Downregulation of peroxisome proliferator-activated receptor α and its coactivators in liver and skeletal muscle mediates the metabolic adaptations during lactation in mice

in Journal of Molecular Endocrinology
View More View Less
  • 1 Institute of Agricultural and Nutritional Sciences, Chair of Animal Nutrition, Martin-Luther-Universität Halle-Wittenberg, Von-Danckelmann-Platz 2, D-06120 Halle (Saale), Germany

Previous studies have shown that genes involved in fatty acid uptake, fatty acid oxidation, and thermogenesis are downregulated in liver and skeletal muscle of rats during lactation. However, biochemical mechanisms underlying these important metabolic adaptations during lactation have not yet been elucidated. As all these genes are transcriptionally regulated by peroxisome proliferator-activated receptor α (Pparα), we hypothesized that their downregulation is mediated by a suppression of Pparα during lactation. In order to investigate this hypothesis, we performed an experiment with lactating and nonlactating Pparα knockout and corresponding wild-type mice. In wild-type mice, lactation led to a considerable downregulation of Pparα, Ppar coactivators Pgc1α and Pgc1β, and Pparα target genes involved in fatty acid uptake, fatty acid oxidation, and thermogenesis in liver and skeletal muscle (P<0.05). Pparα knockout mice had generally a lower expression of all these Pparα target genes in liver and skeletal muscle. However, in those mice, lactation did not lower the expression of genes involved in fatty acid utilization and thermogenesis in liver and skeletal muscle. Expression levels of Pparα target genes in lactating wild-type mice were similar than in lactating or nonlactating Pparα knockout mice. In conclusion, the present findings suggest that downregulation of Pparα and its coactivators in tissues with high rates of fatty acid catabolism is responsible for the reduced utilization of fatty acids in liver and skeletal muscle and the reduced thermogenesis occurring in the lactating animal, which aim to conserve energy and metabolic substrates for milk production in the mammary gland.

Abstract

Previous studies have shown that genes involved in fatty acid uptake, fatty acid oxidation, and thermogenesis are downregulated in liver and skeletal muscle of rats during lactation. However, biochemical mechanisms underlying these important metabolic adaptations during lactation have not yet been elucidated. As all these genes are transcriptionally regulated by peroxisome proliferator-activated receptor α (Pparα), we hypothesized that their downregulation is mediated by a suppression of Pparα during lactation. In order to investigate this hypothesis, we performed an experiment with lactating and nonlactating Pparα knockout and corresponding wild-type mice. In wild-type mice, lactation led to a considerable downregulation of Pparα, Ppar coactivators Pgc1α and Pgc1β, and Pparα target genes involved in fatty acid uptake, fatty acid oxidation, and thermogenesis in liver and skeletal muscle (P<0.05). Pparα knockout mice had generally a lower expression of all these Pparα target genes in liver and skeletal muscle. However, in those mice, lactation did not lower the expression of genes involved in fatty acid utilization and thermogenesis in liver and skeletal muscle. Expression levels of Pparα target genes in lactating wild-type mice were similar than in lactating or nonlactating Pparα knockout mice. In conclusion, the present findings suggest that downregulation of Pparα and its coactivators in tissues with high rates of fatty acid catabolism is responsible for the reduced utilization of fatty acids in liver and skeletal muscle and the reduced thermogenesis occurring in the lactating animal, which aim to conserve energy and metabolic substrates for milk production in the mammary gland.

Introduction

Lactation is a physiological state characterized by a dramatic increase in the energy and nutrient requirement of the organism for milk production. This demand is usually met by a markedly increased food intake and by the utilization of energy stores. In addition, several metabolic adaptations develop in the lactating animal aiming to conserve energy and metabolic substrates for milk production in the mammary gland (Trayhurn et al. 1982, Williamson 1986, Dewey 1997, Smith & Grove 2002). Recently, it has been shown that downregulation of uncoupling proteins (Ucp) 1 and 3 in brown adipose tissue and of Ucp3 in skeletal muscle, leading to a decrease in metabolic fuel oxidation and thermogenesis, contributes to these metabolic adaptations during lactation (Trayhurn et al. 1982, Pedraza et al. 2000, 2001, Xiao et al. 2004a). Furthermore, expression of proteins involved in uptake and oxidation of fatty acids in skeletal muscle (Xiao et al. 2004b) as well as the rates of fatty acid oxidation and ketogenesis in the liver (Whitelaw & Williamson 1977) are reduced during lactation, effects that help to spare fatty acids for milk production in the mammary gland. Both Ucp and proteins involved in fatty acid uptake and oxidation are transcriptionally regulated by peroxisome proliferator-activated receptor α (Pparα; Bruns et al. 1999, Barbera et al. 2000, Young et al. 2001, Mandard et al. 2004). Pparα is a ligand-activated transcription factor, which is abundantly expressed in tissues with high rates of fatty acid oxidation, such as liver and skeletal muscle, and its physiologic role lies in the mediation of metabolic responses to fasting (Schoonjans et al. 1997, Leone et al. 1999, Mandard et al. 2004). Upon activation by either nonesterified fatty acids (NEFA) released from adipose tissue and taken up into tissues or exogenous ligands (diet-derived fatty acids or fibrates), Pparα upregulates genes involved in all aspects of fatty acid catabolism including cellular fatty acid uptake and transport, mitochondrial and peroxisomal fatty acid oxidation, as well as ketogenesis (Mandard et al. 2004). We have recently observed that lactating rats have reduced mRNA concentrations of Pparα and Pparα-regulated genes involved in fatty acid utilization in the liver compared with nonlactating rats (Gutgesell et al. 2009). This finding suggested that downregulation of genes involved in fatty acid uptake and oxidation as well as Ucp during lactation is mediated by suppression of Pparα.

The aim of the present study was to test the hypothesis that downregulation of Pparα mediates the reduced expression of genes involved in fatty acid uptake and β-oxidation in tissues with high rates of fatty acid utilization such as liver and skeletal muscle, which favors the availability of fatty acids for milk triacylglycerol (TAG) production in the mammary gland. For that purpose, we performed an experiment with Pparα knockout and corresponding wild-type mice, and studied the influence of lactation on the expression of Pparα and selected Pparα-responsive genes involved in fatty acid uptake (Fabppm and Fatp), fatty acid oxidation (Cpt I, Cyp4a10 and Mcad), and thermogenesis (Ucp3) in liver and skeletal muscle respectively. It has been shown that the transcriptional activity of Ppar is enhanced by several coactivators, including Pparγ coactivator (Pgc)1α and 1β. These coactivators are required for the ability of Ppar to increase gene transcription to the maximum (Yu & Reddy 2007). In order to study whether lactation influences the expression of these coactivators, we also determined the expression of Pgc1α and Pgc1β in liver and skeletal muscle.

During lactation, an increased flow of NEFA, originating from hydrolysis of TAG by hormone-sensitive lipase in adipose tissue into the mammary gland for milk production, is observed, whereas uptake of fatty acids by lipoprotein lipase (Lpl) from TAG-rich lipoproteins such as chylomicrons and very low-density lipoproteins into adipose tissue is reduced during lactation (Williamson 1986). The uptake of both fatty acids released by Lpl from TAG-rich lipoproteins and albumin-bound NEFA in the plasma released from adipose tissue into the mammary gland is mediated by fatty acid transporters, and is an important source for milk TAG synthesis. To obtain information about alterations in the uptake of fatty acids into the mammary gland during lactation, we also determined expression of fatty acid transporters and Lpl in the mammary gland as well as TAG concentrations in plasma.

Materials and methods

Animal experiment

The animal experiment was carried out with female Pparα knockout mice (129S4/SvJae-Pparatm1Gonz/J) and corresponding wild-type mice (129S1/SvImJ) obtained from Jackson Laboratory (Bar Harbor, ME, USA). They were kept in Macrolon cages in a room maintained with controlled temperature (23±1 °C), humidity (50–60%), and lighting (0600 to 1800 h). All animals were fed a commercial standard diet for rodents (Altromin GmbH, Lage, Germany). The standard diet was nutritionally adequate for lactating mice according to the recommendations of American Society for Nutritional Sciences (ASNS) (Reeves et al. 1993), and contained 11.9 MJ/kg metabolizable energy. The composition of the standard diet was (g/kg diet): crude protein (19.0), crude fat (4.0), crude fiber (6.0), crude ash (7.0), and nitrogen-free extracts (53.0) (Altromin). Water was available ad libitum from nipple drinkers. All experimental procedures described followed established guidelines for the care and handling of laboratory animals (UFAW 1999, Society for Endocrinology's guidelines on the use of animals, URL: http://www.endocrinology-journals.org/misc/use_of_animals.dtl) and were approved by the council of Saxony-Anhalt.

At 14 weeks of age, the mice were mated by housing two female mice with one male mouse (129S1/SvImJ) for 6 days. At the day of parturition, designated as day 1 of lactation, wild-type mice (n=10) and Pparα knockout mice (n=14) were randomly assigned to two groups. In one group of the wild-type and Pparα knockout mice, all pups were removed (without litter), whereas in the other group litters were adjusted to six pups per dam (with litter). During pregnancy and lactation, female mice were kept individually in single cages, and diets fed ad libitum. Feed consumption was measured every day by determining the weight of the remaining diet at the day after feed administration. At day 15 of lactation, dams received the last dose of the diet at the beginning of the light cycle (0600 h) and were killed 4 h later at 1000 h by decapitation under light anesthesia with diethyl ether. Animals were killed in the nonfasted state to prevent fasting-induced Pparα activation.

Sample collection

Blood was collected into heparinized polyethylene tubes (Sarstedt, Nürnberg, Germany). Plasma was obtained by centrifugation of the blood (1100 g; 10 min; 4 °C) and stored at −20 °C. Liver, mammary gland, and skeletal muscle were excised, immediately shock frozen with liquid nitrogen, and stored at −80 °C pending analysis.

Lipid analysis

Plasma TAG concentrations were measured using reagent kits obtained from Merck Eurolab (Ref. 113009990314) according to the manufacturer's protocol.

RNA isolation and RT-PCR with real-time detection

Total RNA was isolated from the liver, mammary gland, and skeletal muscle (M. semitendinosus) using Trizol reagent (Invitrogen) according to the manufacturer's protocol. RNA concentration and purity were estimated from the optical density at 260 and 280 nm (SpectraFluor Plus, Tecan, Crailsheim, Germany). Synthesis of cDNA and determination of mRNA abundance by RT-PCR with real-time detection (Rotorgene 2000, Corbett Research, Mortlake, New South Wales, Australia) using Sybr Green I were performed as recently described in detail (Ringseis et al. 2007c). Relative quantification of mRNA concentrations was performed using the ΔΔCt method (Pfaffl 2001). Threshold cycle (Ct) values were obtained using Rotorgene Software 5.0 (Corbett Research). The housekeeping genes Gapdh (liver), β-actin (skeletal muscle), and Cyp18 (mammary gland) were used for normalization. Different housekeeping genes were used in the various tissues, because none of the housekeeping genes tested served as an appropriate reference gene in all tissues. The existence of a single PCR product of the expected length was guaranteed by melting curve analysis and 1% agarose gel electrophoresis. Relative mRNA concentrations are expressed as fold of mRNA concentration of the wild-type without litter group. Characteristics of the primers (Eurofins MWG Operon, Ebersberg, Germany) used for RT-PCR with real-time detection are shown in Table 1.

Table 1

Characteristics of the primers used for RT-PCR analysis with real-time detection

Forward primer (from 5′ to 3′)Reverse primer (5′–3′)PCR product size (bp)NCBI GenBank
Gene
β-actinACGGCCAGGTCATCACTATTGCACAGGATTCCATACCCAAGAAG87NM_007393
Cyp18GTGGTCTTTGGGAAGGTGAATTACAGGACATTGCGAGCAG210NM_008907
Cyp4a10TGAGGGAGAGCTGGAAAAGACTGTTGGTGATCAGGGTGTG266NM_010011
FabppmCCAGAAAGGGAAGGACATCAGTCTCCAGTTCGCACTCCTC132NM_017399
FasTGGGTTCTAGCCAGCAGAGTACCACCAGAGACCGTTATGC158NM_007988
Fat/Cd36GAGCAACTGGTGGATGGTTTGCAGAATCAAGGGAGAGCAC207NM_007643
FatpTGCTTTGGTTTCTGGGACTTGCTCTAGCCGAACACGAATC156NM_11977
GapdhAACGACCCCTTCATTGACTCCACGACATACTCAGCAC191XM_001476707
l-Cpt ICCAGGCTACAGTGGGACATTGAACTTGCCCATGTCCTTGT209NM_013495
LplGGGCTCTGCCTGAGTTGTAGAGAAATTTCGAAGGCCTGGT157NM_008509
McadAGGTTTCAAGATCGCAATGGCTCCTTGGTGCTCCACTAGC152NM_007382
m-Cpt IGTCGCTTCTTCAAGGTCTGGAAGAAAGCAGCACGTTCGAT232NM_009948
Pgc1αAAACTTGCTAGCGGTCCTCATGTTGACAAATGCTCTTC342NM_008904
Pgc1βAACCCAACCAGTCTCACAGGTGCTGCTGTCCTCAAATACG371NM_133249
PparαCGGGAAAGACCAGCAACAACTGGCAGTGGAAGAATCG137NM_011144
Ucp3CCACACTT CCTCCTGCTCTCGTATAGGGCGCTCAAATGGA235NM_009464

Statistical analysis

Data were analyzed using the Minitab Statistical Software (Minitab Rel. 15, State College, PA, USA). Treatment effects were analyzed by two-way ANOVA with classification factors being litter, genotype, and the interaction of litter and genotype. For significant F-values, means were compared by Fisher's multiple range test. Means were considered significantly different for P<0.05. Data presented in the text are shown as means±s.e.m.

Results

Food intake, body weights of dams, and weights of litters

Dams with litters consumed more food per day than those without litters, irrespective of genotype (wild-type mice without litter: 2.0±0.2 g/d; wild-type mice with litter: 7.7±0.7 g/d; Pparα knockout mice without litter: 2.1±0.2 g/d; Pparα knockout mice with litter: 7.9±1.0 g/d; P<0.05). Body weights of dams at day 1 of lactation did not differ between groups (wild-type mice without litter: 22.2±0.6 g; wild-type mice with litter: 22.1±0.9 g; Pparα knockout mice without litter: 22.7±1.3 g; Pparα knockout mice with litter: 23.7±2.2 g). However, body weights at day 15 of lactation were higher in dams with litters than in those without litters, irrespective of the genotype (wild-type mice without litter: 20.8±0.6 g; wild-type mice with litter: 26.0±0.7 g; Pparα knockout mice without litter: 20.1±0.9 g; Pparα knockout mice with litter: 26.1±2.1 g; P<0.05). Litter weights of dams of both genotypes did not differ either at day 1 or at day 15 of lactation (day 1 of lactation: wild-type mice: 11.8±1.0 g; Pparα knockout mice: 11.2±1.1 g; day 15 of lactation: wild-type mice: 43.5±2.1 g; Pparα knockout mice: 44.8±2.2 g).

TAG concentrations in plasma

TAG concentrations in plasma were influenced by the factors litter and genotype (P<0.05); mice with litters had lower concentrations of TAG in plasma than those without litters, irrespective of the genotype; Pparα knockout mice had higher TAG concentrations in plasma than wild-type mice (wild-type mice without litter: 0.61±0.10 mmol/l; wild-type mice with litter: 0.39±0.02 mmol/l; Pparα knockout mice without litter: 0.90±0.10 mmol/l; Pparα knockout mice with litter: 0.69±0.09 mmol/l).

Expression of Pparα in liver and skeletal muscle

Wild-type mice with litters had markedly lower relative mRNA concentrations of Pparα in liver and skeletal muscle than wild-type mice without litters (P<0.05; Fig. 1).

Figure 1
Figure 1

Relative mRNA concentrations of Pparα in the liver (A) and skeletal muscle (B) of wild-type mice, whose litters were either removed (without litter) or adjusted to 6 pups/dam (with litter) immediately after birth, at day 15 of lactation. Bars represent means±s.e.m. for n=5. *Indicates a significant difference from ‘without’ litter group. P<0.05.

Citation: Journal of Molecular Endocrinology 43, 6; 10.1677/JME-09-0064

Expression of Pparα target genes in the liver

Wild-type mice with litters had markedly lower relative mRNA concentrations of l-Cpt I, Cyp4A10, Fatp, and Fabppm in the liver than wild-type mice without litters (P<0.05; Fig. 2). Relative mRNA concentrations of all these genes in the liver were lower in Pparα knockout mice with and without litters than in wild-type mice with litters (P<0.05; Fig. 2); however, relative mRNA concentrations of these genes in the liver did not differ between Pparα knockout mice with litters and those without litters (Fig. 2).

Figure 2
Figure 2

Relative mRNA concentrations of the Pparα target genes l-Cpt I, Cyp4a10, Fabppm, and Fatp in the liver of lactating wild-type and lactating Pparα knockout mice, whose litters were either removed (without litter) or adjusted to 6 pups/dam (with litter) immediately after birth, at day 15 of lactation. Bars represent means±s.e.m. for n=5 in wild-type mice and n=7 in Pparα knockout mice. Bars without a common letter (a–c) differ, P<0.05. Significant effects (P<0.05) from two-way ANOVA: l-Cpt I: litter, genotype, and litter×genotype; Cyp4a10: litter, genotype, and litter×genotype; Fabppm: litter, genotype, and litter×genotype; Fatp: litter, genotype, and litter×genotype.

Citation: Journal of Molecular Endocrinology 43, 6; 10.1677/JME-09-0064

Expression of Pparα target genes in skeletal muscle

In skeletal muscle, relative mRNA concentrations of m-Cpt I, Mcad, Fatp, and Ucp3 were lower in wild-type mice with litters compared with wild-type mice whose litters were removed (P<0.05; Fig. 3). In contrast, relative mRNA concentrations of these genes did not differ between Pparα knockout mice with litters and Pparα knockout mice without litters (Fig. 3). The relative mRNA concentrations of m-Cpt I, Mcad, Fatp, and Ucp3 in skeletal muscle were lower in Pparα knockout mice with and without litters than in wild-type mice without litters (P<0.05; Fig. 3). Unexpectedly, relative mRNA concentrations of m-Cpt I and Mcad in skeletal muscle in wild-type mice with litters were even lower than in Pparα knockout mice with and without litters (P<0.05; Fig. 3). The relative mRNA concentration of Fabppm in skeletal muscle did not differ between the four groups of mice (Fig. 3).

Figure 3
Figure 3

Relative mRNA concentrations of the Pparα target genes m-Cpt I, Mcad, Fabppm, Fatp, and Ucp3 in the skeletal muscle of lactating wild-type and lactating Pparα knockout mice, whose litters were either removed (without litter) or adjusted to 6 pups/dam (with litter) immediately after birth, at day 15 of lactation. Bars represent means±s.e.m. for n=5 in wild-type mice and n=7 in Pparα knockout mice. Bars without a common letter (a–c) differ, P<0.05. Significant effects (P<0.05) from two-way ANOVA: m-Cpt I: litter and litter×genotype; Mcad: litter and litter×genotype; Fatp: genotype and litter×genotype; Ucp3: litter and litter×genotype.

Citation: Journal of Molecular Endocrinology 43, 6; 10.1677/JME-09-0064

Expression of Ppar coactivators Pgc1α and Pgc1β in liver and skeletal muscle

In liver and skeletal muscle, relative mRNA concentrations of Pgc1α and Pgc1β were lower in wild-type mice with litters compared with wild-type mice whose litters were removed (P<0.05; Fig. 4). In contrast, relative mRNA concentrations of Pgc1α and Pgc1β in liver and skeletal muscle did not differ between Pparα knockout mice with litters and Pparα knockout mice without litters (Fig. 4). However, whereas relative mRNA concentrations of Pgc1α and Pgc1β in liver were lower in Pparα knockout mice with and without litters than in wild-type mice without litters (P<0.05; Fig. 4), relative mRNA concentrations of these genes in skeletal muscle did not differ between wild-type mice without litters and Pparα knockout mice with and without litters (Fig. 4).

Figure 4
Figure 4

Relative mRNA concentrations of Pgc1α and Pgc1β in liver (A) and skeletal muscle (B) of lactating wild-type and lactating Pparα knockout mice, whose litters were either removed (without litter) or adjusted to 6 pups/dam (with litter) immediately after birth, at day 15 of lactation. Bars represent means±s.e.m. for n=5 in wild-type mice and n=7 in Pparα knockout mice. Bars without a common letter (a–b) differ, P<0.05. Significant effects (P<0.05) from two-way ANOVA: Pgc1α liver: litter and litter×genotype; Pgc1β liver: litter, genotype and litter×genotype; Pgc1α skeletal muscle: litter and litter×genotype; Pgc1β skeletal muscle: litter and litter×genotype.

Citation: Journal of Molecular Endocrinology 43, 6; 10.1677/JME-09-0064

Expression of fatty acid transporters, Lpl, and fatty acid synthase in the mammary gland of mice

Wild-type mice with litters had markedly higher mRNA concentrations of Fat/Cd36, Fatp, Lpl, and fatty acid synthase (Fas) in the mammary gland than wild-type mice without litters (P<0.05; Fig. 5). In Pparα knockout mice, the mRNA concentrations of these genes were also higher in the mammary gland of dams with litters than in those without litters (P<0.05; Fig. 5).

Figure 5
Figure 5

Relative mRNA concentrations of Fat/Cd36, Fabppm, Fatp, Lpl, and Fas in the mammary gland of lactating wild-type and lactating Pparα knockout mice, whose litters were either removed (without litter) or adjusted to 6 pups/dam (with litter) immediately after birth, at day 15 of lactation. Bars represent means±s.e.m. for n=5 in wild-type mice and n=7 in Pparα knockout mice. Bars without a common letter (a–b) differ, P<0.05. Significant effects (P<0.05) from two-way ANOVA: Fat/Cd36: litter; Fabppm: litter and litter×genotype; Fatp: litter; Lpl: litter; Fas: litter.

Citation: Journal of Molecular Endocrinology 43, 6; 10.1677/JME-09-0064

Discussion

The aim of the present study was to test the hypothesis that downregulation of Pparα in tissues with high rates of fatty acid catabolism (liver and skeletal muscle) is responsible for the metabolic adaptations occurring in the lactating animal, such as decreased fatty acid oxidation and diminished thermogenesis (Zammit 1980, Pedraza et al. 2000, 2001, Xiao et al. 2004a,b). Herein, we could clearly demonstrate for the first time that downregulation of Pparα and Pparα target genes involved in fatty acid uptake (Fabppm and Fatp), fatty acid oxidation (Cpt I, Cyp4a10, and Mcad), and thermogenesis (Ucp3) occurs only in tissues of lactating wild-type mice. In Pparα knockout mice, in contrast, lactation did not result in a reduced expression of Pparα and Pparα target genes in these tissues. These findings strongly indicate that the metabolic adaptations in the lactating animal (Zammit 1980, Pedraza et al. 2000, 2001, Xiao et al. 2004a,b) are mediated by the diminished expression of Pparα in liver and skeletal muscle. As expected, expression levels of Pparα target genes were markedly lower in liver and skeletal muscle of Pparα knockout mice than in those of nonlactating wild-type mice. In this regard, it is, however, noteworthy that Pparα target genes, with the exception of m-Cpt I and Mcad in skeletal muscle, were expressed in tissues of Pparα knockout mice at levels comparable with those of lactating wild-type mice. This indicates that lactation in wild-type mice causes a similar reduction in the expression of Pparα target genes as disruption of Pparα expression.

Although Pparα is clearly an important transcription factor in regulating the expression of genes involved in fatty acid oxidation, the observation that the mRNA levels of m-Cpt I and Mcad in skeletal muscle were even stronger reduced by lactation than by the Pparα knockout implies that also other Pparα-independent mechanisms might be involved. As lactating wild-type mice had lower mRNA concentrations of Pgc1α and Pgc1β, which are required for maximal transcriptional activity of Ppar (Yu & Reddy 2007, Feingold et al. 2008), in liver and skeletal muscle than their nonlactating counterparts, we suggest that a reduced expression of Ppar coactivators could have also contributed to the decreased expression of Pparα-regulated genes in skeletal muscle and liver during lactation. In liver, the expression of both coactivators was lower in Pparα knockout than in wild-type mice, indicating that Pgc1α and Pgc1β are regulated by Pparα in that tissue. However, in skeletal muscle, the expression of both coactivators did not differ between wild-type mice without litters and Pparα knockout mice with and without litters, suggesting that Pgc1α and Pgc1β in skeletal muscle are regulated by Pparα independently. The finding that Ppar coactivators in skeletal muscle were not reduced in Pparα knockout mice compared with wild-type mice could provide an explanation for the observation that some Pparα-regulated genes, such as m-Cpt I and Mcad, in skeletal muscle were only slightly reduced in knockout versus wild-type mice. Reduced mRNA concentrations of Ppar coactivators in skeletal muscle of lactating wild-type mice compared with lactating Pparα knockout mice could be responsible for the finding that the expression of some Pparα target genes such as m-Cpt I and Mcad in skeletal muscle was even lower in lactating wild-type than in knockout mice.

Besides downregulation of fatty acid oxidation enzymes and fatty acid transporters in skeletal muscle, we observed downregulation of Ucp3 in skeletal muscle of lactating wild-type mice, which is consistent with recent observations in skeletal muscle and brown adipose tissue of lactating rats (Pedraza et al. 2000, 2001, Xiao et al. 2004a,b). Since Ucp function to uncouple the respiratory chain and, thereby, increase heat production, downregulation of Ucp in brown adipose tissue of rats during lactation (Pedraza et al. 2001, Xiao et al. 2004a,b) has been suggested to reflect the need to conserve energy during lactation through a decrease in nonshivering thermogenesis (Williamson 1986, Pedraza et al. 2000, 2001, Xiao et al. 2004a,b). The finding that Ucp3 expression was reduced in skeletal muscle of lactating wild-type mice, but not in lactating Pparα knockout mice, again might indicate that the reduction of thermogenesis in skeletal muscle during lactation (Zammit 1980, Pedraza et al. 2000, 2001, Xiao et al. 2004a,b) is also mediated by the diminished expression of Pparα. Nevertheless, although Ucp3 has been proposed to play an important role in regulating energy expenditure and thermoregulation (Boss et al. 1997, Vidal-Puig et al. 1997), the exact physiological role of Ucp3 is still elusive; i.e. observations from recent studies indicate that Ucp3 function in skeletal muscle and heart is likely to be related to fatty acid catabolism (Muoio et al. 2002, Murray et al. 2005). In line with this assumption is the observation that Ucp3 participates in mitochondrial antioxidant defense and serves as an ‘early response’ to elevated reactive oxygen species (ROS) production and potential oxidative stress by increasing uncoupling respiration during prolonged exercise in rat skeletal muscle (Jiang et al. 2009). Therefore, future studies have to elucidate the exact physiological role of Ucp3 downregulation during lactation.

Based on the findings of this study and other studies in the literature (Trayhurn et al. 1982, Pedraza et al. 2000, 2001, Xiao et al. 2004a,b), we propose the model shown in Fig. 6. It suggests that downregulation of Pparα and its coactivators in tissues with high rates of fatty acid utilization, such as liver, skeletal muscle, and heart, and subsequently reduced utilization of fatty acids by these tissues during lactation mediates an increased flow of NEFA from white adipose tissues and TAG-rich lipoproteins into the mammary gland, and thus helps to spare energy and metabolic substrates for milk production. The physiologically increased availability of fatty acids in the mammary gland during lactation (Williamson 1986, Dewey 1997, Smith & Grove 2002) is reflected by the marked upregulation of fatty acid transporters (Fat/Cd36 and Fatp) and Lpl, which mediate the uptake of albumin-bound NEFA and fatty acids released from TAG-rich lipoproteins respectively in the mammary gland and the reduced concentrations of NEFA (Pedraza et al. 2000) and TAG (Gutgesell et al. 2009) in plasma of lactating animals in both genotypes. In addition, expression of the lipogenic enzyme Fas, which is critical for de novo fatty acid synthesis, was strongly increased in the mammary gland of lactating mice of both genotypes. This indicates that Pparα does not play an essential role for the uptake of fatty acids into the mammary gland, and that de novo fatty acid synthesis in the mammary gland is similar in both genotypes. This indication was not unexpected as Pparα mRNA was only barely detectable in the mammary gland in the present study (data not shown) – a finding that largely confirms those of others (Gimble et al. 1998, Rodriguez-Cruz et al. 2006).

Figure 6
Figure 6

Working hypothesis: downregulation of Pparα and its coactivators leads to a reduced uptake of fatty acids into tissues with high rates of β-oxidation, such as liver, skeletal muscle, and heart, and to a reduced rate of β-oxidation in these tissues. downregulation of Ucps in brown adipose tissue (Ucp1 and Ucp3) and skeletal muscle (Ucp3) additionally diminishes thermogenesis and oxidation of fuels, which are spared for milk synthesis. As recently shown, hepatic enzymes of carnitine synthesis are concomitantly also reduced during lactation, which, in turn, leads to a reduced carnitine content in liver and skeletal muscle (Gutgesell et al. 2009). As carnitine is involved in β-oxidation by transferring fatty acids into the mitochondrion, inhibition of carnitine synthesis can be regarded also as a means to diminish fatty acid oxidation during lactation. On the other side, synthesis of fatty acids and TAG in the liver is enhanced during lactation, leading to an increased secretion of VLDL–TAG and an increased uptake of fatty acids from VLDL–TAG into the mammary gland due to the enhanced expression of Lpl (Farid et al. 1978, Grigor et al. 1982). Simultaneously, the uptake of NEFA derived mainly from lipolysis in white adipose tissue by fatty acid transporters into the mammary gland as well as de novo fatty acid synthesis catalyzed by lipogenic enzymes including Fas in the mammary gland is increased, which also enhances the pool of fatty acids in the mammary gland available for milk TAG production. CD36/Fat, CD36/fatty acid translocase; FA, fatty acid; Fabppm, plasma membrane-fatty acid-binding protein; Fas, fatty acid synthase; Fatp, fatty acid transport protein; Hsl, hormone-sensitive lipase; Lpl, lipoprotein lipase; NEFA, nonesterified fatty acids; Pgc1α/β, PPARγ co-activator 1α/β; Pparα, peroxisome proliferator-activated receptor α; TAG, triacylglycerols; Ucp1/3, uncoupling protein 1/3; VLDL, very low-density lipoprotein.

Citation: Journal of Molecular Endocrinology 43, 6; 10.1677/JME-09-0064

Our proposed model is supported by the finding that activation of Pparα during lactation disturbs the normal metabolic adaptations during lactation. We have recently observed that activation of hepatic Pparα in the lactating rat by feeding a dietary oxidized fat, a potent activator of hepatic Pparα (Chao et al. 2001, Sülzle et al. 2004, Ringseis et al. 2007b), leads to an increased uptake of fatty acids into the liver and an enhanced β-oxidation in the liver, whereas uptake of fatty acids into the mammary gland by fatty acid transporters and Lpl was decreased, which, in turn, led to a dramatically reduced milk TAG content and reduced weight gains of litters during suckling (Ringseis et al. 2007a). Similar observations regarding an impairment of lactation-induced energy-sparing mechanisms by the administration of Pparα activators during lactation have been reported from others (Pedraza et al. 2000).

In conclusion, the present study shows for the first time that downregulation of Pparα, Ppar coactivators, and Pparα-regulated genes, which are involved in fatty acid uptake, fatty acid oxidation, and thermogenesis, occurs only in tissues of lactating wild-type mice but not Pparα knockout mice. We postulate that downregulation of Pparα and its coactivators in tissues with high rates of fatty acid catabolism is responsible for the reduced utilization of fatty acids in liver and skeletal muscle and the reduced thermogenesis occurring in the lactating animal, which aim to conserve energy and metabolic substrates for milk production in the mammary gland. The mechanism through which Pparα is downregulated during lactation is currently unknown, but it may be speculated that hormonal changes associated with lactation, such as hyperprolactinemia or hypoleptinemia (Xiao et al. 2004a), and also changes in the levels of GH or insulin, might be causative. Therefore, further studies are necessary to identify the mechanisms behind the changes in Pparα expression during lactation.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This research did not receive any specific grant from any funding agency in the public, commercial, or not-for-profit sector.

References

  • Barbera MJ, Schlüter A, Pedraza N, Iglesias R, Villaroya F & Giralt M 2000 Peroxisome proliferator-activated receptor α activates transcription of the brown fat uncoupling protein-1 gene. A link between regulation of thermogenic and lipid oxidation pathways in the brown fat cell. Journal of Biological Chemistry 276 14861493.

    • Search Google Scholar
    • Export Citation
  • Boss O, Samec S, Paoloni-Giacobino A, Rossier C, Dulloo A, Seydoux J, Muzzin P & Giacobino JP 1997 Uncoupling protein-3: a new member of the mitochondrial carrier family with tissue-specific expression. FEBS Letters 408 3942.

    • Search Google Scholar
    • Export Citation
  • Bruns S, Carmona MC, Mamperl T, Vinas O, Giralt M, Igleasias R & Villaroya F 1999 Activators of peroxisome proliferators-activated receptor α induce the expression of the uncoupling protein-3 gene in skeletal muscle: a potential for the lipid intake-dependent activation of uncoupling protein-3 gene expression at birth. Diabetes 48 12171222.

    • Search Google Scholar
    • Export Citation
  • Chao PM, Chao CY, Lin FJ & Huang CJ 2001 Oxidized frying oil up-regulates hepatic acyl-CoA oxidase and cytochrome P450 4A1 genes in rats and activates PPARα. Journal of Nutrition 131 31663174.

    • Search Google Scholar
    • Export Citation
  • Dewey KG 1997 Energy and protein requirements during lactation. Annual Review of Nutrition 17 1936.

  • Farid M, Baldwin RL, Yang YT, Osborne E & Grichting G 1978 Effects of age, diet and lactation on lipogenesis in rat adipose, liver and mammary tissues. Journal of Nutrition 108 514524.

    • Search Google Scholar
    • Export Citation
  • Feingold KR, Wang Y, Moser A, Shigenaga JK & Grunfeld C 2008 LPS decreases fatty acid oxidation and nuclear hormone receptors in the kidney. Journal of Lipid Research 49 21792187.

    • Search Google Scholar
    • Export Citation
  • Gimble JM, Pighetti GM, Lerner MR, Wu X, Lightfoot SA, Brackett DJ, Darcy K & Hollingsworth AB 1998 Expression of peroxisome proliferator activated receptor mRNA in normal and tumorigenic rodent mammary glands. Biochemical and Biophysical Research Communications 253 813817.

    • Search Google Scholar
    • Export Citation
  • Grigor MR, Geursen A, Sneyd MJ & Warren SM 1982 Regulation of lipogenic capacity in lactating rats. Biochemical Journal 208 611618.

  • Gutgesell A, Ringseis R, Brandsch C, Stangl GI, Hirche F & Eder K 2009 Peroxisome proliferator-activated receptor α and enzymes of carnitine biosynthesis in the liver are down-regulated during lactation in rats. Metabolism 58 226232.

    • Search Google Scholar
    • Export Citation
  • Jiang N, Zhang G, Bo H, Qu J, Ma G, Cao D, Wen L, Liu S, Ji LL & Zhang Y 2009 Upregulation of uncoupling protein-3 in skeletal muscle during exercise: a potential antioxidant function. Free Radical Biology and Medicine 46 138145.

    • Search Google Scholar
    • Export Citation
  • Leone TC, Weinheimer CJ & Kelly DP 1999 A critical role for the peroxisome proliferator-activated receptor α (PPARα) in the cellular fasting response: the PPARα-null mouse as a model of fatty acid oxidation disorders. PNAS 96 74737478.

    • Search Google Scholar
    • Export Citation
  • Mandard S, Müller M & Kersten S 2004 Peroxisome proliferator receptor α target genes. Cellular and Molecular Life Sciences 61 393416.

  • Muoio DM, MacLean PS, Lang DB, Li S, Houmard JA, Way JM, Winegar DA, Corton JC, Dohm GL & Kraus WE 2002 Fatty acid homeostasis and induction of lipid regulatory genes in skeletal muscles of peroxisome proliferator-activated receptor (PPAR) alpha knock-out mice. Evidence for compensatory regulation by PPAR delta. Journal of Biological Chemistry 277 2608926097.

    • Search Google Scholar
    • Export Citation
  • Murray AJ, Panagia M, Hauton D, Gibbons GF & Clarke K 2005 Plasma free fatty acids and peroxisome proliferator-activated receptor alpha in the control of myocardial uncoupling protein levels. Diabetes 54 349634502.

    • Search Google Scholar
    • Export Citation
  • Pedraza N, Solanes G, Carmona MC, Iglesias R, Vinas O, Mampel T, Vazquez M, Giralt M & Villarroya F 2000 Impaired expression of the uncoupling protein-3 gene in skeletal muscle during lactation: fibrates and troglitazone reverse lactation-induced downregulation of the uncoupling protein-3 gene. Diabetes 49 12241230.

    • Search Google Scholar
    • Export Citation
  • Pedraza N, Solanes G, Iglesias R, Vazquez M, Giralt M & Villarroya F 2001 Differential regulation of expression of genes encoding uncoupling proteins 2 and 3 in brown adipose tissue during lactation in mice. Biochemical Journal 355 105111.

    • Search Google Scholar
    • Export Citation
  • Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 e45.

  • Reeves PG, Nielsen FH & Fahey GC Jr 1993 AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. Journal of Nutrition 123 19391951.

    • Search Google Scholar
    • Export Citation
  • Ringseis R, Dathe C, Muschick A, Brandsch C & Eder K 2007a Oxidized fat reduces milk triacylglycerol concentrations by inhibiting gene expression of lipoprotein lipase and fatty acid transporters in the mammary gland of rats. Journal of Nutrition 137 20562061.

    • Search Google Scholar
    • Export Citation
  • Ringseis R, Muschick A & Eder K 2007b Dietary oxidized fat prevents ethanol-induced triacyglycerol accumulation and increases expression of PPARα target genes in rat liver. Journal of Nutrition 137 7783.

    • Search Google Scholar
    • Export Citation
  • Ringseis R, Pösel S, Hirche F & Eder K 2007c Treatment with pharmacological peroxisome proliferator-activated receptor α agonist clofibrate causes upregulation of organic cation transporter 2 in liver and small intestine of rats. Pharmacological Research 56 175183.

    • Search Google Scholar
    • Export Citation
  • Rodriguez-Cruz M, Tovar AR, Palacios-Gonzalez B, Del Prado M & Torres N 2006 Synthesis of long-chain polyunsaturated fatty acids in lactating mammary gland: role of Delta5 and Delta6 desaturases, SREBP-1, PPARα, and PGC-1. Journal of Lipid Research 47 553560.

    • Search Google Scholar
    • Export Citation
  • Schoonjans K, Martin G, Staels B & Auwerx J 1997 Peroxisome proliferator-activated receptors, orphans with ligands and functions. Current Opinion in Lipidology 8 159166.

    • Search Google Scholar
    • Export Citation
  • Smith MS & Grove KL 2002 Integration of the regulation of reproductive function and energy balance: lactation as a model. Frontiers in Neuroendocrinology 23 225256.

    • Search Google Scholar
    • Export Citation
  • Sülzle A, Hirche F & Eder K 2004 Thermally oxidized dietary fat upregulates the expression of target genes of PPARα in rat liver. Journal of Nutrition 134 13751383.

    • Search Google Scholar
    • Export Citation
  • The UFAW Handbook on the Care and Management of Laboratory Animals 1999 The definitive work on practical husbandry, breeding, laboratory procedures and disease control for a wide variety of vertebrates from marine fish to non-human primates, edn 7. Ed TB Poole. Blackwell Science.

  • Trayhurn P, Douglas JB & McGuckin MM 1982 Brown adipose tissue thermogenesis is suppressed during lactation in mice. Nature 298 5960.

  • Vidal-Puig A, Solanes G, Grujic D, Flier JS & Lowell BB 1997 UCP3: an uncoupling protein homologue expressed preferentially and abundantly in skeletal muscle and brown adipose tissue. Biochemical and Biophysical Research Communications 235 7982.

    • Search Google Scholar
    • Export Citation
  • Whitelaw E & Williamson DH 1977 Effects of ketogenesis from oleate or butyrate in rat hepatocytes. Biochemical Journal 164 521528.

  • Williamson DH 1986 Fuel supply to brown adipose tissue. Biochemical Society Transactions 14 225227.

  • Xiao XQ, Grove KL, Grayson BE & Smith MS 2004a Inhibition of uncoupling protein expression during lactation: role of leptin. Endocrinology 145 830838.

    • Search Google Scholar
    • Export Citation
  • Xiao XQ, Grove KL & Smith MS 2004b Metabolic adaptations in skeletal muscle during lactation: complementary deoxyribonucleic acid microarray and real-time polymerase chain reaction analysis of gene expression. Endocrinology 145 53445354.

    • Search Google Scholar
    • Export Citation
  • Young ME, Patil S, Ying J, Depre C, Ahuja HS, Shipley GL, Stepkowski SM, Davies PJ & Taegtmeyer H 2001 Uncoupling protein 3 transcription is regulated by peroxisome proliferator-activated receptor α in the adult rodent heart. FASEB Journal 15 833845.

    • Search Google Scholar
    • Export Citation
  • Yu S & Reddy JK 2007 Transcription coactivators for peroxisome proliferator-activated receptors. Biochimica et Biophysica Acta 1771 936951.

  • Zammit VA 1980 The effect of glucagons treatment and starvation of virgin and lactating rats on the rates of oxidation of octanoyl-l-carnitine and octanoate by isolated liver mitochondria. Biochemical Journal 190 293300.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 1025 153 9
PDF Downloads 340 78 15
  • View in gallery

    Relative mRNA concentrations of Pparα in the liver (A) and skeletal muscle (B) of wild-type mice, whose litters were either removed (without litter) or adjusted to 6 pups/dam (with litter) immediately after birth, at day 15 of lactation. Bars represent means±s.e.m. for n=5. *Indicates a significant difference from ‘without’ litter group. P<0.05.

  • View in gallery

    Relative mRNA concentrations of the Pparα target genes l-Cpt I, Cyp4a10, Fabppm, and Fatp in the liver of lactating wild-type and lactating Pparα knockout mice, whose litters were either removed (without litter) or adjusted to 6 pups/dam (with litter) immediately after birth, at day 15 of lactation. Bars represent means±s.e.m. for n=5 in wild-type mice and n=7 in Pparα knockout mice. Bars without a common letter (a–c) differ, P<0.05. Significant effects (P<0.05) from two-way ANOVA: l-Cpt I: litter, genotype, and litter×genotype; Cyp4a10: litter, genotype, and litter×genotype; Fabppm: litter, genotype, and litter×genotype; Fatp: litter, genotype, and litter×genotype.

  • View in gallery

    Relative mRNA concentrations of the Pparα target genes m-Cpt I, Mcad, Fabppm, Fatp, and Ucp3 in the skeletal muscle of lactating wild-type and lactating Pparα knockout mice, whose litters were either removed (without litter) or adjusted to 6 pups/dam (with litter) immediately after birth, at day 15 of lactation. Bars represent means±s.e.m. for n=5 in wild-type mice and n=7 in Pparα knockout mice. Bars without a common letter (a–c) differ, P<0.05. Significant effects (P<0.05) from two-way ANOVA: m-Cpt I: litter and litter×genotype; Mcad: litter and litter×genotype; Fatp: genotype and litter×genotype; Ucp3: litter and litter×genotype.

  • View in gallery

    Relative mRNA concentrations of Pgc1α and Pgc1β in liver (A) and skeletal muscle (B) of lactating wild-type and lactating Pparα knockout mice, whose litters were either removed (without litter) or adjusted to 6 pups/dam (with litter) immediately after birth, at day 15 of lactation. Bars represent means±s.e.m. for n=5 in wild-type mice and n=7 in Pparα knockout mice. Bars without a common letter (a–b) differ, P<0.05. Significant effects (P<0.05) from two-way ANOVA: Pgc1α liver: litter and litter×genotype; Pgc1β liver: litter, genotype and litter×genotype; Pgc1α skeletal muscle: litter and litter×genotype; Pgc1β skeletal muscle: litter and litter×genotype.

  • View in gallery

    Relative mRNA concentrations of Fat/Cd36, Fabppm, Fatp, Lpl, and Fas in the mammary gland of lactating wild-type and lactating Pparα knockout mice, whose litters were either removed (without litter) or adjusted to 6 pups/dam (with litter) immediately after birth, at day 15 of lactation. Bars represent means±s.e.m. for n=5 in wild-type mice and n=7 in Pparα knockout mice. Bars without a common letter (a–b) differ, P<0.05. Significant effects (P<0.05) from two-way ANOVA: Fat/Cd36: litter; Fabppm: litter and litter×genotype; Fatp: litter; Lpl: litter; Fas: litter.

  • View in gallery

    Working hypothesis: downregulation of Pparα and its coactivators leads to a reduced uptake of fatty acids into tissues with high rates of β-oxidation, such as liver, skeletal muscle, and heart, and to a reduced rate of β-oxidation in these tissues. downregulation of Ucps in brown adipose tissue (Ucp1 and Ucp3) and skeletal muscle (Ucp3) additionally diminishes thermogenesis and oxidation of fuels, which are spared for milk synthesis. As recently shown, hepatic enzymes of carnitine synthesis are concomitantly also reduced during lactation, which, in turn, leads to a reduced carnitine content in liver and skeletal muscle (Gutgesell et al. 2009). As carnitine is involved in β-oxidation by transferring fatty acids into the mitochondrion, inhibition of carnitine synthesis can be regarded also as a means to diminish fatty acid oxidation during lactation. On the other side, synthesis of fatty acids and TAG in the liver is enhanced during lactation, leading to an increased secretion of VLDL–TAG and an increased uptake of fatty acids from VLDL–TAG into the mammary gland due to the enhanced expression of Lpl (Farid et al. 1978, Grigor et al. 1982). Simultaneously, the uptake of NEFA derived mainly from lipolysis in white adipose tissue by fatty acid transporters into the mammary gland as well as de novo fatty acid synthesis catalyzed by lipogenic enzymes including Fas in the mammary gland is increased, which also enhances the pool of fatty acids in the mammary gland available for milk TAG production. CD36/Fat, CD36/fatty acid translocase; FA, fatty acid; Fabppm, plasma membrane-fatty acid-binding protein; Fas, fatty acid synthase; Fatp, fatty acid transport protein; Hsl, hormone-sensitive lipase; Lpl, lipoprotein lipase; NEFA, nonesterified fatty acids; Pgc1α/β, PPARγ co-activator 1α/β; Pparα, peroxisome proliferator-activated receptor α; TAG, triacylglycerols; Ucp1/3, uncoupling protein 1/3; VLDL, very low-density lipoprotein.

  • Barbera MJ, Schlüter A, Pedraza N, Iglesias R, Villaroya F & Giralt M 2000 Peroxisome proliferator-activated receptor α activates transcription of the brown fat uncoupling protein-1 gene. A link between regulation of thermogenic and lipid oxidation pathways in the brown fat cell. Journal of Biological Chemistry 276 14861493.

    • Search Google Scholar
    • Export Citation
  • Boss O, Samec S, Paoloni-Giacobino A, Rossier C, Dulloo A, Seydoux J, Muzzin P & Giacobino JP 1997 Uncoupling protein-3: a new member of the mitochondrial carrier family with tissue-specific expression. FEBS Letters 408 3942.

    • Search Google Scholar
    • Export Citation
  • Bruns S, Carmona MC, Mamperl T, Vinas O, Giralt M, Igleasias R & Villaroya F 1999 Activators of peroxisome proliferators-activated receptor α induce the expression of the uncoupling protein-3 gene in skeletal muscle: a potential for the lipid intake-dependent activation of uncoupling protein-3 gene expression at birth. Diabetes 48 12171222.

    • Search Google Scholar
    • Export Citation
  • Chao PM, Chao CY, Lin FJ & Huang CJ 2001 Oxidized frying oil up-regulates hepatic acyl-CoA oxidase and cytochrome P450 4A1 genes in rats and activates PPARα. Journal of Nutrition 131 31663174.

    • Search Google Scholar
    • Export Citation
  • Dewey KG 1997 Energy and protein requirements during lactation. Annual Review of Nutrition 17 1936.

  • Farid M, Baldwin RL, Yang YT, Osborne E & Grichting G 1978 Effects of age, diet and lactation on lipogenesis in rat adipose, liver and mammary tissues. Journal of Nutrition 108 514524.

    • Search Google Scholar
    • Export Citation
  • Feingold KR, Wang Y, Moser A, Shigenaga JK & Grunfeld C 2008 LPS decreases fatty acid oxidation and nuclear hormone receptors in the kidney. Journal of Lipid Research 49 21792187.

    • Search Google Scholar
    • Export Citation
  • Gimble JM, Pighetti GM, Lerner MR, Wu X, Lightfoot SA, Brackett DJ, Darcy K & Hollingsworth AB 1998 Expression of peroxisome proliferator activated receptor mRNA in normal and tumorigenic rodent mammary glands. Biochemical and Biophysical Research Communications 253 813817.

    • Search Google Scholar
    • Export Citation
  • Grigor MR, Geursen A, Sneyd MJ & Warren SM 1982 Regulation of lipogenic capacity in lactating rats. Biochemical Journal 208 611618.

  • Gutgesell A, Ringseis R, Brandsch C, Stangl GI, Hirche F & Eder K 2009 Peroxisome proliferator-activated receptor α and enzymes of carnitine biosynthesis in the liver are down-regulated during lactation in rats. Metabolism 58 226232.

    • Search Google Scholar
    • Export Citation
  • Jiang N, Zhang G, Bo H, Qu J, Ma G, Cao D, Wen L, Liu S, Ji LL & Zhang Y 2009 Upregulation of uncoupling protein-3 in skeletal muscle during exercise: a potential antioxidant function. Free Radical Biology and Medicine 46 138145.

    • Search Google Scholar
    • Export Citation
  • Leone TC, Weinheimer CJ & Kelly DP 1999 A critical role for the peroxisome proliferator-activated receptor α (PPARα) in the cellular fasting response: the PPARα-null mouse as a model of fatty acid oxidation disorders. PNAS 96 74737478.

    • Search Google Scholar
    • Export Citation
  • Mandard S, Müller M & Kersten S 2004 Peroxisome proliferator receptor α target genes. Cellular and Molecular Life Sciences 61 393416.

  • Muoio DM, MacLean PS, Lang DB, Li S, Houmard JA, Way JM, Winegar DA, Corton JC, Dohm GL & Kraus WE 2002 Fatty acid homeostasis and induction of lipid regulatory genes in skeletal muscles of peroxisome proliferator-activated receptor (PPAR) alpha knock-out mice. Evidence for compensatory regulation by PPAR delta. Journal of Biological Chemistry 277 2608926097.

    • Search Google Scholar
    • Export Citation
  • Murray AJ, Panagia M, Hauton D, Gibbons GF & Clarke K 2005 Plasma free fatty acids and peroxisome proliferator-activated receptor alpha in the control of myocardial uncoupling protein levels. Diabetes 54 349634502.

    • Search Google Scholar
    • Export Citation
  • Pedraza N, Solanes G, Carmona MC, Iglesias R, Vinas O, Mampel T, Vazquez M, Giralt M & Villarroya F 2000 Impaired expression of the uncoupling protein-3 gene in skeletal muscle during lactation: fibrates and troglitazone reverse lactation-induced downregulation of the uncoupling protein-3 gene. Diabetes 49 12241230.

    • Search Google Scholar
    • Export Citation
  • Pedraza N, Solanes G, Iglesias R, Vazquez M, Giralt M & Villarroya F 2001 Differential regulation of expression of genes encoding uncoupling proteins 2 and 3 in brown adipose tissue during lactation in mice. Biochemical Journal 355 105111.

    • Search Google Scholar
    • Export Citation
  • Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 e45.

  • Reeves PG, Nielsen FH & Fahey GC Jr 1993 AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. Journal of Nutrition 123 19391951.

    • Search Google Scholar
    • Export Citation
  • Ringseis R, Dathe C, Muschick A, Brandsch C & Eder K 2007a Oxidized fat reduces milk triacylglycerol concentrations by inhibiting gene expression of lipoprotein lipase and fatty acid transporters in the mammary gland of rats. Journal of Nutrition 137 20562061.

    • Search Google Scholar
    • Export Citation
  • Ringseis R, Muschick A & Eder K 2007b Dietary oxidized fat prevents ethanol-induced triacyglycerol accumulation and increases expression of PPARα target genes in rat liver. Journal of Nutrition 137 7783.

    • Search Google Scholar
    • Export Citation
  • Ringseis R, Pösel S, Hirche F & Eder K 2007c Treatment with pharmacological peroxisome proliferator-activated receptor α agonist clofibrate causes upregulation of organic cation transporter 2 in liver and small intestine of rats. Pharmacological Research 56 175183.

    • Search Google Scholar
    • Export Citation
  • Rodriguez-Cruz M, Tovar AR, Palacios-Gonzalez B, Del Prado M & Torres N 2006 Synthesis of long-chain polyunsaturated fatty acids in lactating mammary gland: role of Delta5 and Delta6 desaturases, SREBP-1, PPARα, and PGC-1. Journal of Lipid Research 47 553560.

    • Search Google Scholar
    • Export Citation
  • Schoonjans K, Martin G, Staels B & Auwerx J 1997 Peroxisome proliferator-activated receptors, orphans with ligands and functions. Current Opinion in Lipidology 8 159166.

    • Search Google Scholar
    • Export Citation
  • Smith MS & Grove KL 2002 Integration of the regulation of reproductive function and energy balance: lactation as a model. Frontiers in Neuroendocrinology 23 225256.

    • Search Google Scholar
    • Export Citation
  • Sülzle A, Hirche F & Eder K 2004 Thermally oxidized dietary fat upregulates the expression of target genes of PPARα in rat liver. Journal of Nutrition 134 13751383.

    • Search Google Scholar
    • Export Citation
  • The UFAW Handbook on the Care and Management of Laboratory Animals 1999 The definitive work on practical husbandry, breeding, laboratory procedures and disease control for a wide variety of vertebrates from marine fish to non-human primates, edn 7. Ed TB Poole. Blackwell Science.

  • Trayhurn P, Douglas JB & McGuckin MM 1982 Brown adipose tissue thermogenesis is suppressed during lactation in mice. Nature 298 5960.

  • Vidal-Puig A, Solanes G, Grujic D, Flier JS & Lowell BB 1997 UCP3: an uncoupling protein homologue expressed preferentially and abundantly in skeletal muscle and brown adipose tissue. Biochemical and Biophysical Research Communications 235 7982.

    • Search Google Scholar
    • Export Citation
  • Whitelaw E & Williamson DH 1977 Effects of ketogenesis from oleate or butyrate in rat hepatocytes. Biochemical Journal 164 521528.

  • Williamson DH 1986 Fuel supply to brown adipose tissue. Biochemical Society Transactions 14 225227.

  • Xiao XQ, Grove KL, Grayson BE & Smith MS 2004a Inhibition of uncoupling protein expression during lactation: role of leptin. Endocrinology 145 830838.

    • Search Google Scholar
    • Export Citation
  • Xiao XQ, Grove KL & Smith MS 2004b Metabolic adaptations in skeletal muscle during lactation: complementary deoxyribonucleic acid microarray and real-time polymerase chain reaction analysis of gene expression. Endocrinology 145 53445354.

    • Search Google Scholar
    • Export Citation
  • Young ME, Patil S, Ying J, Depre C, Ahuja HS, Shipley GL, Stepkowski SM, Davies PJ & Taegtmeyer H 2001 Uncoupling protein 3 transcription is regulated by peroxisome proliferator-activated receptor α in the adult rodent heart. FASEB Journal 15 833845.

    • Search Google Scholar
    • Export Citation
  • Yu S & Reddy JK 2007 Transcription coactivators for peroxisome proliferator-activated receptors. Biochimica et Biophysica Acta 1771 936951.

  • Zammit VA 1980 The effect of glucagons treatment and starvation of virgin and lactating rats on the rates of oxidation of octanoyl-l-carnitine and octanoate by isolated liver mitochondria. Biochemical Journal 190 293300.

    • Search Google Scholar
    • Export Citation