vitellogenic oocytes. Moreover, vitellogenic and postvitellogenic oocytes do express ERα mRNA, suggesting that estrogens may participate in oocyte late development.

Ovarian follicle E2 synthesis, a three cell-type model

In this study, aromatase expression and activity were detected in the follicular cells of Xenopus follicular cells as evidenced by in situ hybridization. Previous studies have already shown that aromatase is expressed by the follicular cells in the amphibian Rana rugosa during gonad development (Kato et al. 2004). However, our observations also demonstrate that follicular somatic cells are not the unique site of aromatase expression in Xenopus. Aromatase appears indeed expressed and active in vitellogenic oocytes. This observation leads to reconsider the two-cell cooperation model that has been proposed for amphibians (Ahn et al. 1999). Moreover, a significant level of aromatase activity was detected in Xenopus oocyte that corresponds to 25% of whole follicle aromatase activity. This steroidogenic activity is consistent with the mRNA expression that also corresponds to 25% of whole follicle expression. As a follicular control, we observed that star was exclusively expressed by the follicular cells. Star is involved in cholesterol shuttling to the inner mitochondrial membrane and is thus necessary for androgen and estrogen synthesis. As Cyp17 (Yang et al. 2003) and p450-arom are expressed by the oocyte, it suggests that a constant interaction exists between the somatic and the germinal follicular compartments for ovarian steroidogenesis to occur. Therefore, the contribution of the oocyte compartment to the overall follicular aromatase activity appears more important than initially believed. So far, aromatase expression in the oocyte of non-mammalian vertebrates was never clearly reported or discussed, even though a thorough analysis of existing literature revealed a positive protein signal in the oocyte of medaka (Park et al. 2008) and Rana rugosa (Kato et al. 2004), and we recently evidenced such an oocyte expression of cyp19a1a in rainbow trout (Gohin et al. 2011). In order to further investigate whether oocyte contribution to E2 synthesis is specific to a few vitellogenic species or, in contrast, a mechanism shared by evolutionary distant vertebrates, it would be interesting to perform such studies in other non-mammalian species.

The expression in the Xenopus oocyte of both Cyp17 (Yang et al. 2003) – the enzyme able to metabolize progestins into androgens – and p450-arom – the enzyme able to aromatize androgens – is consistent with an autonomous production of E2 by the oocyte. It is also very likely that steroid exchanges exist between oocyte and surrounding somatic follicular compartments, leading to difficulties to access the specific role of E2 synthesized by one compartment in comparison to the other. Moreover, it is also possible that oocytes modulate E2 production by the follicular somatic cells and reciprocally, as previously reported (Sretarugsa & Wallace 1997). The regulation of aromatase expression and activity in the germinal compartment of the ovarian follicle during final oocyte maturation would be in favor of an active participation of E2 from oocyte origin in the intra-follicular dialog. Therefore, our findings and a previous report (Yang et al. 2003) clearly indicate that a third participant – the oocyte – has to be added to the two cell-type model of E2 synthesis in Xenopus. Nevertheless, determining the physiological role of E2 synthesized by the oocyte in comparison to the role of E2 of somatic origin is difficult to perform for technical reasons as local inhibition of oocyte aromatase within each compartment of the whole follicle cannot be performed by microinjection or use of aromatase inhibitors.

Modulation of Xenopus oocyte maturation by E2

Oocyte aromatase expression and activity decreased during late oogenesis concomitantly with a decrease in aromatase expression and activity in the whole follicle (Mulner et al. 1978, Fortune 1983, Gohin et al. 2010). Moreover, Xenopus intra-oocyte E2 concentrations are in the range of E2 content previously measured in the whole follicles (Fortune 1983) and in plasma varying from 1 to 28 ng/ml corresponding to a maximum of 100 nM (Pickford & Morris 1999, Hecker et al. 2004, Urbatzka et al. 2007). Moreover, E2 appeared to be maternally inherited as E2 is still detected in Xenopus unfertilized eggs (Kloas 2002). The physiological function of oocyte E2 remains unclear, particularly during oocyte maturation. As reported in Rana pipiens (Schuetz 1972, Spiegel et al. 1978, Lin & Schuetz 1983, 1985), E2 appeared to inhibit Xenopus follicle-enclosed oocyte maturation likely through an inhibition of gonadotropin/cAMP-induced progestin synthesis by follicular layers (Lin et al. 1988). However, a direct inhibitory effect of E2 on the oocyte could not be ruled out, as demonstrated in previous studies in Xenopus (Baulieu et al. 1978) and in Rana pipiens (Lin & Schuetz 1983). Moreover, several studies reported a slight significant effect of high E2 dose pretreatment on Xenopus denuded oocyte maturation (Hanocq-Quertier & Baltus 1981, Pickford & Morris 1999). In our study, E2, added simultaneously and at nearly a tenfold oocyte physiological concentration, did not inhibit steroid-triggered maturation in denuded oocytes, suggesting that E2 inhibitory effects are occurring in follicular cells. We even surprisingly observed that E2 exerted a slight enhancing action on progesterone-induced meiotic resumption, especially when used in combination with a sub-saturating dose of the MIS. The potentiating effect of E2 evidenced previously and in this study may be due to E2 antioxidant effect.

The effect previously observed after E2 pretreatment may also suggest that its potentiating effect results from a classical genomic mechanism of gene expression activation by ligand-dependent activation of the classical – intracellular – Esr1 and/or Esr2. This is strengthened by the fact that esr1 (a and b) mRNAs are also detected in Xenopus oocytes and their content remains stable throughout late vitellogenesis and maturation. Nevertheless, E2 may also act through a non-genomic mechanism after activation by ERs of signaling pathways (via c-Src or MAPK pathways) that would subsequently interact with the maturation-promoting factor induction. Indeed, it has been shown in other cell types that ERα (Esr1) directly interacts with and activates Src (Fox et al. 2009), the latter being able to accelerate progesterone-induced oocyte maturation (Tokmakov et al. 2005). Moreover, MAPK activation has been shown to participate in maturation promoting factor (MPF) activation and thus to stimulate Xenopus oocyte maturation (Palmer & Nebreda 2000). Finally, a modulator of non-genomic action of the ER, MNAR, is also expressed in Xenopus oocytes (Haas et al. 2005). All these results suggest that E2 genomic and non-genomic effects likely play important and unsuspected roles at the oocyte level during late oogenesis that will need to be further characterized.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was funded by ANR-08-GENM-033 (OSCILE) grant to J B and F C, M G was supported by a doctoral fellowship from CNRS & Region Bretagne.

Acknowledgements

The authors thank CNRS personnel (Rennes) for animal care and Stephane Dreano for his technical support in cDNA sequencing.

References

  • AhnRSYooMSKwonHB1999Evidence for two-cell model of steroidogenesis in four species of amphibian. Journal of Experimental Zoology2849199. doi:10.1002/(SICI)1097-010X(19990615)284:1<91::AID-JEZ12>3.0.CO;2-F.

    • Search Google Scholar
    • Export Citation
  • BaulieuEEGodeauFSchorderetMSchorderetslatkineS1978Steroid-induced meiotic division in Xenopus laevis oocytes – surface and calcium. Nature275593598. doi:10.1038/275593a0.

    • Search Google Scholar
    • Export Citation
  • BobeJMontfortJNguyenTFostierA2006Identification of new participants in the rainbow trout (Oncorhynchus mykiss) oocyte maturation and ovulation processes using cDNA microarrays. Reproductive Biology and Endocrinology439doi:10.1186/1477-7827-4-39.

    • Search Google Scholar
    • Export Citation
  • ChattertonRTJrGeigerASKhanSAHelenowskiIBJovanovicBDGannPH2004Variation in estradiol, estradiol precursors, and estrogen-related products in nipple aspirate fluid from normal premenopausal women. Cancer Epidemiology Biomarkers and Prevention13928935.

    • Search Google Scholar
    • Export Citation
  • DumontJN1972Oogenesis in Xenopus laevis (Daudin). I. Stages of oocyte development in laboratory maintained animals. Journal of Morphology136153179. doi:10.1002/jmor.1051360203.

    • Search Google Scholar
    • Export Citation
  • FortuneJE1983Steroid production by Xenopus ovarian follicles at different developmental stages. Developmental Biology99502509. doi:10.1016/0012-1606(83)90299-3.

    • Search Google Scholar
    • Export Citation
  • FostierABillardRBretonBLegendreMMarlotS1982Plasma 11-oxotestosterone and gonadotropin during the beginning of spermiation in rainbow trout (Salmo gairdneri R.). General and Comparative Endocrinology46428434. doi:10.1016/0016-6480(82)90096-X.

    • Search Google Scholar
    • Export Citation
  • FouchetCSerresCBelleROzonR1975Mechanism of action of progesterone on amphibian oocytes. Uptake and metabolism of progesterone by isolated oocytes of Pleurodeles waltlii and Xenopus laevis. Comparative Biochemistry and Physiology. B Comparative Biochemistry52205210. doi:10.1016/0305-0491(75)90053-X.

    • Search Google Scholar
    • Export Citation
  • FoxEMAndradeJShupnikMA2009Novel actions of estrogen to promote proliferation: integration of cytoplasmic and nuclear pathways. Steroids74622627. doi:10.1016/j.steroids.2008.10.014.

    • Search Google Scholar
    • Export Citation
  • GohinMBobeJChesnelF2010Comparative transcriptomic analysis of follicle-enclosed oocyte maturational and developmental competence acquisition in two non-mammalian vertebrates. BMC Genomics1118doi:10.1186/1471-2164-11-18.

    • Search Google Scholar
    • Export Citation
  • GohinMBodinierPFostierAChesnelFBobeJ2011Aromatase is expressed and active in the rainbow trout oocyte during final oocyte maturation. Molecular Reproduction and Development78510518. doi:10.1002/mrd.21335.

    • Search Google Scholar
    • Export Citation
  • Gore-LangtonREDorringtonJH1981FSH induction of aromatase in cultured rat granulosa cells measured by a radiometric assay. Molecular and Cellular Endocrinology22135151. doi:10.1016/0303-7207(81)90087-3.

    • Search Google Scholar
    • Export Citation
  • Gore-LangtonRAmstrongDT1988Follicular steroidogenesis and its control. In The Physiology of Reproduction pp 331385. KnobilENeillJD. New York: Raven Press.

    • Search Google Scholar
    • Export Citation
  • HaasDWhiteSNLutzLBRasarMHammesSR2005The modulator of nongenomic actions of the estrogen receptor (MNAR) regulates transcription-independent androgen receptor-mediated signaling: evidence that MNAR participates in G protein-regulated meiosis in Xenopus laevis oocytes. Molecular Endocrinology1920352046. doi:10.1210/me.2004-0531.

    • Search Google Scholar
    • Export Citation
  • Hanocq-QuertierJBaltusE1981Induction of meiosis of Xenopus laevis oocytes by mianserine. Gamete Research44956. doi:10.1002/mrd.1120040108.

    • Search Google Scholar
    • Export Citation
  • HeckerMGiesyJPJonesPDJoosteAMCarrJASolomonKRSmithEEVan der KraakGKendallRJDu PreezL2004Plasma sex steroid concentrations and gonadal aromatase activities in African clawed frogs (Xenopus laevis) from South Africa. Environmental Toxicology and Chemistry2319962007. doi:10.1897/03-450.

    • Search Google Scholar
    • Export Citation
  • IwabuchiJWakoSTanakaTIshikawaAYoshidaYMiyataS2007Analysis of the p450 aromatase gene expression in the Xenopus brain and gonad. Journal of Steroid Biochemistry and Molecular Biology107149155. doi:10.1016/j.jsbmb.2007.01.007.

    • Search Google Scholar
    • Export Citation
  • JalabertBFostierAMarcuzziOHeydorffM1984The modulatory effect of oestradiol-17β, testosterone or cortisol on the output of 17α-hydroxy-20β-dihydroprogesterone by rainbow trout (Salmo gairdneri) ovarian follicles stimulated by the maturational gonadotropin s-GtH. Reproduction Nutrition Development24127136. doi:10.1051/rnd:19840204.

    • Search Google Scholar
    • Export Citation
  • KamangarBBGabillardJ-CBobeJ2006Insulin-like growth factor-binding protein (IGFBP)-1, -2, -3, -4, -5, and -6 and IGFBP-related protein 1 during rainbow trout postvitellogenesis and oocyte maturation: molecular characterization, expression profiles, and hormonal regulation. Endocrinology14723992410. doi:10.1210/en.2005-1570.

    • Search Google Scholar
    • Export Citation
  • KatoTMatsuiKTakaseMKobayashiMNakamuraM2004Expression of P450 aromatase protein in developing and in sex-reversed gonads of the XX/XY type of the frog Rana rugosa. General and Comparative Endocrinology137227236. doi:10.1016/j.ygcen.2004.03.013.

    • Search Google Scholar
    • Export Citation
  • KloasW2002Amphibians as a model for the study of endocrine disruptors. International Review of Cytology216157. doi:10.1016/S0074-7696(02)16002-5.

    • Search Google Scholar
    • Export Citation
  • KusakabeMTodoTMcQuillanHJGoetzFWYoungG2002Characterization and expression of steroidogenic acute regulatory protein and MLN64 cDNAs in trout. Endocrinology14320622070. doi:10.1210/en.143.6.2062.

    • Search Google Scholar
    • Export Citation
  • KwonHBAhnRS1994Relative roles of theca and granulosa cells in ovarian follicular steroidogenesis in the amphibian, Rana nigromaculata. General and Comparative Endocrinology94207214. doi:10.1006/gcen.1994.1077.

    • Search Google Scholar
    • Export Citation
  • LaMarcaMJWestphalLMReinDA1985Gonadotropins and the timing of progesterone-induced meiotic maturation of Xenopus laevis oocytes. Developmental Biology1093240. doi:10.1016/0012-1606(85)90343-4.

    • Search Google Scholar
    • Export Citation
  • LinYWSchuetzAW1983In vitro estrogen modulation of pituitary and progesterone-induced oocyte maturation in Rana pipiens. Journal of Experimental Zoology226281291. doi:10.1002/jez.1402260214.

    • Search Google Scholar
    • Export Citation
  • LinYWSchuetzAW1985Intrafollicular action of estrogen in regulating pituitary-induced ovarian progesterone synthesis and oocyte maturation in Rana pipiens: temporal relationship and locus of action. General and Comparative Endocrinology58421435. doi:10.1016/0016-6480(85)90115-7.

    • Search Google Scholar
    • Export Citation
  • LinYWKwonHBPetrinoTRSchuetzAW1988Studies on the mechanism of action of estradiol in regulating follicular progesterone levels: effects on cAMP mediated events and 3ßhydroxysteroid dehydrogenase. Development Growth and Differentiation30611618. doi:10.1111/j.1440-169X.1988.00611.x.

    • Search Google Scholar
    • Export Citation
  • MonodGDemonesAFostierA1993Inhibition of ovarian microsomal aromatase and follicular estradiol secretion by imidazole fungicides in rainbow-trout. Marine Environmental Research35153157. doi:10.1016/0141-1136(93)90030-4.

    • Search Google Scholar
    • Export Citation
  • MourotBNguyenTFostierABobeJ2006Two unrelated putative membrane-bound progestin receptors, progesterone membrane receptor component 1 (PGMRC1) and membrane progestin receptor (mPR) beta, are expressed in the rainbow trout oocyte and exhibit similar ovarian expression patterns. Reproductive Biology and Endocrinology46doi:10.1186/1477-7827-4-6.

    • Search Google Scholar
    • Export Citation
  • MulnerOThibierCOzonR1978Steroid biosynthesis by ovarian follicles of Xenopus laevis in vitro during oogenesis. General and Comparative Endocrinology34287295. doi:10.1016/0016-6480(78)90250-2.

    • Search Google Scholar
    • Export Citation
  • NagahamaYYoshikuniMYamashitaMTokumotoTKatsuY1995Regulation of oocyte growth and maturation in fish. Current Topics in Developmental Biology30103145. doi:10.1016/S0070-2153(08)60565-7.

    • Search Google Scholar
    • Export Citation
  • OgawaADakeJIwashinaYKTokumotoT2011Induction of ovulation in Xenopus without hCG injection: the effect of adding steroids into the aquatic environment. Reproductive Biology and Endocrinology911doi:10.1186/1477-7827-9-11.

    • Search Google Scholar
    • Export Citation
  • PalmerANebredaAR2000The activation of MAP kinase and p34cdc2/cyclin B during the meiotic maturation of Xenopus oocytes. Progress in Cell Cycle Research4131143.

    • Search Google Scholar
    • Export Citation
  • ParkJWTompsettAZhangXNewstedJLJonesPDAuDKongRWuRSGiesyJPHeckerM2008Fluorescence in situ hybridization techniques (FISH) to detect changes in CYP19a gene expression of Japanese medaka (Oryzias latipes). Toxicology and Applied Pharmacology232226235. doi:10.1016/j.taap.2008.06.012.

    • Search Google Scholar
    • Export Citation
  • PickfordDBMorrisID1999Effects of endocrine-disrupting contaminants on amphibian oogenesis: methoxychlor inhibits progesterone-induced maturation of Xenopus laevis oocytes in vitro. Environmental Health Perspectives107285292. doi:10.1289/ehp.99107285.

    • Search Google Scholar
    • Export Citation
  • RasarMAHammesSR2006The physiology of the Xenopus laevis ovary. Methods in Molecular Biology3221730. doi:10.1007/978-1-59745-000-3_2.

  • ReynhoutJKSmithLD1973Evidence for steroid metabolism during the in vitro induction of maturation in oocytes of Rana pipiens. Developmental Biology30392402. doi:10.1016/0012-1606(73)90096-1.

    • Search Google Scholar
    • Export Citation
  • RuppRASniderLWeintraubH1994Xenopus embryos regulate the nuclear localization of XMyoD. Genes and Development813111323. doi:10.1101/gad.8.11.1311.

    • Search Google Scholar
    • Export Citation
  • SanyalMKSibreERGreepRO1973Breakdown of germinal vesicle of frog oocytes with 5 alpha-reduced products of progesterone in vitro. Proceedings of the Society for Experimental Biology and Medicine144483486.

    • Search Google Scholar
    • Export Citation
  • SchuetzAW1972Estrogens and ovarian follicular functions in Rana pipiens. General and Comparative Endocrinology183236. doi:10.1016/0016-6480(72)90076-7.

    • Search Google Scholar
    • Export Citation
  • SpiegelJJonesESnyderBW1978Estradiol-17 beta interference with meiotic maturation in Rana pipiens ovarian follicles: evidence for inhibition of 3 beta-hydroxysteroid dehydrogenase. Journal of Experimental Zoology204187191. doi:10.1002/jez.1402040207.

    • Search Google Scholar
    • Export Citation
  • SretarugsaPWallaceRA1997The developing Xenopus oocyte specifies the type of gonadotropin-stimulated steroidogenesis performed by its associated follicle cells. Development Growth and Differentiation398797. doi:10.1046/j.1440-169X.1997.00009.x.

    • Search Google Scholar
    • Export Citation
  • Thibier-FouchetCMulnerOOzonR1976Progesterone biosynthesis and metabolism by ovarian follicles and isolated oocytes Xenopus laevis. Biology of Reproduction14317326. doi:10.1095/biolreprod14.3.317.

    • Search Google Scholar
    • Export Citation
  • TokmakovAIwasakiTItakuraSSatoKShirouzuMFukamiYYokoyamaS2005Regulation of Src kinase activity during Xenopus oocyte maturation. Developmental Biology278289300. doi:10.1016/j.ydbio.2004.10.018.

    • Search Google Scholar
    • Export Citation
  • TurnerDLWeintraubH1994Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal cells to a neural fate. Genes and Development814341447. doi:10.1101/gad.8.12.1434.

    • Search Google Scholar
    • Export Citation
  • UrbatzkaRBotteroSMandichALutzIKloasW2007Endocrine disrupters with (anti)estrogenic and (anti)androgenic modes of action affecting reproductive biology of Xenopus laevis: I. Effects on sex steroid levels and biomarker expression. Comparative Biochemistry and Physiology. Toxicology and Pharmacology144310318. doi:10.1016/j.cbpc.2006.10.008.

    • Search Google Scholar
    • Export Citation
  • VizzianoDRanduineauGBaronDCautyCGuiguenY2007Characterization of early molecular sex differentiation in rainbow trout, Oncorhynchus mykiss. Developmental Dynamics23621982206. doi:10.1002/dvdy.21212.

    • Search Google Scholar
    • Export Citation
  • YangWHLutzLBHammesSR2003Xenopus laevis ovarian CYP17 is a highly potent enzyme expressed exclusively in oocytes. Evidence that oocytes play a critical role in Xenopus ovarian androgen production. Journal of Biological Chemistry27895529559. doi:10.1074/jbc.M212027200.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 459 134 5
PDF Downloads 115 62 5
  • View in gallery

    Localization of aromatase transcripts in Xenopus laevis ovaries. Xenopus p450-arom antisense (A, C, and E) and sense (B, D, and F) probes were hybridized on adjacent ovarian sections. Xenopus p450-arom transcripts were present in stage III oocytes (st III, >500 μm diameter) and in the corresponding follicular cells (st III foll) but not in the stage V oocytes (st V oo >1000 μm diameter). Gv, germinal vesicle; bv, blood vessel; me, melanosomes; fc, follicular cells.

  • View in gallery

    QPCR analysis of aromatase and star mRNA expression in whole Xenopus follicles and oocytes during late oogenesis. The mRNA levels of p450-arom (left panel), star (middle panel), and 18S (right panel) were monitored in whole follicles and denuded oocytes sampled during vitellogenic stage IV (st IV) and matured stage VI (st VI MII). For each sample, three separate RT reactions were carried out using three separate RNA samples originating from three different animals. Analysis of mRNA levels was standardized to levels of 18S rRNA. Mean±s.e.m. are shown (n=3). Different letters indicate significant differences (non-parametric Mann–Whitney U test at P<0.05). #Not significantly different from background levels. For each gene, the mRNA abundance was arbitrarily set to 100 for stage IV follicles.

  • View in gallery

    Aromatase activity in Xenopus whole follicles and denuded oocytes during late oogenesis. (A) Aromatase activity was measured by tritiated water release assay from whole follicles (foll) and denuded oocytes (oo) sampled at stage IV (st IV) and stage VI prior to meiosis resumption (st VI PI), and follicular layers (f.l.) from stage IV follicles. Activity is expressed as femtomoles of estrone (E1) synthesized over 20 h from three females in duplicates. (B) Aromatase activity in non-injected stage VI oocytes (not inj.), after injection of water (H2O), or after 12–24 h following the injection of 15 ng p450-arom mRNA (12 h p450-arom and 24 h p450-arom). Activity was measured in 50 prophase I stage VI oocytes from three females in duplicates. The controls (ctrl) correspond to phosphate buffer processed under the same conditions. Mean±s.e.m. are shown (n=3). Different letters indicate significant differences (non-parametric Mann–Whitney U test at P<0.05).

  • View in gallery

    Effect of estradiol-17β (E2) on resumption of meiosis of follicle-enclosed or denuded Xenopus oocytes induced by gonadotropin and progesterone respectively. Follicle-enclosed or denuded oocytes were incubated for 15 h in modified OR2 buffer supplemented with 40 IU/ml of human chorionic gonadotropin (hCG) (A) or with 0.1–1 μM progesterone (Pg; B and C). 1 μM E2 was added simultaneously. Females with more than 50% of maturing oocytes were classified as highly responsive to progesterone stimulation (B), while females with <50% of maturing oocytes were classified as poorly responsive (C). After incubation, germinal vesicle breakdown (GVBD) was assessed by direct observation under a stereomicroscope of the appearance of a white spot on the animal pole. Mean±s.e.m. are shown. Different letters indicate significant differences (non-parametric χ2 test at P<0.05).

  • View in gallery

    Effect of estradiol (E2) microinjection on progesterone-induced resumption of meiosis of Xenopus denuded oocytes. Fifty stage VI prophase I oocytes were microinjected with 30 pg E2 or with vehicle buffer (veh.) and then incubated at room temperature in modified OR2 buffer completed with 1 μM progesterone (Pg+E2 or Pg+veh. respectively), whereas 50 oocytes were only incubated with or without 1 μM progesterone (Pg (n.i.) or cont. respectively). Germinal vesicle breakdown (GVBD) was assessed by direct observation under a stereomicroscope of the appearance of a white spot on the oocyte animal pole. Results are representative of three independent experiments.

  • View in gallery

    QPCR analysis of estradiol (E2) receptor 1 (esr1a and b) mRNA expression in whole follicles and oocytes during late oogenesis. The mRNA levels of E2 receptor 1 (esr1a and b) were monitored in whole follicles and denuded oocytes sampled during vitellogenic stage IV (st IV) and matured stage VI (st VI MII). For each sample, three separate RT reactions were carried out using three separate RNA samples originating from three different animals. Analysis of mRNA levels was standardized to levels of 18S rRNA. The mRNA abundance was arbitrarily set to 100 for stage IV follicle. Mean±s.e.m. are shown (n=3). No significant difference could be detected (using non-parametric Mann–Whitney U test).

  • AhnRSYooMSKwonHB1999Evidence for two-cell model of steroidogenesis in four species of amphibian. Journal of Experimental Zoology2849199. doi:10.1002/(SICI)1097-010X(19990615)284:1<91::AID-JEZ12>3.0.CO;2-F.

    • Search Google Scholar
    • Export Citation
  • BaulieuEEGodeauFSchorderetMSchorderetslatkineS1978Steroid-induced meiotic division in Xenopus laevis oocytes – surface and calcium. Nature275593598. doi:10.1038/275593a0.

    • Search Google Scholar
    • Export Citation
  • BobeJMontfortJNguyenTFostierA2006Identification of new participants in the rainbow trout (Oncorhynchus mykiss) oocyte maturation and ovulation processes using cDNA microarrays. Reproductive Biology and Endocrinology439doi:10.1186/1477-7827-4-39.

    • Search Google Scholar
    • Export Citation
  • ChattertonRTJrGeigerASKhanSAHelenowskiIBJovanovicBDGannPH2004Variation in estradiol, estradiol precursors, and estrogen-related products in nipple aspirate fluid from normal premenopausal women. Cancer Epidemiology Biomarkers and Prevention13928935.

    • Search Google Scholar
    • Export Citation
  • DumontJN1972Oogenesis in Xenopus laevis (Daudin). I. Stages of oocyte development in laboratory maintained animals. Journal of Morphology136153179. doi:10.1002/jmor.1051360203.

    • Search Google Scholar
    • Export Citation
  • FortuneJE1983Steroid production by Xenopus ovarian follicles at different developmental stages. Developmental Biology99502509. doi:10.1016/0012-1606(83)90299-3.

    • Search Google Scholar
    • Export Citation
  • FostierABillardRBretonBLegendreMMarlotS1982Plasma 11-oxotestosterone and gonadotropin during the beginning of spermiation in rainbow trout (Salmo gairdneri R.). General and Comparative Endocrinology46428434. doi:10.1016/0016-6480(82)90096-X.

    • Search Google Scholar
    • Export Citation
  • FouchetCSerresCBelleROzonR1975Mechanism of action of progesterone on amphibian oocytes. Uptake and metabolism of progesterone by isolated oocytes of Pleurodeles waltlii and Xenopus laevis. Comparative Biochemistry and Physiology. B Comparative Biochemistry52205210. doi:10.1016/0305-0491(75)90053-X.

    • Search Google Scholar
    • Export Citation
  • FoxEMAndradeJShupnikMA2009Novel actions of estrogen to promote proliferation: integration of cytoplasmic and nuclear pathways. Steroids74622627. doi:10.1016/j.steroids.2008.10.014.

    • Search Google Scholar
    • Export Citation
  • GohinMBobeJChesnelF2010Comparative transcriptomic analysis of follicle-enclosed oocyte maturational and developmental competence acquisition in two non-mammalian vertebrates. BMC Genomics1118doi:10.1186/1471-2164-11-18.

    • Search Google Scholar
    • Export Citation
  • GohinMBodinierPFostierAChesnelFBobeJ2011Aromatase is expressed and active in the rainbow trout oocyte during final oocyte maturation. Molecular Reproduction and Development78510518. doi:10.1002/mrd.21335.

    • Search Google Scholar
    • Export Citation
  • Gore-LangtonREDorringtonJH1981FSH induction of aromatase in cultured rat granulosa cells measured by a radiometric assay. Molecular and Cellular Endocrinology22135151. doi:10.1016/0303-7207(81)90087-3.

    • Search Google Scholar
    • Export Citation
  • Gore-LangtonRAmstrongDT1988Follicular steroidogenesis and its control. In The Physiology of Reproduction pp 331385. KnobilENeillJD. New York: Raven Press.

    • Search Google Scholar
    • Export Citation
  • HaasDWhiteSNLutzLBRasarMHammesSR2005The modulator of nongenomic actions of the estrogen receptor (MNAR) regulates transcription-independent androgen receptor-mediated signaling: evidence that MNAR participates in G protein-regulated meiosis in Xenopus laevis oocytes. Molecular Endocrinology1920352046. doi:10.1210/me.2004-0531.

    • Search Google Scholar
    • Export Citation
  • Hanocq-QuertierJBaltusE1981Induction of meiosis of Xenopus laevis oocytes by mianserine. Gamete Research44956. doi:10.1002/mrd.1120040108.

    • Search Google Scholar
    • Export Citation
  • HeckerMGiesyJPJonesPDJoosteAMCarrJASolomonKRSmithEEVan der KraakGKendallRJDu PreezL2004Plasma sex steroid concentrations and gonadal aromatase activities in African clawed frogs (Xenopus laevis) from South Africa. Environmental Toxicology and Chemistry2319962007. doi:10.1897/03-450.

    • Search Google Scholar
    • Export Citation
  • IwabuchiJWakoSTanakaTIshikawaAYoshidaYMiyataS2007Analysis of the p450 aromatase gene expression in the Xenopus brain and gonad. Journal of Steroid Biochemistry and Molecular Biology107149155. doi:10.1016/j.jsbmb.2007.01.007.

    • Search Google Scholar
    • Export Citation
  • JalabertBFostierAMarcuzziOHeydorffM1984The modulatory effect of oestradiol-17β, testosterone or cortisol on the output of 17α-hydroxy-20β-dihydroprogesterone by rainbow trout (Salmo gairdneri) ovarian follicles stimulated by the maturational gonadotropin s-GtH. Reproduction Nutrition Development24127136. doi:10.1051/rnd:19840204.

    • Search Google Scholar
    • Export Citation
  • KamangarBBGabillardJ-CBobeJ2006Insulin-like growth factor-binding protein (IGFBP)-1, -2, -3, -4, -5, and -6 and IGFBP-related protein 1 during rainbow trout postvitellogenesis and oocyte maturation: molecular characterization, expression profiles, and hormonal regulation. Endocrinology14723992410. doi:10.1210/en.2005-1570.

    • Search Google Scholar
    • Export Citation
  • KatoTMatsuiKTakaseMKobayashiMNakamuraM2004Expression of P450 aromatase protein in developing and in sex-reversed gonads of the XX/XY type of the frog Rana rugosa. General and Comparative Endocrinology137227236. doi:10.1016/j.ygcen.2004.03.013.

    • Search Google Scholar
    • Export Citation
  • KloasW2002Amphibians as a model for the study of endocrine disruptors. International Review of Cytology216157. doi:10.1016/S0074-7696(02)16002-5.

    • Search Google Scholar
    • Export Citation
  • KusakabeMTodoTMcQuillanHJGoetzFWYoungG2002Characterization and expression of steroidogenic acute regulatory protein and MLN64 cDNAs in trout. Endocrinology14320622070. doi:10.1210/en.143.6.2062.

    • Search Google Scholar
    • Export Citation
  • KwonHBAhnRS1994Relative roles of theca and granulosa cells in ovarian follicular steroidogenesis in the amphibian, Rana nigromaculata. General and Comparative Endocrinology94207214. doi:10.1006/gcen.1994.1077.

    • Search Google Scholar
    • Export Citation
  • LaMarcaMJWestphalLMReinDA1985Gonadotropins and the timing of progesterone-induced meiotic maturation of Xenopus laevis oocytes. Developmental Biology1093240. doi:10.1016/0012-1606(85)90343-4.

    • Search Google Scholar
    • Export Citation
  • LinYWSchuetzAW1983In vitro estrogen modulation of pituitary and progesterone-induced oocyte maturation in Rana pipiens. Journal of Experimental Zoology226281291. doi:10.1002/jez.1402260214.

    • Search Google Scholar
    • Export Citation
  • LinYWSchuetzAW1985Intrafollicular action of estrogen in regulating pituitary-induced ovarian progesterone synthesis and oocyte maturation in Rana pipiens: temporal relationship and locus of action. General and Comparative Endocrinology58421435. doi:10.1016/0016-6480(85)90115-7.

    • Search Google Scholar
    • Export Citation
  • LinYWKwonHBPetrinoTRSchuetzAW1988Studies on the mechanism of action of estradiol in regulating follicular progesterone levels: effects on cAMP mediated events and 3ßhydroxysteroid dehydrogenase. Development Growth and Differentiation30611618. doi:10.1111/j.1440-169X.1988.00611.x.

    • Search Google Scholar
    • Export Citation
  • MonodGDemonesAFostierA1993Inhibition of ovarian microsomal aromatase and follicular estradiol secretion by imidazole fungicides in rainbow-trout. Marine Environmental Research35153157. doi:10.1016/0141-1136(93)90030-4.

    • Search Google Scholar
    • Export Citation
  • MourotBNguyenTFostierABobeJ2006Two unrelated putative membrane-bound progestin receptors, progesterone membrane receptor component 1 (PGMRC1) and membrane progestin receptor (mPR) beta, are expressed in the rainbow trout oocyte and exhibit similar ovarian expression patterns. Reproductive Biology and Endocrinology46doi:10.1186/1477-7827-4-6.

    • Search Google Scholar
    • Export Citation
  • MulnerOThibierCOzonR1978Steroid biosynthesis by ovarian follicles of Xenopus laevis in vitro during oogenesis. General and Comparative Endocrinology34287295. doi:10.1016/0016-6480(78)90250-2.

    • Search Google Scholar
    • Export Citation
  • NagahamaYYoshikuniMYamashitaMTokumotoTKatsuY1995Regulation of oocyte growth and maturation in fish. Current Topics in Developmental Biology30103145. doi:10.1016/S0070-2153(08)60565-7.

    • Search Google Scholar
    • Export Citation
  • OgawaADakeJIwashinaYKTokumotoT2011Induction of ovulation in Xenopus without hCG injection: the effect of adding steroids into the aquatic environment. Reproductive Biology and Endocrinology911doi:10.1186/1477-7827-9-11.

    • Search Google Scholar
    • Export Citation
  • PalmerANebredaAR2000The activation of MAP kinase and p34cdc2/cyclin B during the meiotic maturation of Xenopus oocytes. Progress in Cell Cycle Research4131143.

    • Search Google Scholar
    • Export Citation
  • ParkJWTompsettAZhangXNewstedJLJonesPDAuDKongRWuRSGiesyJPHeckerM2008Fluorescence in situ hybridization techniques (FISH) to detect changes in CYP19a gene expression of Japanese medaka (Oryzias latipes). Toxicology and Applied Pharmacology232226235. doi:10.1016/j.taap.2008.06.012.

    • Search Google Scholar
    • Export Citation
  • PickfordDBMorrisID1999Effects of endocrine-disrupting contaminants on amphibian oogenesis: methoxychlor inhibits progesterone-induced maturation of Xenopus laevis oocytes in vitro. Environmental Health Perspectives107285292. doi:10.1289/ehp.99107285.

    • Search Google Scholar
    • Export Citation
  • RasarMAHammesSR2006The physiology of the Xenopus laevis ovary. Methods in Molecular Biology3221730. doi:10.1007/978-1-59745-000-3_2.

  • ReynhoutJKSmithLD1973Evidence for steroid metabolism during the in vitro induction of maturation in oocytes of Rana pipiens. Developmental Biology30392402. doi:10.1016/0012-1606(73)90096-1.

    • Search Google Scholar
    • Export Citation
  • RuppRASniderLWeintraubH1994Xenopus embryos regulate the nuclear localization of XMyoD. Genes and Development813111323. doi:10.1101/gad.8.11.1311.

    • Search Google Scholar
    • Export Citation
  • SanyalMKSibreERGreepRO1973Breakdown of germinal vesicle of frog oocytes with 5 alpha-reduced products of progesterone in vitro. Proceedings of the Society for Experimental Biology and Medicine144483486.

    • Search Google Scholar
    • Export Citation
  • SchuetzAW1972Estrogens and ovarian follicular functions in Rana pipiens. General and Comparative Endocrinology183236. doi:10.1016/0016-6480(72)90076-7.

    • Search Google Scholar
    • Export Citation
  • SpiegelJJonesESnyderBW1978Estradiol-17 beta interference with meiotic maturation in Rana pipiens ovarian follicles: evidence for inhibition of 3 beta-hydroxysteroid dehydrogenase. Journal of Experimental Zoology204187191. doi:10.1002/jez.1402040207.

    • Search Google Scholar
    • Export Citation
  • SretarugsaPWallaceRA1997The developing Xenopus oocyte specifies the type of gonadotropin-stimulated steroidogenesis performed by its associated follicle cells. Development Growth and Differentiation398797. doi:10.1046/j.1440-169X.1997.00009.x.

    • Search Google Scholar
    • Export Citation
  • Thibier-FouchetCMulnerOOzonR1976Progesterone biosynthesis and metabolism by ovarian follicles and isolated oocytes Xenopus laevis. Biology of Reproduction14317326. doi:10.1095/biolreprod14.3.317.

    • Search Google Scholar
    • Export Citation
  • TokmakovAIwasakiTItakuraSSatoKShirouzuMFukamiYYokoyamaS2005Regulation of Src kinase activity during Xenopus oocyte maturation. Developmental Biology278289300. doi:10.1016/j.ydbio.2004.10.018.

    • Search Google Scholar
    • Export Citation
  • TurnerDLWeintraubH1994Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal cells to a neural fate. Genes and Development814341447. doi:10.1101/gad.8.12.1434.

    • Search Google Scholar
    • Export Citation
  • UrbatzkaRBotteroSMandichALutzIKloasW2007Endocrine disrupters with (anti)estrogenic and (anti)androgenic modes of action affecting reproductive biology of Xenopus laevis: I. Effects on sex steroid levels and biomarker expression. Comparative Biochemistry and Physiology. Toxicology and Pharmacology144310318. doi:10.1016/j.cbpc.2006.10.008.

    • Search Google Scholar
    • Export Citation
  • VizzianoDRanduineauGBaronDCautyCGuiguenY2007Characterization of early molecular sex differentiation in rainbow trout, Oncorhynchus mykiss. Developmental Dynamics23621982206. doi:10.1002/dvdy.21212.

    • Search Google Scholar
    • Export Citation
  • YangWHLutzLBHammesSR2003Xenopus laevis ovarian CYP17 is a highly potent enzyme expressed exclusively in oocytes. Evidence that oocytes play a critical role in Xenopus ovarian androgen production. Journal of Biological Chemistry27895529559. doi:10.1074/jbc.M212027200.

    • Search Google Scholar
    • Export Citation