Abstract
Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors belonging to the nuclear hormone receptor superfamily that functions as critical regulators of lipid and energy homeostasis. Although intensively studied in mammals, their basic biological functions are still poorly understood. The objective of this work was to characterize PPARβ subtypes in a fish, the Atlantic salmon (Salmo salar), in order to address PPAR function and the regulation of lipid homeostasis in lower vertebrates. The screening of an Atlantic salmon genomic library revealed the presence of four genes for PPARβ subtypes. Based on comparisons of exons and exon-flanking regions, these genes were assigned into two families, ssPPARβ1 and ssPPARβ2, each family containing two isotypes: ssPPARβ1A and β1B and ssPPARβ2A and β2B. Two full-length cDNAs for ssPPARβ1A and ssPPPARβ2A were isolated. Transcripts for ssPPARβ1A and ssPPARβ2A have distinct tissue expression profiles, with ssPPARβ1A predominating in liver and ssPPARβ2A predominating in gill. Expression levels of mRNA of either isotypes were up to tenfold lower in kidney, heart, spleen, muscle, and brain. In cellular transfection assays, ssPPARβ1A is activated by monounsaturated fatty acids, 2-bromopalmitate, and mammalian PPARβ-specific ligand GW501516. In contrast, PPARβ2A was not activated by any of the compounds tested. Furthermore, ssPPARβ2A repressed both the basal reporter gene activity and the GW501516-induced activity of ssPPARβ1A. The results indicate unexpected levels of variety and complexity in PPAR subtype and mechanism of action in lower vertebrates.
Introduction
Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors that belong to the nuclear hormone receptor superfamily. Originally isolated from humans, rodents, and amphibians, they are now widely accepted to be critical regulators of lipid and energy homeostasis (Isseman & Green 1990, Krey et al. 1993, Desvergne & Wahli 1999, Hihi et al. 2002). In mammals, one gene for each of the three PPAR subtypes, PPARα, PPARβ (also known as PPARδ), and PPARγ, is present (Michalik & Wahli 1999). The role of PPARα is hypothesized to be primarily in controlling the reversible induction of β-oxidation in specific tissues, especially liver, as a response to changing energy requirements and nutritional status. The evidence for this comes most directly from rodents, where PPARα is expressed in cells with high catabolic rates of fatty acid oxidation, such as hepatocytes, cardiomyocytes, kidney proximal tubules, and intestinal mucosa (Escher et al. 2001). Indeed, PPARα-null mice are incapable of upregulating fatty acid oxidation during fasting (Kersten et al. 1999, Leone et al. 1999). In contrast, mammalian PPARγ is considered to play a critical role in fat accumulation, particularly in adipocytes and in lipid-accumulating macrophages (Rosen & Speigelman 2001). The role of PPARβ is less well understood. Various studies suggest that PPARβ has a role in the global control of lipid homeostasis in mammals. It is moderately activated by a range of unsaturated fatty acids (Forman et al. 1997) and has a broad tissue expression profile (Escher et al. 2001). PPARβ-null mice show reduced adipose stores (Peters et al. 2000), which cannot be explained by adipose-specific PPARβ deficiency (Barak et al. 2002, Wang et al. 2003). Furthermore, in the absence of the ligand, PPARβ can act as a repressor of PPARα and PPARγ action (Shi et al. 2002). Similarly, in the cell overexpression systems and in the absence of activating ligand, PPARβ can downregulate the genes involved in the lipid and energy metabolism (Tachibana et al. 2005). Recently, highly specific and potent synthetic ligands for mammalian PPARβ have been developed. Treatment of animals with these compounds has demonstrated that ligand-activated PPARβ directly controls lipid utilization through upregulation of genes involved in β-oxidation and energy uncoupling in various tissues (Dressel et al. 2003, Tanaka et al. 2003, Wang et al. 2003, Tachibana et al. 2005). In consequence, PPARβ ligands can have beneficial effects in correcting dyslipodemic states in various animal disease models. Thus, PPARβ ligands are now receiving considerable attention as potential pharmaceuticals for the treatment of a variety of human diseases associated with dyslipidemia (Desvergne et al. 2004).
In addition to functioning as a regulator of energy metabolism, PPARβ has also been shown to have significant roles in the control of cellular proliferation and differentiation. Studies on PPARβ-null mice have indicated the PPARβ functions in skin wound healing (Michalik et al. 2001), keratinocyte differentiation (Schmuth et al. 2002, Kim et al. 2006) in apoptosis (Di-Poi et al. 2002), and skin and colon carcinogenesis (Harman et al. 2004, Kim et al. 2004).
Despite these developments, bona fide endogenous ligands for PPARβ have still not been conclusively defined and the precise role of PPARβ in lipid and energy metabolism, and how this relates to PPARβ function in cellular differentiation and proliferation, is not yet understood. The study of PPARs in lower vertebrates such as fish offers an opportunity to compare expression, define common ligands, and infer common functions across vertebrates, thus informing studies on PPARs in humans. Recently, a study on two members of a major fish clade, the Perciformes, reported the identification and characterization of homologs of PPARα, β, and γ (Leaver et al. 2005). Comparison of these gene sequences with information from the pufferfish (Takifugu rubripides and Tetraodon nigroviridis, also Perciformes) genome-sequencing projects suggested that these fishes possessed a single PPARβ gene and that they shared many of the features of their mammalian counterpart. However, examination of the zebrafish genome database indicated that there are two PPARβ genes in this Cypriniform species. Consequently, the exact number of genes and/or the presence of distinct PPAR isoforms in fish are yet to be determined. Here, we show that multiple PPARβ genes are present in Atlantic salmon, a commercially important member of a third major fish clade, the Salmoniformes. Two of these gene products are demonstrated to differ in tissue expression profile and transactivation properties.
Materials and methods
Isolation of Atlantic salmon PPAR genes
An Atlantic salmon genomic DNA library was constructed in λFIXII (Stratagene, La Jolla, CA, USA) from DNA isolated from blood from a single individual. This library was screened with a 32P-labeled DNA probe corresponding to the ligand-binding domain (LBD) of plaice (Pleuronectes platessa) PPARβ (Leaver et al. 2005). Hybridizing clones were isolated, phage DNA purified, restriction digested, and subjected to Southern blot analysis using the plaice PPARβ probe. Hybridizing restriction fragments were then subcloned to plasmid vectors and sequenced using an ABI 477 autosequencer and BigDye sequencing reagents. Sequences were analyzed using Autoassembler software supplied by Applied Biosystems.
Isolation of Atlantic salmon PPARβ cDNAs
Full-length cDNAs were isolated from total salmon liver RNA using reverse transcription, PCR, and RACE (SMART RACE system, BD Clontech, Oxford, UK). Gene-specific primers (P1, P2, and P3; Fig. 1 and Table 1) were directed to the regions immediately adjacent to PPARβ termination codons predicted from genomic sequencing. These primers were combined in 5′-RACE PCRs with SMART liver cDNA and the SMART system universal primer. Further, RACE PCR was performed with primers synthesized to specific regions within the products arising from the first round of reactions. These primers (P4 and P5; Fig. 1 and Table 1) were used in nested PCR procedures. Finally, full-length open reading frames for salmon PPARβ cDNAs were obtained using both forward and reverse gene-specific primers (P1, P6, P7, and P8; Fig. 1 and Table 1), designed from consideration of the previously isolated RACE products. All products were ligated to Escherichia coli plasmid vectors and sequenced.
Tissue expression
Total RNA was isolated from tissues of three Atlantic salmon (average mass=200 g) using TriReagent (Sigma). For quantitative PCR (QPCR), 1 μg total RNA was converted to cDNA using a blend of poly-dT oligonucleotide primer (25 nM) and random hexamers (75 nM), and Reverse-iT reverse transcriptase (AMV/MMuLV blend; Abgene, Epsom, Surrey, UK). QPCRs of 20 μl contained 100 nM of each primer, cDNA from the equivalent of 25 ng total RNA for PPARβ reactions and from the equivalent of 0.25 ng RNA for 18S rRNA reactions. Amplicons were quantified using SYBR Green PCR mastermix (Abgene) and a Techne Quantica QPCR instrument. Cycling parameters consisted of a 15-min 95 °C soak to activate the polymerase, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Primers were directed to areas where the two cDNAs exhibited low nucleotide identity, either side of the junction corresponding to the first exon of the LBD of each PPAR. For ssPPARβ1A, these were 5′-GACCACCAACCC-CAATGGCTCGGAT and 5′-CAGCCCATTCTCAGCCT-GGCACAAG, and for ssPPARβ2A, 5′-CCCCCACCATCT TGGTGGCTCAGA and 5′-TAGACCACTCTCTGCTTG-CCACAGG. The PCR products produced from these primers under QPCR conditions were checked by gel electrophoresis and sequencing before undertaking QPCR. In each case, only the predicted products of 176 and 190 bp for ssPPARβ1A and ssPPARβ2A respectively, were amplified. Values for PPARβ were normalized to 18S rRNA levels measured with primers 5′-CTGCCCTATCAACTTTCGATGGTACT and 5′-AA-AGTGTACTCATTCCAATTACGGGG.
Cell transfection experiments
Salmon PPARβ cDNAs were ligated to pcDNA3 and used to transfect AS (derived from Atlantic salmon, epitheloid; Nicholson & Byrne 1973) cells with pCMVβgal and a reporter construct containing a PPRE from the mouse cyp4A6 promoter (Ijpenberg et al. 1997) linked to a chloramphenicol acetyltransferase (CAT) gene. AS cells were routinely grown and passaged in Dulbecco’s modified Eagle’s medium (DMEM), 10% fetal bovine serum (FBS). Prior to transfection, cells were passaged into DMEM, plus charcoal/dextran-stripped 10% FBS (Pierce, Rockford, IL, USA). Total plasmid DNA (1.5 μg) was transfected to each well of 12-well tissue culture plates using 7.5 μl Superfect reagent according to the manufacturer’s instructions (Qiagen). Twenty-four hours after transfection, cells were treated with fatty acids (100 μM; Sigma), Wy16463 (50 μM), rosiglitazone, GW501516 (10 μM; Alexis Corporation, Nottingham, UK), and L165041 (10 μM; Calbiochem, Nottingham, UK) in 5 μl ethanol. Cells were harvested 24 h after treatment, lysed in 300 μl detergent-based buffer, and CAT protein was measured using an ELISA method (Roche). β-Galactosidase activity was measured in a microtitre plate-based assay. Briefly, 20 μl cell lysate was incubated with 130 μl PBS containing 5 mM MgCl2, 10 mM β-mercaptoethanol, and 1.5 mM o-nitrophenyl-β-galactoside (ONPG). After 30 min, the reaction was stopped by the addition of 75 μl of 1 M Na2CO3 and the A420 measured. CAT quantity was normalized to β-galactosidase activity and, after subtracting mock-transfected blank values, values for each treatment were expressed relative to the ethanol control for pcDNA3 (empty vector). All treatments were performed in triplicate.
Results
Atlantic salmon possesses four distinct PPARβ genes
The salmon genomic library was screened with a probe corresponding to the LBD of a plaice PPARβ (Leaver et al. 2005), and a total of nine distinct phage inserts were found to contain PPARβ-related sequences. Assembly of the sequences from these nine inserts produced four distinct clone sets, each comprised overlapping genomic fragments. Comparisons of exon sequences corresponding to the LBD of PPARβ suggested that they contained distinct sequences. Based on the genomic sequence information, oligonu-cleotide primers were designed to be specific for each PPARβ sequence. Initially, primers were directed to the regions adjacent to the termination codons of each of the three gene sequences (L1, L29, and L92 clone sets; Fig. 1). For the L1 clone set, a single cDNA was isolated (designated as ssPPARβ1A), which was found to contain a full-length open reading frame for PPARβ. For L92, a partial cDNA was obtained, containing only the coding region corresponding to the LBD of PPARβ. This cDNA was distinct from ssPPARβ1A. No PPARβ cDNAs were obtained for the L29 clone set (designated as ssPPARβ1B). Using the partial cDNA sequence derived from the L92 clone set, two more oligonucleotides were designed to areas within the region corresponding to the LBD. These were used in a nested 5′-RACE procedure and two distinct cDNAs were obtained. One of these cDNAs contained an open reading frame for a PPARβ isoform distinct from both ssPPARβ1A and the partial L92 cDNA, and was designated ssPPARβ2A (corresponding to the L6 clone set). The other cDNA corresponded, with 100% nucleotide identity in the overlapping region, to the previously isolated partial L92 cDNA. This cDNA contained an open reading frame, which lacked a DNA-binding domain but possessed an intact A/B domain and LBD, and together with the gene in the L92 clone set was designated ssPPARβ2B. The gene and cDNA sequences corresponding to the exons encoding the LBD of each of the presumed PPARβ genes were aligned, together with exon-flanking regions (Fig. 2). The percentage identity matrices for these alignments showed that one of the cDNA sequences (ssPPARβ1A) was identical to the gene present in the L1 clone set. The other full-length cDNA (ssPPARβ2A) showed between 98 and 100% identity to clone set L6, whilst the atypical ssPPARβ2B cDNA showed between 99 and 100% identity to the L92 clone set. Further attempts were made to isolate a cDNA (ssPPARβ1B) corresponding to the L29 genomic sequence from gill, kidney, and muscle cDNA, but were unsuccessful. It should be noted that the materials for the construction of genomic and cDNA libraries were derived from different individuals; thus, the small differences observed between these cDNAs and genes are most likely the result of allelic variation within salmon populations. In addition, apparent from the identity matrices, the clone sets fall into two groups of two genes each, with about 80% identity between the members from different groups. Exon-flanking sequences from the genes were compared to determine whether the four genes were from distinct loci, or were allelic variants from two loci. From Fig. 2, it is apparent that, although there is some similarity in the exon-flanking regions between L29 and L1, and between L6 and L92 clone sets, there is a lower level of identity than might be expected of allelic variants. This indicates that there are at least four distinct PPARβ genes in salmon.
Atlantic salmon PPARβ phylogeny
Comparison of the deduced amino acid sequences of the full-length ssPPARβ1A and ssPPARβ2A cDNAs clearly demonstrated that both salmon PPARs phylo-genetically clustered with PPARβ subtypes from diverse vertebrates (Fig. 3). The salmon PPARs were most closely related to PPARs from other fish species. However, it is notable that, within the PPARβ phylogeny, the two zebrafish PPARβ isoforms do not resolve on the same branches as the salmon isoforms, and in any case their positions in the phylogeny are not well supported by bootstrap values. Most amino acid identity between the salmon isoforms and PPARβ from other vertebrates was evident in the DNA- and ligand-binding regions, although there were also areas of cross-species identity in both the AB- and D-domains (Fig. 4). In both ssPPARβ1A and ssPPARβ2A, the amino acid residues that interact with fatty acid ligand and co-activator proteins are conserved (Nolte et al. 1998, Xu et al. 1999, Fyffe et al. 2006, Fig. 4).
Differential tissue expression of salmon PPARβ genes
QPCR analysis of salmon PPARβ expression across a range of tissues indicated that there were differences in relative expression levels (Fig. 5). ssPPARβ1A was most highly expressed in liver and adipose, whilst ssPPARβ2A was most highly expressed in gill and adipose. The levels of ssPPARβ1A exceeded those of ssPPARβ2A in liver. In gill, ssPPARβ2A was the predominant isoform and both were expressed equally in adipose. The expression levels in other tissues were three- to fivefold lower than in liver, gill, and adipose, and there were no differences between the expression level of ssPPARβ1A and ssPPARβ2A.
Differential transactivation of salmon PPARβ subtypes
In cellular transfection assays (Fig. 6), there was a relatively small but significant activation of ssPPARβ1A by palmitoleic acid. In contrast, there was no apparent effect of oleic, linolenic, arachidonic, eicosapentenoic, or docosahexaenoic acids. There was a much greater response to the mammalian PPARβ-specific ligand GW501516 and bromopalmitate. However, L165041, another mammalian PPARβ-selective ligand, was not an effective activator of salmon ssPPARβ1A. Note that all compounds that resulted in the activation of ssPPARβ1A also induced the basal activity of the reporter construct, suggesting the presence of endogenous ssPPARβ1A. Indeed, QPCR indicated that ssPPARβ1A was present (not shown) in the AS cell line although at lower levels per unit input RNA than any of the salmon tissues tested. This may indicate that fatty acids are effective activators of ssPPARβ1A, since they all induced reporter gene activity significantly above that induced by the vehicle ethanol. Transfection of the ssPPARβ2A significantly reduced the basal level of transcription from the reporter construct with all tested compounds (Fig. 6), suggesting repression of endogenous ssPPARβ1A activity in the AS cell line. To test this, AS cells were transfected with both ssPPARβA1 and ssPPARβ2A, and reporter gene activation measured after GW501516 treatment. The results confirmed (Fig. 7) that ssPPARβ2A repressed both the basal and the GW501516-induced activity of ssPPARβ1A, as well as the endogenous basal and induced activity.
Discussion
Atlantic salmon are both a declining wild species with a complex and characteristic life cycle and a commercially valuable farmed species. The management of both wild and farmed stocks is as rich in social, economic, and political issues as its resource base is rich biologically. However, a particular biological problem which concerns both the survival of wild fish and the quality of farmed fish is related to the control of energy and, particularly, lipid homeostasis. PPARs are now known to be critical regulators of these processes. The study presented here is the first report of the functional characterization of PPAR subtypes from a salmonid species, the Atlantic salmon. Phylogenetic analysis shows that all the four genes described here belong to the PPARβ subfamily. In mammals, where PPARs have been studied most intensively, a single gene encodes for PPARβ, and studies in other fish species have identified varying numbers of PPARβ subtypes. BLAST searches of near complete genome sequences for the pufferfishes, Takifugu rubripes and Tetraodon nigroviridis, reveal the presence of only one PPARβ gene. Similarly, in plaice and sea bream, it has previously been reported that only one PPARβ gene is detectable (Leaver et al. 2005). This compares with the situation in zebrafish, where, from genomic sequence and published information, there is clear evidence of two PPARβ isoforms (Robinson-Rechavi et al. 2001, Leaver et al. 2005). Of the four Atlantic salmon sequences identified here, at least two appear to be functional genes for PPARβ (termed here ssPPARβ1A and ssPPARβ2A), as shown by the identification of corresponding cDNAs containing complete coding sequence. It is not clear whether our failure to isolate fully resolved cDNAs for the other two gene sequences is because these are not functional genes or because they are not expressed. It is nevertheless important to note that for one of the other genes (ssPPARβ2B), we were able to isolate a cDNA with an open reading frame containing an AB-domain, a D-domain, and a ligand-binding domain, but lacking a DNA-binding domain. It is not yet clear whether this represents an aberrantly or partially processed mRNA or codes for an atypical but functional PPARβ subtype. For the other gene (ssPPARβ1B), through sequence homology, we could identify six out of seven coding exons on a single lambda genomic clone (not shown; Accession numbers AM229298 and AM229299). The first coding exon of ssPPARβ1B could not be definitively established because of the uncertainty in predicting this less conserved region of the gene by homology. Nevertheless, it is likely that this gene also encodes a functional PPAR. Attempts to isolate a cDNA for this gene from a variety of tissues were not successful, suggesting that it is either not expressed or is expressed in a tissue or developmentally restricted manner.
The presence of four PPARβ genes in salmonids is most probably a result of a relatively recent polyploidization event (60–90 million years), which is clearly evident in the evolution of salmonids (Allendorf & Thorgaard 1984). Moreover, more ancient polyploidization events have been proposed as a driving force for the evolution of the vertebrate lineage (Ohno 1970). One of these has been proposed to have occurred in the early evolution of ray-finned fishes (Taylor et al. 2003) and recent comparative syntenic analyses of zebrafish and pufferfish genomes (Woods et al. 2005) have supported this event and inferred subsequent lineage-specific duplications or losses to account for the differences in gene numbers between these species. The four PPARβ genes in Atlantic salmon clearly group into two subfamilies most likely representing the polyploidization-dependent duplication of two PPARβ subtypes from an ancestral diploid salmonid, these two genes arising from the more ancient ray-finned fish event. The phylogenetic analysis suggests that these two salmon subfamilies are not orthologous to the two PPARβ subtypes in zebrafish, although it should be noted that the zebrafish sequences are not placed in the tree with high confidence and a definitive conclusion must await functional characterization of the zebrafish PPARβ subtypes.
From an evolutionary perspective, a key question surrounding the process of polyploidizaton is how an individual with a polyploid genome would gain a selective advantage in a population and thence give rise to a new polyploid species. For such polyploidized individuals to reproduce successfully, they are required to undergo a process of diploidization concurrent with functional divergence of duplicated loci to obtain a selective advantage over their diploid relatives (Wolfe 2001). The genetic divergence of PPARβ subtypes in salmon may be an example of the outcome of this diploidization process, and as such these genes would be expected to exhibit functional divergence. Indeed, our results indicate that ssPPARβ1A or ssPPARβ2A are differentially expressed and exhibit distinct activation characteristics. Levels of ssPPARβ1A predominate in liver and ssPPARβ2A predominate in gill and the differential expression of salmon PPARβ isoforms has functional significance when the cellular transfection results are considered. It would appear that ssPPARβ1A is similar in ligand-activation profile to PPARβ from other species (Forman et al. 1997, Oliver et al. 2001, Leaver et al. 2005) being responsive to palmitoleic and oleic acids and to 2-bromopalmitate. Importantly, it is highly activated by the mammalian PPARβ-selective ligand GW501516, but not activated by the PPARα-specific ligand WY146463. The response to GW501516 suggests that, as with PPARβ in mammals, this compound is a ligand for ssPPARβ1A. The identification of highly selective and potent ligands for fish PPARs is a necessary step in advancing understanding in this area and further studies are required to test whether GW501516 will be as selective and potent in salmon as it is in mammals. On the other hand, the lack of response of ssPPARβ2A to fatty acids or PPARβ-selective ligands is intriguing. Consideration of the LBD of ssPPARβ2A suggests that this may be because there are critical differences between the sequence of this isoform and the sequences of mammalian or other characterized fish PPARβ homologs. A number of amino acid residues are not conserved in the ssPPARβ2A subtype (Fig. 4), which may change the characteristics of the LBD. However, none of these substitutions are at positions shown to be involved in either fatty acid ligand binding (Xu et al. 1999, Fyffe et al. 2006) or co-activator binding to human PPAR (Nolte et al. 1998), suggesting that ssPPARβ2A may be capable of binding and being activated by as yet undiscovered ligands. It is possible that, if the two salmon subtypes have conserved functions and binding specificity, the true endogenous ligand for vertebrate PPARβ may not be fatty acids, but might in future be identified as a compound which activates both ssPPARβ1A and ssPPARβ2A. Alternatively, the nonconserved substitutions or other characteristics of ssPPARβ2A may prohibit ligand activation under any circumstances and its sole function may be to repress the activity of other PPARs. Mammalian PPARβ has been shown to repress the activity of the other PPAR subtypes by competing for binding to PPREs (Shi et al. 2002). In this respect, the repressive ability of ssPPARβ2A in both basal and GW501516-induced transcriptional activity is significant. The high levels of expression of ssPPARβ2A in gill, in combination with its repressive activity, may have specific implications for the action of other PPAR subtypes in this tissue. As the fish gill is in close contact with the external environment, a single layer of epithelial cells separating the blood from the water, it is possible that in this tissue ssPPARβ2A functions to repress the activity of other PPARs in order to prevent their un-programmed activation by exogenous compounds or contaminants. Thus, Atlantic salmon may have evolved novel PPARβ-dependent processes. In this regard, it is important to note that other salmonids, such as rainbow trout and brown trout (Onchorhyncus mykiss and Salmo trutta), are also poly-ploid and would thus contain homologs of the four salmon PPARβ genes. Previous studies (Batisto-Pinto et al. 2005, Lui et al. 2005) of tissue expression profiles and PPAR-agonist responses in these species have considered only a single PPARβ subtype identified from partial cDNA sequences. In future, and in the light of these results from salmon, such studies should be conducted with the expectation of the presence of multiple PPAR subtypes with divergent function in trout and other salmonids.
In conclusion, these studies demonstrate the possibility for unexpected levels of variety in PPARβ subtype and mechanism of action in Atlantic salmon, showing that further complexity in physiological control may result from functional divergence of duplicated nuclear receptor genes. Further studies are required to understand the role of these important regulators of lipid homeostasis in life cycle and evolutionary adaptation in salmonids and to determine common PPAR-dependent processes across all vertebrates.
Oligonucleotide primers used for Atlantic salmon PPARβ cDNA isolation
| Oligonucleotide 5′ to 3′ | |
|---|---|
| Primer | |
| P1 | TAAACCAGTCCAGTCAGTACATGTCC |
| P2 | CAGTCAGTACATGTCCTTATAGATC |
| P3 | TTCCAGTCAGTACAGATTTAGTCCGGT |
| P4 | CTTGGGGAAGACATAGAGGGAGTCCTG |
| P5 | TCGTTAAGGAAGAGATCCACAAACCCT |
| P6 | CAGGATCCATGGGTAGCCAACAGAATGGAGAGATTG |
| P7 | AAGGTACCAGTCAGTACATGTCCTTATAGATCTCCT |
| P8 | CTTGGATCCTGGGACATGAAG |
Schematic representation of Atlantic salmon PPARβ genes and cDNAs. L1, L29, L6, and L92 are overlapping phage insert sets and the exons present are indicated as open boxes. ssPPARβ1A, β2A, and β2B are the cDNAs isolated using the primers P1–P8 (see text), with the open reading frames indicated by open boxes. The ssPPARβ1B cDNA corresponding to insert set L29 was not isolated. The diagram is not to scale.
Citation: Journal of Molecular Endocrinology 38, 3; 10.1677/JME-06-0043
Identity matrices and exon-flanking regions of Atlantic salmon PPARβ genes and cDNAs comprising the region corresponding to the ligand-binding domain. Numbers indicate the percentage identity between pairs of sequences. L1, L6, L29, and L92 are the gene sequences (boxed). The flanking exon sequences are shown with the AG/GT splice junctions and TGA termination codons underlined. β1A, β2A, and β2B are the ssPPARβ cDNA sequences.
Citation: Journal of Molecular Endocrinology 38, 3; 10.1677/JME-06-0043
Phylogenetic tree for the ligand-binding domain (LBD) of PPARs from diverse species. The deduced amino acid sequences corresponding to the LBD of the PPAR isotypes from plaice (pp), Atlantic salmon (ss), human (hs), and zebrafish (dr) were aligned using ClustalW and the resulting data used to construct an unrooted tree using Bayesian inference (MrBayes 3; Ronquist & Huelsenbeck 2005). The tree was plotted with NJplot. Confidence values of branch topologies are indicated.
Citation: Journal of Molecular Endocrinology 38, 3; 10.1677/JME-06-0043
Comparison of PPARβ from Atlantic salmon, plaice, and human. Alignment was generated with ClustalW, and identical residues present in three or more of the four sequences are shaded. The functional domains of the proteins are indicated by shaded or unshaded labeled boxes below the sequence line. The positions of residues which are not conserved in ssPPARβ2A are highlighted. Residues involved in human PPARβ ligand binding are boxed and shaded. Residues involved in human PPAR co-activator binding are boxed and unshaded.
Citation: Journal of Molecular Endocrinology 38, 3; 10.1677/JME-06-0043
Tissue expression profile of Atlantic salmon PPARβ isotypes. Results of QPCR assays as described in text. Data represent the mean±s.d. from three individual salmon. PPARβ was normalized to 18S RNA. Both genes were quantified by comparison with a standard curve of linearized plasmid containing the corresponding insert cDNA. Asterisks indicate tissues in which one of the PPAR subtypes significantly (P < 0.05; t-test) differs from the other.
Citation: Journal of Molecular Endocrinology 38, 3; 10.1677/JME-06-0043
Transactivation of Atlantic salmon PPARβ. AS cells were transfected with the expression vector pcDNA3, alone (cDNA3) or containing the coding sequences for the two Atlantic salmon PPARs, a CAT reporter construct containing the Cyp4A6-Z PPRE and a β-galactosidase expression plasmid. Cells were treated with 100 μM palmitoleic acid (16=1), oleic acid (18=1), linolenic acid (18=3), arachidonic acid (20=4), eicosapentenoic acid (20=5), docosahexaenoic acid (22=6), 50 μM 2-bromopalmitate (BR16). 50 μM Wy-14,643 (WY), 10 μM L165041 (L), 10 μM GW501516 (GW), and 10 μM rosiglitazone (ROS) or the vehicle ethanol (EtOH). Results are expressed as the fold increase in CAT (after subtraction of mock-transfected background and normalization to β-galactosidase) with respect to the ethanol control values for empty vector (pcDNA3). Figures represent a single experiment out of two repetitions and all treatments were in triplicate. Error bars correspond to mean±s.d.
Citation: Journal of Molecular Endocrinology 38, 3; 10.1677/JME-06-0043
ssPPARβ2A represses the activity of ssPPARβ1A. AS cells were transfected with cDNA3 (no PPAR) alone, or in combination with ssPPARβ1A and/or ssPPARβ2A. Cells were treated with GW501516 or with the vehicle, ethanol, as indicated. Results are expressed as arbitrary units of normalized CAT activity. Figures represent a single experiment out of two repetitions and all treatments were in triplicate. Error bars correspond to mean±s.d.
Citation: Journal of Molecular Endocrinology 38, 3; 10.1677/JME-06-0043
This work was supported by a European Union research grant Q5RS-CT-2000-30360 and by the BBSRC, UK. Stephanie Fontagne was funded as a traveling fellow by the French Government. The sequences referred to have been deposited in the EMBL/NCBI databases under Accession numbers AM229297–AM229306. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.
Footnotes
(M Tariq Ezaz is now at Research School of Biological Sciences, Australian National University, Canberra, Australian Capital Territory 0200, Australia) (S Fontagne is now at INRA, 64310 Saint-Pee sur Nivelle, France)
References
Allendorf FW & Thorgaard GH 1984 Tetraploidy and the evolution of salmonid fishes. In Evolutionary Genetics of Salmonid Fishes, pp 1–53. Ed BJ Turner. New York: Plenum Press.
Barak Y, Liao D, He WM, Ong ES, Nelson MC, Olefsky JM, Boland R & Evans RM 2002 Effects of peroxisome proliferator-activated receptor delta on placentation, adiposity, and colorectal cancer. PNAS 99 303–308.
Batisto-Pinto C, Rodrigues P, Rocha E & Lobo-da-Cunha A 2005 Identification and organ expression of peroxisome proliferator activated receptors in brown trout (Salmo trutta f. fario). Biochimica et Biophysica Acta 1731 88–94.
Desvergne B & Wahli W 1999 Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocrine Reviews 20 649–688.
Desvergne B, Michalik L & Wahli W 2004 Be fit or be sick: peroxisome proliferator-activated receptors are down the road. Molecular Endocrinology 18 1321–1322.
Di-Poi N, Tan NS, Michalik L, Wahli W & Desvergne B 2002 Antiapoptotic role of PPARb in keratinocytes via transcriptional control of the Akt1 signaling pathway. Molecular Cell 10 721–733.
Dressel U, Allen TL, Pippal JB, Rohde PR, Lau P & Muscat GE 2003 The peroxisome proliferator-activated receptor β/agonist, GW501516, regulates the expression of genes involved in lipid catabolism and energy uncoupling in skeletal muscle cells. Molecular Endocrinology 17 2477–2493.
Escher P, Braissant O, Basu-Modak S, Michalik L, Wahli W & Desvergne B 2001 Rat PPARs; quantitative analysis in adult rat tissues and regulation in fasting and refeeding. Endocrinology 142 4195–4202.
Forman BM, Chen J & Evans RM 1997 Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated receptors α and δ. PNAS 94 4312–4317.
Fyffe SA, Alphey MS, Buetow L, Smith TK, Ferguson MAJ, Sorenson MD, Bjorkling F & Hunter WN 2006 Recombinant human PPAR-β/δ ligand-binding domain is locked in an activated conformation by endogenous fatty acids. Journal of Molecular Biology 356 1005–1013.
Harman FS, Nicol CJ, Marin HE, Ward JM, Gonzalez FJ & Peters JM 2004 Peroxisome proliferator-activated receptor-delta attenuates colon carcinogenesis. Natural Medicine 10 481–483.
Hihi AK, Michalik L & Wahli W 2002 PPARs: transcriptional effectors of fatty acids and their derivatives. Cellular and Molecular Life Sciences 59 790–798.
Ijpenberg A, Jeannin E, Wahli W & Desvergne B 1997 Polarity and specific sequence requirements of peroxisome proliferator-activated receptor (PPAR)/retinoid X receptor (RXR) heterodimer binding to DNA. A functional analysis of the malic enzyme gene PPAR response element. Journal of Biological Chemistry 274 15901–20117.
Isseman I & Green S 1990 Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature 347 645–650.
Kersten S, Seydoux J, Peters JM, Gonzalez FJ, Desvergne B & Wahli W 1999 Peroxisome proliferator-activated receptor α mediates the adaptive response to fasting. Journal of Clinical Investigation 103 1489–1498.
Kim DJ, Akiyama TE, Harman FS, Burns AM, Shan W, Ward JM, Kennett MJ, Gonzalez FJ & Peters JM 2004 Peroxisome proliferator-activated receptor beta (delta)-dependent regulation of ubiquitin C expression contributes to attenuation of skin carcinogenesis. Journal of Biological Chemistry 279 23719–23727.
Kim DJ, Bility MT, Billin AN, Willson TM, Gonzalez FJ & Peters JM 2006 PPARβ/δ selectivity induces differentiation and inhibits cell proliferation. Cell Death and Differentiation 13 53–60.
Krey G, Keller H, Mahfoudi A, Medin J, Ozato K, Dreyer C & Wahli W 1993 Xenopus peroxisome proliferator activated receptors: genomic organisation, response element recognition, heterodimer formation with retinoid X receptor and activation by fatty acids. Journal of Steroid Biochemistry and Molecular Biology 47 65–73.
Leaver MJ, Boukouvala E, Antonopoulou E, Diez A, Favre-Krey L, Ezaz MT, Bautista JM, Tocher DR & Krey G 2005 Three peroxisomal proliferator-activated receptor (PPAR) isotypes from each of two species of marine fish. Endocrinology 146 3150–3162.
Leone TC, Weinheimer CJ & Kelly DP 1999 A critical role for the peroxisome proliferators-activated receptor α (PPARα) in the cellular fasting response: the PPARα-null mouse as a model of fatty acid oxidation disorders. PNAS 96 7473–7478.
Lui GL, Moon TW, Metcalfe CD, Lee LEJ & Trudeau VL 2005 A teleost in vitro reporter gene assay to screen for agonists of the peroxisome proliferators-activated receptors. Environmental Toxicology and Chemistry 24 2260–2266.
Michalik M & Wahli W 1999 Peroxisomal proliferator-activated receptors: three isotypes for a multitude of functions. Current Opinion in Biotechnology 10 564–570.
Michalik L, Desvergne B, Tan NS, Basu-Modak S, Escher P, Rieusset J, Peters JM, Kaya G, Gonzalez FJ, Zakany J et al.2001 Impaired skin wound healing in peroxisome proliferator-activated receptor (PPAR)alpha and PPARbeta mutant mice. Journal of Cell Biology 154 799–814.
Nicholson BL & Byrne C 1973 An established cell line from Atlantic salmon (Salmo salar). Journal of the Fisheries Research Board of Canada 30 916–923.
Nolte RT, Wisely GB, Westin S, Cobb JE, Lambert MH, Kurokawa R, Rosenfeld MG, Willson TM, Glass CK & Millburn MV 1998 Ligand binding and co-activator assembly of the peroxisome proliferator-activated receptor-gamma. Nature 395 137–143.
Ohno S 1970. Evolution by Gene Duplication. London: George Allen and Unwin.
Oliver WR Jr, Snaith MR, Russell CS, Plunket KD, Bodkin NL, Lewis MC, Winegar DA, Sznaidman ML, Lambert MH, Xu HE et al.2001 A selective peroxisome proliferator-activated receptor δ agonist promotes reverse cholesterol transport. PNAS 98 5306–5311.
Peters JM, Lee SS, Li W, Ward JM, Gavrilova O, Everett C, Reitman ML, Hudson LD & Gonzalez FJ 2000 Growth, adipose, brain and skin alterations resulting from targeted disruption of the mouse peroxisome proliferator-activated receptor β(δ). Molecular and Cellular Biology 20 5119–5128.
Robinson-Rechavi M, Marchand O, Escriva H, Bardet PL, Zelus D, Hughes S & Laudet V 2001 Euteleost fish genomes are characterised by expansion of gene families. Genome Research 11 781–788.
Ronquist F & Huelsenbeck JP 2005 MrBayes 3: Bayesian phylogeny inference under mixed models. Bioinformatics 19 1572–1584.
Rosen ED & Spiegelman BM 2001 PPARγ: a nuclear regulator of metabolism, differentiation, and growth. Journal of Biological Chemistry 276 37731–37734.
Schmuth M, Haqq CM, Cairns WJ, Holder JC, Dorsam S, Chang S, Lau P, Fowler AJ, Chuang G, Moser AH et al.2004 Peroxisome proliferator-activated receptor (PPAR)-β/δ stimulates differentiation and lipid accumulation an keratinocytes. Journal of Investigative Dermatology 122 971–983.
Shi Y, Hon M & Evans RM 2002 The peroxisome proliferator-activated receptor delta, an integer of transcriptional repression & nuclear receptor signaling. PNAS 99 2613–2618.
Tachibana K, Kobayashi Y, Tanaka T, Tagami M, Sugiyama A, Katayama T, Ueda C, Yamasaki D, Ishimoto K, Sumitomo M et al.2005 Gene expression profiling of potential peroxisome proliferator-activated receptor (PPAR) target genes in human hepatoblastoma cell lines inducibly expressing different PPAR isoforms. Nuclear Receptor 3 3.
Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K et al.2003 Activation of peroxisome proliferator-activated receptor δ induces fatty acid β-oxidation in skeletal muscle and attenuates metabolic syndrome. PNAS 100 15924–15929.
Taylor JS, Braasch I, Frickey T, Meyer A & Van de Peer Y 2003 Genome duplication: a trait shared by 22,000 species of ray-finned fish. Genome Research 13 382–390.
Wang YX, Lee CH, Tiep S, Yu RT, Ham J, Kang H & Evans RM 2003 Peroxisome-proliferator-activated receptor delta activates fat metabolism to prevent obesity. Cell 113 159–170.
Wolfe KH 2001 Yesterday’s polyploids and the mystery of diploidization. Nature Reviews 2 333–341.
Woods IG, Wilson C, Friedlander B, Chang P, Reyes DK, Nix R, Kelly PD, Chu F, Postlethwait JH & Talbot WS 2005 The zebrafish map defines ancestral vertebrate chromosomes. Genome Research 15 1307–1314.
Xu HE, Lambert MH, Montana VG, Parks DJ, Blanchard SG & Brown PJ 1999 Molecular recognition of fatty acids by peroxisome proliferators-activated receptors. Molecular Cell 3 397–403.
