Glucose-induced repression of PPARα gene expression in pancreatic β-cells involves PP2A activation and AMPK inactivation

in Journal of Molecular Endocrinology
View More View Less
  • 1 Department of Biochemistry and Molecular Biology, University of Southern Denmark, Campusvej 55, 5230 Odense M, Denmark
  • 2 1Department of Medical Biochemistry and Genetics, University of Copenhagen, 2200 Copenhagen N, Denmark.

Tight regulation of fatty acid metabolism in pancreatic β-cells is important for β-cell viability and function. Chronic exposure to elevated concentrations of fatty acid is associated with β-cell lipotoxicity. Glucose is known to repress fatty acid oxidation and hence to augment the toxicity of fatty acids. The peroxisome proliferator activated receptor α (PPARα) is a key activator of genes involved in β-cell fatty acid oxidation, and transcription of the PPARα gene has been shown to be repressed by increasing concentrations of glucose in β-cells. However, the mechanism underlying this transcriptional repression by glucose remains unclear. Here we report that glucose-induced repression of PPARα gene expression in INS-1E cells is independent of β-cell excitation and insulin secretion but requires activation of protein phosphatase 2A in a process involving inactivation of the AMP-activated protein kinase (AMPK). Pharmacological activation of AMPK at high glucose concentrations interferes with glucose repression of PPARα and PPARα target genes in INS-1E cells as well as in rat islets. Specific knock-down of the catalytic AMPK-subunit AMPKα2 but not AMPKα1 using RNAi suppressed PPARα expression, thereby mimicking the effect of glucose. These results indicate that activation of protein phosphatase 2A and subsequent inactivation of AMPK is necessary for glucose repression of PPARα expression in pancreatic β-cells.

Abstract

Tight regulation of fatty acid metabolism in pancreatic β-cells is important for β-cell viability and function. Chronic exposure to elevated concentrations of fatty acid is associated with β-cell lipotoxicity. Glucose is known to repress fatty acid oxidation and hence to augment the toxicity of fatty acids. The peroxisome proliferator activated receptor α (PPARα) is a key activator of genes involved in β-cell fatty acid oxidation, and transcription of the PPARα gene has been shown to be repressed by increasing concentrations of glucose in β-cells. However, the mechanism underlying this transcriptional repression by glucose remains unclear. Here we report that glucose-induced repression of PPARα gene expression in INS-1E cells is independent of β-cell excitation and insulin secretion but requires activation of protein phosphatase 2A in a process involving inactivation of the AMP-activated protein kinase (AMPK). Pharmacological activation of AMPK at high glucose concentrations interferes with glucose repression of PPARα and PPARα target genes in INS-1E cells as well as in rat islets. Specific knock-down of the catalytic AMPK-subunit AMPKα2 but not AMPKα1 using RNAi suppressed PPARα expression, thereby mimicking the effect of glucose. These results indicate that activation of protein phosphatase 2A and subsequent inactivation of AMPK is necessary for glucose repression of PPARα expression in pancreatic β-cells.

Introduction

Tight regulation of β-cell fatty acid metabolism is important for β-cell function. Fatty acids acutely potentiate glucose stimulated insulin secretion (Stein et al. 1996, Itoh et al. 2003, Roduit et al. 2004), whereas chronic exposure of β-cells to elevated concentrations of fatty acids causes β-cell dysfunction known as lipotoxic-ity (Shimabukuro et al. 1998b, Maedler et al. 2001). The nuclear receptor peroxisome proliferator activated receptor α (PPARα) has previously been shown to be expressed and to activate fatty acid oxidation in pancreatic β-cells (Zhou et al. 1998). This would bring PPARα in a position to antagonize lipotoxicity; however, reports on the role of PPARα in β-cell function have been conflicting (Guerre-Millo et al. 2001, Tordjman et al. 2002, Gremlich et al. 2004). Recent data from our laboratory showed that acute activation of PPARα, but not PPARγ, has the potential to stimulate mitochondrial β-oxidation and potentiate glucose-stimulated insulin secretion (GSIS) in both INS-1E insulinoma cells and rat islets (Ravnskjaer et al. 2005). Thus, regulation of PPARα expression and activity appears essential for adjusting β-cells to metabolic challenges and for maintenance of β-cell function.

The lipotoxicity in β-cells is augmented by hyperglycemia in the pathology of glucolipotoxicity (El Assaad et al. 2003). Glucose interferes with lipid partitioning and redirects the flow from lipid oxidation into lipid accumulation. Instantly, this is accomplished through post-translational modification of numerous metabolic enzymes including acetyl-CoA carboxylase (ACC) (Zhang & Kim 1995), whereas chronic effects of glucose on lipid metabolism are exerted at the transcriptional level (Roche et al. 1998). Both acute and chronic effects of glucose are antagonized by the AMP-activated protein kinase (AMPK). AMPK is considered a central cellular energy gauge activated by energy depletion, cellular stress and adipokines and is known to promote lipid oxidation (Kahn et al. 2005). Similarly, AMPK shuts down energy-consuming processes such as lipogenesis by suppressing expression and activities of lipogenic enzymes like ACC (Zhang & Kim 1995) and key lipogenic transcription factors such as sterol regulatory element binding protein 1 (Zhou et al. 2001) and carbohydrate response element binding protein (ChREBP) (Kawaguchi et al. 2002). Inactivation of AMPK by glucose has previously been described in β-cells and could be a pivotal regulatory event in glucose-induced lipogenesis (Salt et al. 1998b, da Silva et al. 2000). In addition to ATP-generation from glucose oxidation, activation of protein phosphatase 2A (or PP2A-like phosphatases) could mediate glucose action through disruption of AMPK subunit interaction (Gimeno-Alcaniz & Sanz 2003, Samari et al. 2005).

In addition to the activation of lipogenic genes, increasing levels of glucose leads to repression of genes involved in fatty acid oxidation. Pancreatic islets chronically exposed to hyperglycemic conditions show a significant reduction in PPARα expression level (Zhou et al. 1998, Laybutt et al. 2002), and in vitro studies of insulinoma cells and rat islets confirm this repression by glucose as a direct effect on PPARα gene transcription (Roduit et al. 2000). However, the molecular mechanism underlying this repression by glucose remains unknown.

Here we report that glucose repression of PPARα gene expression in pancreatic β-cells is independent of β-cell excitation and insulin secretion but involves activation of PP2A (or PP2A-like phosphatase) and acute inactivation of AMPK. Activation of AMPK using the biguanide metformin or the thiazolidinedione (TZD) compound troglitazone completely reverses the glucose-induced repression of PPARα and selected PPARα target genes. Importantly, AMPK activation also abolished glucose repression of the PPARα gene in isolated rat islets. Similarly, selective inhibition of PP2A activity interferes with the effect of glucose. Specific knock-down of AMPKα2 by shRNA mimics the effect of glucose on the PPARα expression and supports a model where AMPK activity is necessary to maintain β-cell PPARα expression and where AMPK inactivation is instrumental for glucose-induced repression of PPARα gene expression.

Materials and methods

Cell culture and glucose stimulation

The cell line INS-1E was cultured as previously described (Merglen et al. 2004). The cells in use were all at passage numbers between 50 and 70 and used for experiments at 70–80% confluence. Medium and supplements were from Invitrogen-GIBCO and serum from HyClone. In all glucose experiments, cells were pre-incubated 24 h in 5 mM glucose media before addition of glucose and compounds. Rat islets were isolated from adult male Wistar rats by collagenase perfusion and pre-cultured for 24 h in 3 mM glucose medium before addition of glucose and metformin and further incubation for 24 h. Actinomycin D, verapamil and metformin were purchased from Sigma-Aldrich, okadaic acid from Biomol (Plymouth Meeting, PA, USA), and troglitazone was kindly provided by Novo Nordisk (Bagsvaerd, Denmark).

Adenovirus generation and transduction

pSuper-AMPKα1 and α2 were constructed with specific oligos directed against sequences AGCCCTAGGT AGTCGTTGA and CGCTCGTTGATAGTTTCTG, respectively, as described (Brummelkamp et al. 2002). The H1-promoter and oligos were then excised using SmaI and HindIII and ligated into pShuttle (EcoRV and klenow-filled SalI). Recombinant adenoviruses containing shRNA against AMPKα1 and α2 were generated using the AdEasy cloning system from Stratagene. The linarized plasmids were transfected into 293-HEK cells and the viruses were amplified and purified using CsCl gradients. Viruses were initially titrated and titers estimated by a plaque assay-based approach. Subsequently, relative titers of functional viruses were equalized based on quantification of the adenoviral transcript AdE4 by real time PCR. Adenoviral vectors expressing simian virus 40 (SV40) small-t antigen and mutated SV40 small-t antigen (C103S) (Porras et al. 1996) were kindly provided by Professor Kathleen Rundell (Feinberg School of Medicine, Chicago). Twenty-four hours after transduction with AdshAMPKα1 or α2, medium was changed to new 5 mM glucose medium and cells were incubated 48 h before harvest. SV40 Small-t antigen transduction was performed in 5 mM glucose medium and glucose added 24 h later. All experiments were made at least in duplicate.

Protein analysis by western blotting and ECL detection

For total protein extraction INS-1E cells were harvested in hypotonic lysis buffer containing SDS. Nuclear extracts were prepared essentially as described in (Roduit et al. 2000). Protein extracts were separated by SDS–PAGE and proteins blotted onto PVDF membranes (Millipore, Billerica, MA, USA) and probed with specific antibodies. Primary antibodies anti-PPARγ (SC-7273) and anti-TFIIB (SC-225) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and anti-AMPKα (#2532) and anti-phosphoAMPKα (Thr172) (#2531) from Cell Signaling (Danvers, MA, USA). Secondary horseradish peroxidase-coupled anti-Fcγ antibodies, anti-Mouse (P0447) and Anti-Rabbit (P0399), were obtained from DAKO Cytomation (Carpinteria, CA, USA). Densitometric quantification was performed using ImageQuant 5.0 software from GE Healthcare (Chalfont St. Giles, UK).

RNA isolation and cDNA synthesis

INS-1E cells were harvested in guadinium thiocyanate, and RNA was isolated according to a modified Chomczynski–Sacchi protocol (Chomczynski & Sacchi 1987). cDNA was prepared after DNAse treatment (Invitrogen DNAseI) by reverse transcription (Invitrogen first-strand-kit) of the isolated RNA primed by random hexamers (dNTP)6.

Real time PCR

Quantitative 3-step real time PCR was performed on the ABI-7700 Prism real time PCR instrument using SyBRgreen master mix (Sigma) and Sigma passive reference according to instructions from the manufacturer. PCR reactions were made in duplicates. Primers for real time PCR were designed using Primer Express 2.0 (Applied Biosystems, Foster City, CA, USA) and specificity and efficacy validated before use. All quantifications were performed with TFIIB as internal standard and presented as fold over control. Primer sequences (forward and reverse, respectively): PPARα gataccactatggagtccacgca, gccgaaagaagcccttgc; TFIIB gtt ctgctccaacctttgcct, tgtgtagctgccatctgcactt; L-PK tggacatc atctttgcctcctt, ctgctaacacgtcactggcttt; c-fos ccttctccagcatg ggctc, gatctgcgcaaaagtcctgtg acyl-CoA oxidase (ACO) cagataattggcacctacgcc, aagatgagttccgtggccc; carnitine palmitoyl transferase 1 (CPT-1), ctggtgggccacaaattacg, aggtagatatattcttcccaccagtca; AdE4 ctccggaaccaccacag aaa, gcagacatgtttgagagaaaaatgg; SV40 Small-t-Ag tgcagctaatggaccttctaggt, gaatattcccccaggcactc; AMPKα1 aagccaaatcagggactgctac, agtgctgatggatcccgat; AMPKα2 ggcaaagtgaagattggagaaca, aactgccactttatggcctgtc.

Statistical analysis

Statistical evaluation of the data was performed using the two-tailed Student’s t-test on paired data or one-way ANOVA (Fig. 5B). Data (relative to control (5 mM or C)) are presented as means ± s.d. (n ≥ 3) or means ± range (n=2).

Results

Glucose represses transcription of the PPARα gene independently of insulin secretion

Glucose has previously been reported to repress the expression of PPARα mRNA in pancreatic β-cells, and to do so solely at the level of transcription (Roduit et al. 2000). We confirmed this observation in the INS-1E β-cell line and showed that glucose repression of PPARα mRNA level is observed within 30 min (Fig. 1A). In keeping with the notion that this repression occurs at the transcriptional level, inhibition of RNA synthesis with actinomycin D at 25 mM glucose, did not lead to further reduction in the PPARα mRNA level (Fig. 1A).

Glucose is known to induce β-cell excitation, Ca+2 influx and insulin secretion. We therefore wanted to examine if glucose-stimulated Ca+2 influx or GSIS is required for glucose repression of the PPARα gene in INS-1E cells. INS-1E cells were pre-incubated with verapamil, a selective L-type Ca+2channel blocker, prior to 12-h incubation with 25 mM glucose or with the non-nutrient insulin secretagog KCl (40 mM). Importantly, neither verapamil nor KCl had any effect on the PPARα mRNA level (Fig. 1B). This shows that Ca+2 influx and insulin secretion are not implicated in the glucose repression of PPARα expression. Similarly, neither the specific insulin receptor inhibitor HNMPA-nor wortmannin affected glucose repression of (AM)3 PPARα (data not shown). As a control for the experiment, the expression levels of two glucose-induced genes, liver pyruvate kinase (L-PK) and the immediate early gene c-fos, were quantified. In pancreatic β-cells, L-PK is induced by glucose through activation of the ChREBP independently of β-cell excitation (Wang & Wollheim 2002), whereas c-fos induction by glucose is dependent on Ca+2 influx (Susini et al. 1998). As expected, L-PK was induced only by glucose even in the presence of verapamil, while c-fos was induced by both glucose and KCl in a verapamil sensitive manner (Fig. 1B). Thus, these results show that glucose-induced repression of PPARα gene expression in INS-1E cells is independent of β-cell excitation and insulin secretion.

Pharmacological activation of AMPK relieves glucose repression of the PPARα gene in INS-1E cells and isolated rat islets

As AMPK activation is known to interfere with glucose induction of gene expression, we wanted to investigate whether activation of AMPK would also counteract the repressive effect of glucose on β-cell PPARα expression. INS-1E cells were cultured for 24 h in medium containing 25 mM glucose in the presence or absence of troglitazone (5–20 μM) or metformin (0.25–1 mM), both of which have been demonstrated to activate the AMPK in muscle and β-cells (Fryer et al. 2002, Leclerc et al. 2004). Total RNA was extracted and real time PCR was used to quantify the PPARα mRNA level relative to that of TFIIB. High concentrations of glucose (25 mM) repressed PPARα expression to approximately 25% of the expression at 5 mM glucose (P<0.01), whereas increasing concentrations of troglitazone (Fig. 2A) or metformin (Fig. 2B) dose-dependently restored PPARα expression. We next wanted to see if AMPK activation could also attenuate glucose repression of the PPARα gene in primary β-cells. To do so, freshly isolated rat islets were pre-incubated for 24 h at 3 mM glucose and further incubated for 24 h at 3 mM or 20 mM glucose, respectively, in the presence or absence of metformin. RNA was extracted and PPARα levels were quantified by real time PCR and presented relative to TFIIB expression. In line with the effects of AMPK activation in INS-1E cells, metformin completely abolished glucose repression of PPARα but had no effect at 3 mM glucose (Fig. 2C). These results indicate that inactivation of AMPK activity is necessary for glucose-induced repression of PPARα gene expression in pancreatic β-cells.

AMPK activation by metformin restores PPARα protein level and expression of PPARα target genes at high glucose

To verify that the effects of AMPK activation on PPARα mRNA level was translated into an increase in PPARα protein level, nuclear extracts were prepared from INS-1E cells cultured for 24 h in medium containing 25 mM glucose in the absence or presence of 0.5 mM metformin, respectively. The nuclear extracts were subjected to SDS–PAGE analysis and western blotting. Total cell extract from cells ectopically expressing mouse PPARα was used as a positive control. PPARα protein levels reflected the changes in mRNA level in that 25 mM glucose markedly reduced PPARα protein, whereas metformin activation of AMPK counteracted glucose repression of PPARα protein (Fig. 3A). To confirm that the glucose regulation of PPARα protein is functionally significant, we investigated expression levels of the known PPARα target genes ACO (Tugwood et al. 1992) and liver CPT-1 (Napal et al. 2005). Notably, expression of both target genes is reduced by glucose (P<0.05) and dose dependently restored by AMPK activation with metformin (0.25–1 mM) (Fig. 3B). Thus, the changes in PPARα mRNA expression in response to glucose and AMPK activation are reflected by parallel changes in PPARα protein level and expression of PPARα target genes.

Pharmacological activation of AMPK and inhibition of PP2A blocks glucose inhibition of β-cell AMPK activity

The finding that glucose represses PPARα expression in a manner counteracted by pharmacological activation of AMPK, points to a central role for AMPK in this response. To address this, AMPK activity was evaluated in INS-1E cells incubated for 0.5–24 h at 5 and 25 mM glucose alone or in the presence of troglitazone (5–20 μM), metformin (0.5 mM), or the PP2A inhibitor okadaic acid (25 nM). AMPK activity was assessed by Western blotting and ECL detection of threonine-172 phosphorylation of the AMPKα-subunit. In agreement with the acute glucose repression of PPARα expression (Fig. 1A), 25 mM glucose markedly reduced AMPK activity compared with 5 mM glucose already after 30 min (Fig. 4A). This repression of AMPK activity by glucose persisted for at least 24 h (Fig. 4B and C). The TZD compound troglitazone dose-dependently restored AMPK activity (Fig. 4B), as did metformin (Fig. 4C), without affecting the total protein level of AMPKα subunit. Glucose is known to activate PP2A. Interestingly, inhibition of PP2A by okadaic acid totally blocked the negative effect of glucose on AMPK activity (Fig. 4C). These results confirm that AMPK activity is acutely repressed by glucose in the β-cell line INS-1E and show that this repression is counteracted by metformin and troglitazone as well as by inhibition of PP2A.

Inhibition of PP2A blocks glucose repression of PPARα expression

To further investigate the role of PP2A in glucose action on β-cell PPARα expression, PP2A activity was chemically inhibited in INS-1E cells stimulated with 25 mM glucose and PPARα mRNA levels were analyzed by real time PCR. Resembling the stimulating effect on AMPK-activity, chemical inhibition of PP2A using the specific inhibitor okadaic acid (12.5 or 25 nM) dose-dependently restored PPARα levels (Fig. 5A P,<0.05). This was confirmed by adenoviral transduction (titer 40 pfu/cell) of INS-1E cells with SV40 small-t antigen-a protein known to form a stable complex with PP2A and inhibit it’s catalytic activity (Yang et al. 1991). Similarly to okadaic acid, SV40 small-t antigen blunted the glucose effect on PPARα expression (Fig. 5B P,<0.05). A mutated form of SV40 small-t antigen (C103S) expressed to the same level but unable to interact with PP2A (Porras et al. 1996) did not affect PPARα expression nor did Ad-CMV (C). These results indicate that glucose activation of PP2A or PP2A-like kinases is necessary for glucose-induced repression of PPARα gene expression.

Specific knock-down of the catalytic AMPK α2-subunit mimics glucose-induced PPARα repression

To confirm the role of AMPK activity in maintenance of PPARα gene expression under low glucose conditions, we generated adenoviral vectors expressing shRNA for specific knock-down of the catalytic subunits α1 and α2. INS-1E cells were transduced with these adenoviral shRNA constructs targeting AMPKα1, α2, or a combination of both, respectively, for 72 h in 5 mM glucose medium. Control cells were transduced with an empty adenoviral shRNA-vector (C). Total RNA and protein was extracted and AMPKα mRNA (Fig. 6A) and protein levels (Fig. 6B) were investigated. Specific knock-down of the AMPKα1 and α2 genes was confirmed by quantitative real time PCR (50% and 60% mRNA reduction respectively, P<0.05). Also AMPKα protein level was reduced by knock-down as assessed by western blotting and ECL-detection of total level of AMPKα subunit. Whereas knock-down of AMPKα1 did not affect PPARα expression level, AMPKα2 knockdown reduced the PPARα mRNA level by ~50% (Fig. 6C P,<0.05). These results show that the activity of AMPKα2, but not that of AMPKα1, is important for maintenance of PPARα gene expression.

Discussion

During the last years, our knowledge about the family of AMPKs has expanded dramatically. Once a glucose sensor in budding yeast (Celenza & Carlson 1986) the AMPK is now considered a central fuel gauge upholding mammalian energy homeostasis and controlling fuel selection in various metabolically important tissues (reviewed in Kahn et al. 2005). Metabolic signals such as adipokines (Minokoshi et al. 2002, Yamauchi et al. 2002, Banerjee et al. 2004), hormones (Minokoshi et al. 2004) and nutrients (da Silva et al. 2000, Leclerc & Rutter 2004, Koo et al. 2005) are integrated by the AMPK centrally and peripherally resulting in increased food intake, reduced hepatic glucose output and a general shift from energy expenditure to energy production. Also pharmacologically, the AMPK is of substantial interest. Anti-diabetic compounds such as metformin and rosigli-tazone of the biguanide and thiazolidinedione classes, respectively, have been shown to activate AMPK (Zhou et al. 2001, Fryer et al. 2002). Metformin was recently reported to activate hepatic AMPK through activation of the upstream AMPK-kinase LKB1 (Shaw et al. 2005).

Here we describe a novel role for AMPK in the pancreatic β-cell. In keeping with AMPK stimulation of fatty acid oxidation in various tissues, we show that AMPK is important for the maintenance of PPARα gene expression in INS-1E cells and primary β-cells. Furthermore, we provide evidence that AMPK inactivation is a key event in glucose-induced repression of PPARα expression. While acutely decreasing AMPK activity, glucose represses PPARα expression independently of β-cell excitation and insulin secretion in both the INS-1E β-cell line and isolated rat islets. Importantly, repression of PPARα gene expression is reflected at PPARα protein level together with expression levels of the known PPARα target genes ACO and CPT-1 in a manner completely reversed by pharmacological activation of AMPK. Specific knockdown of AMPKα2, but not AMPKα1, reduces PPARα expression even at a low glucose level, suggesting that inactivation of AMPKα2 by glucose is upstream to PPARα gene repression. This is in agreement with our finding that metformin did not have any effect on islet PPARα expression under non-repressive low glucose conditions. To further explore the underlying mechanism, we chemically inhibited phosphatases known to be activated by glucose and found that inhibition of PP2A using okadaic acid attenuated glucose-induced inactivation of AMPK as well as repression of PPARα expression. This was confirmed by specific SV40 small-t antigen mediated inhibition of PP2A activity. SV40 small-t antigen forms a stable complex with the PP2A A-subunit replacing the regulatory B-subunit and inhibiting PP2A activity (Yang et al. 1991). The relative contribution of ATP generation from glucose oxidation to AMPK inactivation was not assessed in our experiments. Notably however, PP2A inhibition with okadaic acid entirely restored AMPKα phosphorylation level at 25 mM glucose (Fig. 4C), suggesting that glucose could suppress AMPKα activity by activating PP2A rather than through an increase in the ATP/AMP ratio. A model where glucose activates PP2A leading to AMPK inactivation and PPARα repression (outlined in Fig. 7) is attractive as homologous pathways controlling energy substrate selection are known from yeast (Jiang & Carlson 1996). Glucose has previously been shown to inactivate AMPK in β-cells (Salt et al. 1998b, da Silva et al. 2000), and recent findings that glucose and PP2A can disrupt mammalian AMPK subunit association (Gimeno-Alcaniz & Sanz 2003) support the depicted model.

AMPK activity is known to counteract glucose-stimulated gene expression through inhibition of ChREBP (Kawaguchi et al. 2002), whereas possible involvement of AMPK in repression of mammalian genes by glucose has not previously been described. However, treatment of islets from hyperglycemic Zucker diabetic fatty (ZDF) rats with leptin resulted in increased fatty acid oxidation, islet delipidation and functional restoration (Zhou et al. 1997, 1998). Strikingly, the lipopenic effect of leptin was associated with an increase in expression of both PPARα and PPARα target genes. Leptin is known to promote fatty acid oxidation in various tissues but only in skeletal muscle this has been shown to involve AMPK activation (Minokoshi et al. 2002). Also troglitazone, here used to activate AMPK, has a similar potential to counteract glucolipotoxicity in isolated ZDF rat islets through delipidation (Shimabukuro et al. 1998a, Higa et al. 1999). Both observations are in keeping with our data showing that activation of AMPK leads to increased PPARα expression. Of note, PPARγ is not expressed at significant levels in INS-1E cells (data not shown). Therefore it is unlikely that troglitazone, which is also a PPARγ agonist, affects PPARα expression through activation of PPARγ in the present study.

Our finding that specific knock-down of the α2 but not the α1 subunit of AMPK in the β-cell suppresses PPARα expression indicates a functional specialization of the two catalytic isoforms. This was previously addressed by specific α1 and α2 knock-out models (Viollet et al. 2003). Whereas AMPKα1−/− mice did not display any phenotypic abnormalities, AMPKα2−/− mice were highly glucose intolerant with impaired GSIS. The β-cell dysfunction observed in vivo was not found in isolated AMPKα2−/− islets, suggesting that GSIS impairment was either not a primary defect, or that β-cell AMPKα2 depletion is critical only in the in vivo AMPKα2−/− environment with chronically increased levels of fatty acids and catecholamines. Other studies functionally comparing AMPKα1 and α2 revealed that the α1 subunit is cytoplasmatic, whereas AMPKα2 is also found in the nucleus of β-cell lines (Salt et al. 1998a, da Silva et al. 2000). AMPKα1 is hence likely to phosphorylate cytoplasmatic substrates, whereas AMPKα2 may be involved in the conversion of metabolic signals into transcriptional regulation. This model is supported by our data showing that AMPKα2, but not AMPKα1, is involved in the maintenance of PPARα expression. In addition, our RNAi based approach supports previous studies in MIN6 insulinoma cells where inactivation of AMPKα2 by antibody injection at low glucose mimicked glucose induction of the L-PK (da Silva et al. 2000). Of note, a similar approach in primary hepatocytes, where a dominant negative AMPKα subunit was used to inactivate endogenous AMPK at low glucose, showed no effect on L-PK expression (Woods et al. 2000). Whether this discrepancy reveals a general difference between β-cells and hepatocytes or simply reflects different experimental conditions is still to be resolved. In a recent study, ectopic expression of a constitutive active AMPKα subunit in rat islets did not affect PPARα expression (Diraison et al. 2004). However, as the authors note, the experiments were performed at 3 mM glucose, reducing the impact of ectopic AMPKα expression. This would be in agreement with our present data (Fig. 2C). Furthermore, substrate recognition of a deregulated catalytic AMPKα subunit expressed alone could be compromised by the relative lack of regulatory subunits.

In conclusion, we describe here for the first time the involvement of AMPK in repression of gene expression by glucose. We find that repression of PPARα gene expression by glucose in INS-1E insulinoma cells involves activation of PP2A and inactivation of AMPK. This mechanism is likely to apply also to primary β-cells, since AMPK activation totally abolishes glucose repression of the PPARα gene in isolated rat islets. Our result that AMPKα2 but not AMPKα1 is necessary for maintenance of PPARα gene expression suggest that glucose acts primarily by inactivation of AMPKα2. Hence, acute inactivation of the AMPKα2 appears to be a critical step in both induction and repression of genes by glucose in pancreatic β-cells. PPARα is a known key regulator of fatty acid oxidation, and PPARα expression in the β-cell is important for β-cell function (Zhou et al. 1998, Ravnskjaer et al. 2005). Thus, the ability of AMPK to increase PPARα expression under hyperglycemic conditions indicates that pharmacological activators of AMPK may exert direct beneficial effects on β-cell lipid partitioning and contribute to β-cell protection.

Figure 1
Figure 1

Glucose represses PPARα mRNA level at the transcriptional level independently of β-cell excitation or insulin secretion. INS-1E cells were pre-cultured for 24 h in 5 mM glucose medium before addition of glucose to 25 mM or 40 mM KCl. Where indicated, 5 μM actinomycin D was added together with the glucose or cells were pre-incubated with 20 μM verapamil for 1 h before glucose addition. Cells were subsequently harvested at the indicated time points (A) or after 12 h incubation (B). Total RNA was extracted and expression of PPARα, L-PK and c-fos were quantified using real time PCR. The data was normalized to TFIIB expression and presented relative to expression at 5 mM glucose. RNA was harvested in duplicates, and range is indicated (* significantly different from 5 mM glucose P<0.05). The presented results are representative of at least 3 independent experiments.

Citation: Journal of Molecular Endocrinology 36, 2; 10.1677/jme.1.01965

Figure 2
Figure 2

Pharmacological activators of AMPK interfere with glucose repression of the PPARα gene in INS-1E cells and isolated rat islets. INS-1E cells were pre-cultured for 24 h in 5 mM glucose medium before addition of glucose to 25 mM with or without with troglitazone (5, 10 and 20 μM) (A) or metformin (0.25, 0.5 and 1 mM) (B). Cells were subsequently cultured for 24 h before total RNA was extracted. Freshly isolated rat islets were pre-cultured for 24 h in 3 mM glucose medium before 24-h incubation at 3 or 20 mM glucose in the presence or absence of metformin (1 mM) (C). Expression of PPARα was quantified using real time PCR, normalized to TFIIB expression and presented relative to expression at 5 mM glucose. RNA was harvested in duplicates, and range is indicated (*, significantly different from 5 mM glucose P<0.05). The presented results are representative of at least 3 independent experiments.

Citation: Journal of Molecular Endocrinology 36, 2; 10.1677/jme.1.01965

Figure 3
Figure 3

Pharmacological activation of AMPK interferes with glucose repression of PPARα protein and target gene expression. INS-1E cells were pre-cultured for 24 h in 5 mM glucose medium before addition of glucose to 25 mM with or without with metformin (protein: 0.5 mM, RNA: 0.25, 0.5 or 1 mM). Cells were subsequently cultured for 24 h before nuclear proteins and RNA was extracted. (A) Proteins were separated by SDS-PAGE and levels of PPARα and TFIIB visualized by immunoblotting. Extract from cells ectopically expressing mPPARα was used as positive control (Pα). (B) The expression levels of ACO and CPT-1 were quantified by real time PCR, normalized to TFIIB expression and presented relative to expression at 5 mM glucose. RNA was harvested in duplicates, and range is indicated (*, significantly different from 5 mM glucose P<0.05). The presented results are representative of at least 3 independent experiments.

Citation: Journal of Molecular Endocrinology 36, 2; 10.1677/jme.1.01965

Figure 4
Figure 4

AMPK activity is repressed by glucose but restored by troglitazone, metformin and PP2A inhibition. (A) and (B) INS-1E cells were pre-cultured for 24 h in 5 mM glucose medium before addition of glucose to 25 mM with or without with troglitazone (5, 10, 20 μM). (C) INS-1E cells pre-cultured at 5 mM glucose were treated with metformin (0.5 mM) or okadaic acid (25 nM) at 5 mM or 25 mM glucose, respectively. Cells were harvested and whole cell extracts subsequently prepared at the indicated time points A or after 24 h incubation B and C. Proteins were separated by SDS-PAGE and levels of phosphoAMPKα (Thr172) and AMPKα visualized by immunoblotting and densitometric quantification. The presented results are representative of at least 3 independent experiments.

Citation: Journal of Molecular Endocrinology 36, 2; 10.1677/jme.1.01965

Figure 5
Figure 5

Inhibition of PP2A interferes with glucose repression of PPARα gene expression. (A) INS-1E cells were pre-cultured for 24 h at 5 mM glucose. The glucose concentration was increased to 25 mM, DMSO or okadaic acid (12.5 or 25 nM) was added, and cells were cultured for 24 h before harvesting of RNA. (B) Cells were adenovirally transduced with SV40 small-t-antigen wt or mutant (C103S) or Ad-CMV as control (C) at 5 mM glucose. After 24 h, the glucose concentration was increased to 25 mM and cells were subsequently cultured for 24 h before total RNA was extracted. Expression of PPARα was quantified by real time PCR, normalized to TFIIB expression and presented relative to expression at 5 mM glucose. RNA was harvested in duplicates, and range is indicated. Means not sharing same superscript differ significantly (P<0.05). The presented results are representative of at least 3 independent experiments.

Citation: Journal of Molecular Endocrinology 36, 2; 10.1677/jme.1.01965

Figure 6
Figure 6

Specific knock-down of AMPKα2 represses PPARα expression. INS-1E cells were transduced with a control virus AdshEmpty (C), adenoviral shRNA vectors AdshAMPKα1, AdshAMPKα2 or both and cultured for 72 h at 5 mM glucose. Total mRNA and protein was extracted. (A) Relative knock-down of either AMPKα subunit α1 and α2 was quantified by real time PCR and normalized to TFIIB expression. (B) Knock-down of AMPKα protein was confirmed by western blotting and ECL. (C) PPARα expression was quantified by real time PCR and normalized to TFIIB expression. RNA was harvested in duplicates, and range is indicated (*, significantly different from control P<0.05). The presented results are representative of at least 3 independent experiments.

Citation: Journal of Molecular Endocrinology 36, 2; 10.1677/jme.1.01965

Figure 7
Figure 7

Proposed model for glucose-induced repression of PPARα gene expression in pancreatic β-cells. The effect of the potential glucose-stimulated increase in the ATP/AMP ratio on AMPK activity was not addressed but added for completion.

Citation: Journal of Molecular Endocrinology 36, 2; 10.1677/jme.1.01965

The authors are grateful to Claes Wollheim for supplying the INS-1E cell line, Kathleen Rundell for adenoviral SV40 small-t antigen, René Bernards for the pSuper vector and Novo Nordisk for troglitazone.

Funding

This work was supported by grants from the Danish Health Science Research Council and the Danish Diabetes Foundation. M B is supported by a Novo Nordisk scholarship. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.

References

  • Banerjee RR, Rangwala SM, Shapiro JS, Rich AS, Rhoades B, Qi Y, Wang J, Rajala MW, Pocai A, Scherer PE, Steppan CM, Ahima RS, Obici S, Rossetti L & Lazar MA 2004 Regulation of fasted blood glucose by resistin. Science 303 1195–1198.

    • Search Google Scholar
    • Export Citation
  • Brummelkamp TR, Bernards R & Agami R 2002 A system for stable expression of short interfering RNAs in mammalian cells. Science 296 550–553.

    • Search Google Scholar
    • Export Citation
  • Celenza JL & Carlson M 1986 A yeast gene that is essential for release from glucose repression encodes a protein kinase. Science 233 1175–1180.

    • Search Google Scholar
    • Export Citation
  • Chomczynski P & Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry 162 156–159.

    • Search Google Scholar
    • Export Citation
  • da Silva, Leclerc I, Salt IP, Doiron B, Hardie DG, Kahn A & Rutter GA 2000 Role of AMP-activated protein kinase in the regulation by glucose of islet beta cell gene expression. PNAS 97 4023–4028.

    • Search Google Scholar
    • Export Citation
  • Diraison F, Motakis E, Parton LE, Nason GP, Leclerc I & Rutter GA 2004 Impact of adenoviral transduction with SREBP1c or AMPK on pancreatic islet gene expression profile: analysis with oligonucleotide microarrays. Diabetes 53 S84–S91.

    • Search Google Scholar
    • Export Citation
  • El Assaad W, Buteau J, Peyot ML, Nolan C, Roduit R, Hardy S, Joly E, Dbaibo G, Rosenberg L & Prentki M 2003 Saturated fatty acids synergize with elevated glucose to cause pancreatic beta-cell death. Endocrinology 144 4154–4163.

    • Search Google Scholar
    • Export Citation
  • Fryer LG, Parbu-Patel A & Carling D 2002 The Anti-diabetic drugs rosiglitazone and metformin stimulate AMP-activated protein kinase through distinct signaling pathways. Journal of Biological Chemistry 277 25226–25232.

    • Search Google Scholar
    • Export Citation
  • Gimeno-Alcaniz JV & Sanz P 2003 Glucose and type 2A protein phosphatase regulate the interaction between catalytic and regulatory subunits of AMP-activated protein kinase. Journal of Molecular Biology 333 201–209.

    • Search Google Scholar
    • Export Citation
  • Gremlich S, Nolan C, Roduit R, Burcelin R, Peyot ML, Delghingaro-Augusto V, Desvergne B, Michalik L, Prentki M & Wahli W 2004 Pancreatic islet adaptation to fasting is dependent on ppar{alpha} transcriptional up-regulation of fatty acid oxidation. Endocrinology 146 375–382.

    • Search Google Scholar
    • Export Citation
  • Guerre-Millo M, Rouault C, Poulain P, Andre J, Poitout V, Peters JM, Gonzalez FJ, Fruchart JC, Reach G & Staels B 2001 PPAR-alpha-null mice are protected from high-fat diet-induced insulin resistance. Diabetes 50 2809–2814.

    • Search Google Scholar
    • Export Citation
  • Higa M, Zhou YT, Ravazzola M, Baetens D, Orci L & Unger RH 1999 Troglitazone prevents mitochondrial alterations, beta cell destruction, and diabetes in obese prediabetic rats. PNAS 96 11513–11518.

    • Search Google Scholar
    • Export Citation
  • Itoh Y, Kawamata Y, Harada M, Kobayashi M, Fujii R, Fukusumi S, Ogi K, Hosoya M, Tanaka Y, Uejima H, Tanaka H, Maruyama M, Satoh R, Okubo S, Kizawa H, Komatsu H, Matsumura F, Noguchi Y, Shinohara T, Hinuma S, Fujisawa Y & Fujino M 2003 Free fatty acids regulate insulin secretion from pancreatic beta cells through GPR40. Nature 422 173–176.

    • Search Google Scholar
    • Export Citation
  • Jiang R & Carlson M 1996 Glucose regulates protein interactions within the yeast SNF1 protein kinase complex. Genes Development 10 3105–3115.

    • Search Google Scholar
    • Export Citation
  • Kahn BB, Alquier T, Carling D & Hardie DG 2005 AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. Cell Metabolism 1 15–25.

    • Search Google Scholar
    • Export Citation
  • Kawaguchi T, Osatomi K, Yamashita H, Kabashima T & Uyeda K 2002 Mechanism for fatty acid ‘sparing’ effect on glucose-induced transcription: regulation of carbohydrate-responsive element-binding protein by AMP-activated protein kinase. Journal of Biological Chemistry 277 3829–3835.

    • Search Google Scholar
    • Export Citation
  • Koo SH, Flechner L, Qi L, Zhang X, Screaton RA, Jeffries S, Hedrick S, Xu W, Boussouar F, Brindle P, Takemori H & Montminy M 2005 The CREB coactivator TORC2 is a key regulator of fasting glucose metabolism. Nature 437 1109–1111.

    • Search Google Scholar
    • Export Citation
  • Laybutt DR, Sharma A, Sgroi DC, Gaudet J, Bonner-Weir S & Weir GC 2002 Genetic regulation of metabolic pathways in beta-cells disrupted by hyperglycemia. Journal of Biological Chemistry 277 10912–10921.

    • Search Google Scholar
    • Export Citation
  • Leclerc I & Rutter GA 2004 AMP-activated protein kinase: a new beta-cell glucose sensor?: Regulation by amino acids and calcium ions. Diabetes 53 S67–S74.

    • Search Google Scholar
    • Export Citation
  • Leclerc I, Woltersdorf WW, da S, X, Rowe RL, Cross SE, Korbutt GS, Rajotte RV, Smith R & Rutter GA 2004 Metformin, but not leptin, regulates AMP-activated protein kinase in pancreatic islets: impact on glucose-stimulated insulin secretion. American Journal of Physiology, Endocrinology and Metabolism 286 E1023–E1031.

    • Search Google Scholar
    • Export Citation
  • Maedler K, Spinas GA, Dyntar D, Moritz W, Kaiser N & Donath MY 2001 Distinct effects of saturated and monounsaturated fatty acids on beta-cell turnover and function. Diabetes 50 69–76.

    • Search Google Scholar
    • Export Citation
  • Merglen A, Theander S, Rubi B, Chaffard G, Wollheim CB & Maechler P 2004 Glucose sensitivity and metabolism-secretion coupling studied during two-year continuous culture in INS-1E insulinoma cells. Endocrinology 145 667–678.

    • Search Google Scholar
    • Export Citation
  • Minokoshi Y, Kim YB, Peroni OD, Fryer LG, Muller C, Carling D & Kahn BB 2002 Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415 339–343.

    • Search Google Scholar
    • Export Citation
  • Minokoshi Y, Alquier T, Furukawa N, Kim YB, Lee A, Xue B, Mu J, Foufelle F, Ferre P, Birnbaum MJ, Stuck BJ & Kahn BB 2004 AMP-kinase regulates food intake by responding to hormonal and nutrient signals in the hypothalamus. Nature 428 569–574.

    • Search Google Scholar
    • Export Citation
  • Napal L, Marrero PF & Haro D 2005 An intronic peroxisome proliferator-activated receptor-binding sequence mediates fatty acid induction of the human carnitine palmitoyltransferase 1A. Journal of Molecular Biology 354 751–759.

    • Search Google Scholar
    • Export Citation
  • Porras A, Bennett J, Howe A, Tokos K, Bouck N, Henglein B, Sathyamangalam S, Thimmapaya B & Rundell K 1996 A novel simian virus 40 early-region domain mediates transactivation of the cyclin A promoter by small-t antigen and is required for transformation in small-t antigen-dependent assays. Journal of Virology 70 6902–6908.

    • Search Google Scholar
    • Export Citation
  • Ravnskjaer K, Boergesen M, Rubi B, Larsen JK, Nielsen T, Fridriksson J, Maechler P & Mandrup S 2005 Peroxisome proliferator-activated receptor alpha (PPARalpha) potentiates, whereas PPARgamma attenuates, glucose-stimulated insulin secretion in pancreatic beta-cells. Endocrinology 146 3266–3276.

    • Search Google Scholar
    • Export Citation
  • Roche E, Farfari S, Witters LA, Assimacopoulos-Jeannet F, Thumelin S, Brun T, Corkey BE, Saha AK & Prentki M 1998 Long-term exposure of beta-INS cells to high glucose concentrations increases anaplerosis, lipogenesis, and lipogenic gene expression. Diabetes 47 1086–1094.

    • Search Google Scholar
    • Export Citation
  • Roduit R, Morin J, Masse F, Segall L, Roche E, Newgard CB, Assimacopoulos-Jeannet F & Prentki M 2000 Glucose down-regulates the expression of the peroxisome proliferator-activated receptor-alpha gene in the pancreatic beta -cell. Journal of Biological Chemistry 275 35799–35806.

    • Search Google Scholar
    • Export Citation
  • Roduit R, Nolan C, Alarcon C, Moore P, Barbeau A, Delghingaro-Augusto V, Przybykowski E, Morin J, Masse F, Massie B, Ruderman N, Rhodes C, Poitout V & Prentki M 2004 A role for the malonyl-CoA/long-chain acyl-CoA pathway of lipid signaling in the regulation of insulin secretion in response to both fuel and nonfuel stimuli. Diabetes 53 1007–1019.

    • Search Google Scholar
    • Export Citation
  • Salt I, Celler JW, Hawley SA, Prescott A, Woods A, Carling D & Hardie DG 1998a AMP-activated protein kinase: greater AMP dependence, and preferential nuclear localization, of complexes containing the alpha2 isoform. Biochemical Journal 334 177–187.

    • Search Google Scholar
    • Export Citation
  • Salt IP, Johnson G, Ashcroft SJ & Hardie DG 1998b AMP-activated protein kinase is activated by low glucose in cell lines derived from pancreatic beta cells, and may regulate insulin release. Biochemical Journal 335 533–539.

    • Search Google Scholar
    • Export Citation
  • Samari HR, Moller MT, Holden L, Asmyhr T & Seglen PO 2005 Stimulation of hepatocytic AMP-activated protein kinase by okadaic acid and other autophagy-suppressive toxins. Biochemical Journal 386 237–244.

    • Search Google Scholar
    • Export Citation
  • Shaw RJ, Lamia KA, Vasquez D, Koo SH, Bardeesy N, Depinho RA, Montminy M & Cantley LC 2005 The Kinase LKB1 Mediates Glucose Homeostasis in Liver and Therapeutic Effects of Metformin. Science 310 1642–1646.

    • Search Google Scholar
    • Export Citation
  • Shimabukuro M, Zhou YT, Lee Y & Unger RH 1998a Troglitazone lowers islet fat and restores beta cell function of Zucker diabetic fatty rats. Journal of Biological Chemistry 273 3547–3550.

    • Search Google Scholar
    • Export Citation
  • Shimabukuro M, Zhou YT, Levi M & Unger RH 1998b Fatty acid-induced beta cell apoptosis: a link between obesity and diabetes. PNAS 95 2498–2502.

    • Search Google Scholar
    • Export Citation
  • Stein DT, Esser V, Stevenson BE, Lane KE, Whiteside JH, Daniels MB, Chen S & McGarry JD 1996 Essentiality of circulating fatty acids for glucose-stimulated insulin secretion in the fasted rat. Journal of Clinical Investigation 97 2728–2735.

    • Search Google Scholar
    • Export Citation
  • Susini S, Roche E, Prentki M & Schlegel W 1998 Glucose and glucoincretin peptides synergize to induce c-fos, c-jun, junB, zif-268, and nur-77 gene expression in pancreatic beta(INS-1) cells. FASEB Journal 12 1173–1182.

    • Search Google Scholar
    • Export Citation
  • Tordjman K, Standley KN, Bernal-Mizrachi C, Leone TC, Coleman T, Kelly DP & Semenkovich CF 2002 PPARalpha suppresses insulin secretion and induces UCP2 in insulinoma cells. Journal of Lipid Research 43 936–943.

    • Search Google Scholar
    • Export Citation
  • Tugwood JD, Issemann I, Anderson RG, Bundell KR, McPheat WL & Green S 1992 The mouse peroxisome proliferator activated receptor recognizes a response element in the 5′ flanking sequence of the rat acyl CoA oxidase gene. EMBO Journal 11 433–439.

    • Search Google Scholar
    • Export Citation
  • Viollet B, Andreelli F, Jorgensen SB, Perrin C, Geloen A, Flamez D, Mu J, Lenzner C, Baud O, Bennoun M, Gomas E, Nicolas G, Wojtaszewski JF, Kahn A, Carling D, Schuit FC, Birnbaum MJ, Richter EA, Burcelin R & Vaulont S 2003 The AMP-activated protein kinase alpha2 catalytic subunit controls whole-body insulin sensitivity. Journal of Clinical Investigations 111 91–98.

    • Search Google Scholar
    • Export Citation
  • Wang H & Wollheim CB 2002 ChREBP rather than USF2 regulates glucose stimulation of endogenous l-pyruvate kinase expression in insulin-secreting cells. Journal of Biological Chemistry 277 32746–32752.

    • Search Google Scholar
    • Export Citation
  • Woods A, Azzout-Marniche D, Foretz M, Stein SC, Lemarchand P, Ferre P, Foufelle F & Carling D 2000 Characterization of the role of AMP-activated protein kinase in the regulation of glucose-activated gene expression using constitutively active and dominant negative forms of the kinase. Molecular and Cellular Biology 20 6704–6711.

    • Search Google Scholar
    • Export Citation
  • Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, Ueki K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre P, Carling D, Kimura S, Nagai R, Kahn BB & Kadowaki T 2002 Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nature Medicine 8 1288–1295.

    • Search Google Scholar
    • Export Citation
  • Yang SI, Lickteig RL, Estes R, Rundell K, Walter G & Mumby MC 1991 Control of protein phosphatase 2A by simian virus 40 small-t antigen. Molecular and Cellular Biology 11 1988–1995.

    • Search Google Scholar
    • Export Citation
  • Zhang S & Kim KH 1995 Glucose activation of acetyl-CoA carboxylase in association with insulin secretion in a pancreatic beta-cell line. Journal of Endocrinology 147 33–41.

    • Search Google Scholar
    • Export Citation
  • Zhou YT, Shimabukuro M, Koyama K, Lee Y, Wang MY, Trieu F, Newgard CB & Unger RH 1997 Induction by leptin of uncoupling protein-2 and enzymes of fatty acid oxidation. PNAS 94 6386–6390.

    • Search Google Scholar
    • Export Citation
  • Zhou YT, Shimabukuro M, Wang MY, Lee Y, Higa M, Milburn JL, Newgard CB & Unger RH 1998 Role of peroxisome proliferator-activated receptor alpha in disease of pancreatic beta cells. PNAS 95 8898–8903.

    • Search Google Scholar
    • Export Citation
  • Zhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J, Wu M, Ventre J, Doebber T, Fujii N, Musi N, Hirshman MF, Goodyear LJ & Moller DE 2001 Role of AMP-activated protein kinase in mechanism of metformin action. Journal of Clinical Investigation 108 1167–1174.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 946 132 12
PDF Downloads 237 92 4
  • View in gallery

    Glucose represses PPARα mRNA level at the transcriptional level independently of β-cell excitation or insulin secretion. INS-1E cells were pre-cultured for 24 h in 5 mM glucose medium before addition of glucose to 25 mM or 40 mM KCl. Where indicated, 5 μM actinomycin D was added together with the glucose or cells were pre-incubated with 20 μM verapamil for 1 h before glucose addition. Cells were subsequently harvested at the indicated time points (A) or after 12 h incubation (B). Total RNA was extracted and expression of PPARα, L-PK and c-fos were quantified using real time PCR. The data was normalized to TFIIB expression and presented relative to expression at 5 mM glucose. RNA was harvested in duplicates, and range is indicated (* significantly different from 5 mM glucose P<0.05). The presented results are representative of at least 3 independent experiments.

  • View in gallery

    Pharmacological activators of AMPK interfere with glucose repression of the PPARα gene in INS-1E cells and isolated rat islets. INS-1E cells were pre-cultured for 24 h in 5 mM glucose medium before addition of glucose to 25 mM with or without with troglitazone (5, 10 and 20 μM) (A) or metformin (0.25, 0.5 and 1 mM) (B). Cells were subsequently cultured for 24 h before total RNA was extracted. Freshly isolated rat islets were pre-cultured for 24 h in 3 mM glucose medium before 24-h incubation at 3 or 20 mM glucose in the presence or absence of metformin (1 mM) (C). Expression of PPARα was quantified using real time PCR, normalized to TFIIB expression and presented relative to expression at 5 mM glucose. RNA was harvested in duplicates, and range is indicated (*, significantly different from 5 mM glucose P<0.05). The presented results are representative of at least 3 independent experiments.

  • View in gallery

    Pharmacological activation of AMPK interferes with glucose repression of PPARα protein and target gene expression. INS-1E cells were pre-cultured for 24 h in 5 mM glucose medium before addition of glucose to 25 mM with or without with metformin (protein: 0.5 mM, RNA: 0.25, 0.5 or 1 mM). Cells were subsequently cultured for 24 h before nuclear proteins and RNA was extracted. (A) Proteins were separated by SDS-PAGE and levels of PPARα and TFIIB visualized by immunoblotting. Extract from cells ectopically expressing mPPARα was used as positive control (Pα). (B) The expression levels of ACO and CPT-1 were quantified by real time PCR, normalized to TFIIB expression and presented relative to expression at 5 mM glucose. RNA was harvested in duplicates, and range is indicated (*, significantly different from 5 mM glucose P<0.05). The presented results are representative of at least 3 independent experiments.

  • View in gallery

    AMPK activity is repressed by glucose but restored by troglitazone, metformin and PP2A inhibition. (A) and (B) INS-1E cells were pre-cultured for 24 h in 5 mM glucose medium before addition of glucose to 25 mM with or without with troglitazone (5, 10, 20 μM). (C) INS-1E cells pre-cultured at 5 mM glucose were treated with metformin (0.5 mM) or okadaic acid (25 nM) at 5 mM or 25 mM glucose, respectively. Cells were harvested and whole cell extracts subsequently prepared at the indicated time points A or after 24 h incubation B and C. Proteins were separated by SDS-PAGE and levels of phosphoAMPKα (Thr172) and AMPKα visualized by immunoblotting and densitometric quantification. The presented results are representative of at least 3 independent experiments.

  • View in gallery

    Inhibition of PP2A interferes with glucose repression of PPARα gene expression. (A) INS-1E cells were pre-cultured for 24 h at 5 mM glucose. The glucose concentration was increased to 25 mM, DMSO or okadaic acid (12.5 or 25 nM) was added, and cells were cultured for 24 h before harvesting of RNA. (B) Cells were adenovirally transduced with SV40 small-t-antigen wt or mutant (C103S) or Ad-CMV as control (C) at 5 mM glucose. After 24 h, the glucose concentration was increased to 25 mM and cells were subsequently cultured for 24 h before total RNA was extracted. Expression of PPARα was quantified by real time PCR, normalized to TFIIB expression and presented relative to expression at 5 mM glucose. RNA was harvested in duplicates, and range is indicated. Means not sharing same superscript differ significantly (P<0.05). The presented results are representative of at least 3 independent experiments.

  • View in gallery

    Specific knock-down of AMPKα2 represses PPARα expression. INS-1E cells were transduced with a control virus AdshEmpty (C), adenoviral shRNA vectors AdshAMPKα1, AdshAMPKα2 or both and cultured for 72 h at 5 mM glucose. Total mRNA and protein was extracted. (A) Relative knock-down of either AMPKα subunit α1 and α2 was quantified by real time PCR and normalized to TFIIB expression. (B) Knock-down of AMPKα protein was confirmed by western blotting and ECL. (C) PPARα expression was quantified by real time PCR and normalized to TFIIB expression. RNA was harvested in duplicates, and range is indicated (*, significantly different from control P<0.05). The presented results are representative of at least 3 independent experiments.

  • View in gallery

    Proposed model for glucose-induced repression of PPARα gene expression in pancreatic β-cells. The effect of the potential glucose-stimulated increase in the ATP/AMP ratio on AMPK activity was not addressed but added for completion.

  • Banerjee RR, Rangwala SM, Shapiro JS, Rich AS, Rhoades B, Qi Y, Wang J, Rajala MW, Pocai A, Scherer PE, Steppan CM, Ahima RS, Obici S, Rossetti L & Lazar MA 2004 Regulation of fasted blood glucose by resistin. Science 303 1195–1198.

    • Search Google Scholar
    • Export Citation
  • Brummelkamp TR, Bernards R & Agami R 2002 A system for stable expression of short interfering RNAs in mammalian cells. Science 296 550–553.

    • Search Google Scholar
    • Export Citation
  • Celenza JL & Carlson M 1986 A yeast gene that is essential for release from glucose repression encodes a protein kinase. Science 233 1175–1180.

    • Search Google Scholar
    • Export Citation
  • Chomczynski P & Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry 162 156–159.

    • Search Google Scholar
    • Export Citation
  • da Silva, Leclerc I, Salt IP, Doiron B, Hardie DG, Kahn A & Rutter GA 2000 Role of AMP-activated protein kinase in the regulation by glucose of islet beta cell gene expression. PNAS 97 4023–4028.

    • Search Google Scholar
    • Export Citation
  • Diraison F, Motakis E, Parton LE, Nason GP, Leclerc I & Rutter GA 2004 Impact of adenoviral transduction with SREBP1c or AMPK on pancreatic islet gene expression profile: analysis with oligonucleotide microarrays. Diabetes 53 S84–S91.

    • Search Google Scholar
    • Export Citation
  • El Assaad W, Buteau J, Peyot ML, Nolan C, Roduit R, Hardy S, Joly E, Dbaibo G, Rosenberg L & Prentki M 2003 Saturated fatty acids synergize with elevated glucose to cause pancreatic beta-cell death. Endocrinology 144 4154–4163.

    • Search Google Scholar
    • Export Citation
  • Fryer LG, Parbu-Patel A & Carling D 2002 The Anti-diabetic drugs rosiglitazone and metformin stimulate AMP-activated protein kinase through distinct signaling pathways. Journal of Biological Chemistry 277 25226–25232.

    • Search Google Scholar
    • Export Citation
  • Gimeno-Alcaniz JV & Sanz P 2003 Glucose and type 2A protein phosphatase regulate the interaction between catalytic and regulatory subunits of AMP-activated protein kinase. Journal of Molecular Biology 333 201–209.

    • Search Google Scholar
    • Export Citation
  • Gremlich S, Nolan C, Roduit R, Burcelin R, Peyot ML, Delghingaro-Augusto V, Desvergne B, Michalik L, Prentki M & Wahli W 2004 Pancreatic islet adaptation to fasting is dependent on ppar{alpha} transcriptional up-regulation of fatty acid oxidation. Endocrinology 146 375–382.

    • Search Google Scholar
    • Export Citation
  • Guerre-Millo M, Rouault C, Poulain P, Andre J, Poitout V, Peters JM, Gonzalez FJ, Fruchart JC, Reach G & Staels B 2001 PPAR-alpha-null mice are protected from high-fat diet-induced insulin resistance. Diabetes 50 2809–2814.

    • Search Google Scholar
    • Export Citation
  • Higa M, Zhou YT, Ravazzola M, Baetens D, Orci L & Unger RH 1999 Troglitazone prevents mitochondrial alterations, beta cell destruction, and diabetes in obese prediabetic rats. PNAS 96 11513–11518.

    • Search Google Scholar
    • Export Citation
  • Itoh Y, Kawamata Y, Harada M, Kobayashi M, Fujii R, Fukusumi S, Ogi K, Hosoya M, Tanaka Y, Uejima H, Tanaka H, Maruyama M, Satoh R, Okubo S, Kizawa H, Komatsu H, Matsumura F, Noguchi Y, Shinohara T, Hinuma S, Fujisawa Y & Fujino M 2003 Free fatty acids regulate insulin secretion from pancreatic beta cells through GPR40. Nature 422 173–176.

    • Search Google Scholar
    • Export Citation
  • Jiang R & Carlson M 1996 Glucose regulates protein interactions within the yeast SNF1 protein kinase complex. Genes Development 10 3105–3115.

    • Search Google Scholar
    • Export Citation
  • Kahn BB, Alquier T, Carling D & Hardie DG 2005 AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. Cell Metabolism 1 15–25.

    • Search Google Scholar
    • Export Citation
  • Kawaguchi T, Osatomi K, Yamashita H, Kabashima T & Uyeda K 2002 Mechanism for fatty acid ‘sparing’ effect on glucose-induced transcription: regulation of carbohydrate-responsive element-binding protein by AMP-activated protein kinase. Journal of Biological Chemistry 277 3829–3835.

    • Search Google Scholar
    • Export Citation
  • Koo SH, Flechner L, Qi L, Zhang X, Screaton RA, Jeffries S, Hedrick S, Xu W, Boussouar F, Brindle P, Takemori H & Montminy M 2005 The CREB coactivator TORC2 is a key regulator of fasting glucose metabolism. Nature 437 1109–1111.

    • Search Google Scholar
    • Export Citation
  • Laybutt DR, Sharma A, Sgroi DC, Gaudet J, Bonner-Weir S & Weir GC 2002 Genetic regulation of metabolic pathways in beta-cells disrupted by hyperglycemia. Journal of Biological Chemistry 277 10912–10921.

    • Search Google Scholar
    • Export Citation
  • Leclerc I & Rutter GA 2004 AMP-activated protein kinase: a new beta-cell glucose sensor?: Regulation by amino acids and calcium ions. Diabetes 53 S67–S74.

    • Search Google Scholar
    • Export Citation
  • Leclerc I, Woltersdorf WW, da S, X, Rowe RL, Cross SE, Korbutt GS, Rajotte RV, Smith R & Rutter GA 2004 Metformin, but not leptin, regulates AMP-activated protein kinase in pancreatic islets: impact on glucose-stimulated insulin secretion. American Journal of Physiology, Endocrinology and Metabolism 286 E1023–E1031.

    • Search Google Scholar
    • Export Citation
  • Maedler K, Spinas GA, Dyntar D, Moritz W, Kaiser N & Donath MY 2001 Distinct effects of saturated and monounsaturated fatty acids on beta-cell turnover and function. Diabetes 50 69–76.

    • Search Google Scholar
    • Export Citation
  • Merglen A, Theander S, Rubi B, Chaffard G, Wollheim CB & Maechler P 2004 Glucose sensitivity and metabolism-secretion coupling studied during two-year continuous culture in INS-1E insulinoma cells. Endocrinology 145 667–678.

    • Search Google Scholar
    • Export Citation
  • Minokoshi Y, Kim YB, Peroni OD, Fryer LG, Muller C, Carling D & Kahn BB 2002 Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415 339–343.

    • Search Google Scholar
    • Export Citation
  • Minokoshi Y, Alquier T, Furukawa N, Kim YB, Lee A, Xue B, Mu J, Foufelle F, Ferre P, Birnbaum MJ, Stuck BJ & Kahn BB 2004 AMP-kinase regulates food intake by responding to hormonal and nutrient signals in the hypothalamus. Nature 428 569–574.

    • Search Google Scholar
    • Export Citation
  • Napal L, Marrero PF & Haro D 2005 An intronic peroxisome proliferator-activated receptor-binding sequence mediates fatty acid induction of the human carnitine palmitoyltransferase 1A. Journal of Molecular Biology 354 751–759.

    • Search Google Scholar
    • Export Citation
  • Porras A, Bennett J, Howe A, Tokos K, Bouck N, Henglein B, Sathyamangalam S, Thimmapaya B & Rundell K 1996 A novel simian virus 40 early-region domain mediates transactivation of the cyclin A promoter by small-t antigen and is required for transformation in small-t antigen-dependent assays. Journal of Virology 70 6902–6908.

    • Search Google Scholar
    • Export Citation
  • Ravnskjaer K, Boergesen M, Rubi B, Larsen JK, Nielsen T, Fridriksson J, Maechler P & Mandrup S 2005 Peroxisome proliferator-activated receptor alpha (PPARalpha) potentiates, whereas PPARgamma attenuates, glucose-stimulated insulin secretion in pancreatic beta-cells. Endocrinology 146 3266–3276.

    • Search Google Scholar
    • Export Citation
  • Roche E, Farfari S, Witters LA, Assimacopoulos-Jeannet F, Thumelin S, Brun T, Corkey BE, Saha AK & Prentki M 1998 Long-term exposure of beta-INS cells to high glucose concentrations increases anaplerosis, lipogenesis, and lipogenic gene expression. Diabetes 47 1086–1094.

    • Search Google Scholar
    • Export Citation
  • Roduit R, Morin J, Masse F, Segall L, Roche E, Newgard CB, Assimacopoulos-Jeannet F & Prentki M 2000 Glucose down-regulates the expression of the peroxisome proliferator-activated receptor-alpha gene in the pancreatic beta -cell. Journal of Biological Chemistry 275 35799–35806.

    • Search Google Scholar
    • Export Citation
  • Roduit R, Nolan C, Alarcon C, Moore P, Barbeau A, Delghingaro-Augusto V, Przybykowski E, Morin J, Masse F, Massie B, Ruderman N, Rhodes C, Poitout V & Prentki M 2004 A role for the malonyl-CoA/long-chain acyl-CoA pathway of lipid signaling in the regulation of insulin secretion in response to both fuel and nonfuel stimuli. Diabetes 53 1007–1019.

    • Search Google Scholar
    • Export Citation
  • Salt I, Celler JW, Hawley SA, Prescott A, Woods A, Carling D & Hardie DG 1998a AMP-activated protein kinase: greater AMP dependence, and preferential nuclear localization, of complexes containing the alpha2 isoform. Biochemical Journal 334 177–187.

    • Search Google Scholar
    • Export Citation
  • Salt IP, Johnson G, Ashcroft SJ & Hardie DG 1998b AMP-activated protein kinase is activated by low glucose in cell lines derived from pancreatic beta cells, and may regulate insulin release. Biochemical Journal 335 533–539.

    • Search Google Scholar
    • Export Citation
  • Samari HR, Moller MT, Holden L, Asmyhr T & Seglen PO 2005 Stimulation of hepatocytic AMP-activated protein kinase by okadaic acid and other autophagy-suppressive toxins. Biochemical Journal 386 237–244.

    • Search Google Scholar
    • Export Citation
  • Shaw RJ, Lamia KA, Vasquez D, Koo SH, Bardeesy N, Depinho RA, Montminy M & Cantley LC 2005 The Kinase LKB1 Mediates Glucose Homeostasis in Liver and Therapeutic Effects of Metformin. Science 310 1642–1646.

    • Search Google Scholar
    • Export Citation
  • Shimabukuro M, Zhou YT, Lee Y & Unger RH 1998a Troglitazone lowers islet fat and restores beta cell function of Zucker diabetic fatty rats. Journal of Biological Chemistry 273 3547–3550.

    • Search Google Scholar
    • Export Citation
  • Shimabukuro M, Zhou YT, Levi M & Unger RH 1998b Fatty acid-induced beta cell apoptosis: a link between obesity and diabetes. PNAS 95 2498–2502.

    • Search Google Scholar
    • Export Citation
  • Stein DT, Esser V, Stevenson BE, Lane KE, Whiteside JH, Daniels MB, Chen S & McGarry JD 1996 Essentiality of circulating fatty acids for glucose-stimulated insulin secretion in the fasted rat. Journal of Clinical Investigation 97 2728–2735.

    • Search Google Scholar
    • Export Citation
  • Susini S, Roche E, Prentki M & Schlegel W 1998 Glucose and glucoincretin peptides synergize to induce c-fos, c-jun, junB, zif-268, and nur-77 gene expression in pancreatic beta(INS-1) cells. FASEB Journal 12 1173–1182.

    • Search Google Scholar
    • Export Citation
  • Tordjman K, Standley KN, Bernal-Mizrachi C, Leone TC, Coleman T, Kelly DP & Semenkovich CF 2002 PPARalpha suppresses insulin secretion and induces UCP2 in insulinoma cells. Journal of Lipid Research 43 936–943.

    • Search Google Scholar
    • Export Citation
  • Tugwood JD, Issemann I, Anderson RG, Bundell KR, McPheat WL & Green S 1992 The mouse peroxisome proliferator activated receptor recognizes a response element in the 5′ flanking sequence of the rat acyl CoA oxidase gene. EMBO Journal 11 433–439.

    • Search Google Scholar
    • Export Citation
  • Viollet B, Andreelli F, Jorgensen SB, Perrin C, Geloen A, Flamez D, Mu J, Lenzner C, Baud O, Bennoun M, Gomas E, Nicolas G, Wojtaszewski JF, Kahn A, Carling D, Schuit FC, Birnbaum MJ, Richter EA, Burcelin R & Vaulont S 2003 The AMP-activated protein kinase alpha2 catalytic subunit controls whole-body insulin sensitivity. Journal of Clinical Investigations 111 91–98.

    • Search Google Scholar
    • Export Citation
  • Wang H & Wollheim CB 2002 ChREBP rather than USF2 regulates glucose stimulation of endogenous l-pyruvate kinase expression in insulin-secreting cells. Journal of Biological Chemistry 277 32746–32752.

    • Search Google Scholar
    • Export Citation
  • Woods A, Azzout-Marniche D, Foretz M, Stein SC, Lemarchand P, Ferre P, Foufelle F & Carling D 2000 Characterization of the role of AMP-activated protein kinase in the regulation of glucose-activated gene expression using constitutively active and dominant negative forms of the kinase. Molecular and Cellular Biology 20 6704–6711.

    • Search Google Scholar
    • Export Citation
  • Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, Ueki K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre P, Carling D, Kimura S, Nagai R, Kahn BB & Kadowaki T 2002 Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nature Medicine 8 1288–1295.

    • Search Google Scholar
    • Export Citation
  • Yang SI, Lickteig RL, Estes R, Rundell K, Walter G & Mumby MC 1991 Control of protein phosphatase 2A by simian virus 40 small-t antigen. Molecular and Cellular Biology 11 1988–1995.

    • Search Google Scholar
    • Export Citation
  • Zhang S & Kim KH 1995 Glucose activation of acetyl-CoA carboxylase in association with insulin secretion in a pancreatic beta-cell line. Journal of Endocrinology 147 33–41.

    • Search Google Scholar
    • Export Citation
  • Zhou YT, Shimabukuro M, Koyama K, Lee Y, Wang MY, Trieu F, Newgard CB & Unger RH 1997 Induction by leptin of uncoupling protein-2 and enzymes of fatty acid oxidation. PNAS 94 6386–6390.

    • Search Google Scholar
    • Export Citation
  • Zhou YT, Shimabukuro M, Wang MY, Lee Y, Higa M, Milburn JL, Newgard CB & Unger RH 1998 Role of peroxisome proliferator-activated receptor alpha in disease of pancreatic beta cells. PNAS 95 8898–8903.

    • Search Google Scholar
    • Export Citation
  • Zhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J, Wu M, Ventre J, Doebber T, Fujii N, Musi N, Hirshman MF, Goodyear LJ & Moller DE 2001 Role of AMP-activated protein kinase in mechanism of metformin action. Journal of Clinical Investigation 108 1167–1174.

    • Search Google Scholar
    • Export Citation