Duplicated receptors for VIP and PACAP (VPAC1R and PAC1R) in a teleost fish, Fugu rubripes

in Journal of Molecular Endocrinology
View More View Less
  • 1 1Fugu Genomics group, MRC-HGMP Resource Centre, Genome Campus, Hinxton, Cambridge, UK
  • | 2 2Centre of Marine Sciences, Universidade do Algarve, Campus de Gambelas, 8000-117 Faro, Portugal

Free access

Two principal groups of receptors orthologous with human PAC1R and VPAC1R and were identified and characterised at the genomic level in the teleost fish Fugu rubripes. An additional group orthologous with VPAC2R was also identified and partially characterised. In Fugu, gene duplication of each of the PAC1Rs, VPAC1Rs and VPAC2Rs appears to have occurred. The topology of the tree surrounding the Fugu duplications and other isolated piscine sequences indicates that the duplication events for these six genes clearly preceded the speciation event leading to the Cypriniformes and Tetraodontiformes and is probably teleost-specific. Overall, the combined pattern of gene expression for each pair of duplicated genes mirrored the expression in other vertebrates. However, within each pair of duplicates further specialisation had occurred, with each demonstrating differential tissue distribution profiles suggesting they that may be responsible for the divergent action of the ligands, vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating peptide (PACAP). The Fugu VPAC1R gene regions showed conserved synteny with human chromosome 3p21.3 and also C. elegans chromosome X, indicating that the putative ancestral human chromosome 3 region may be equivalent to chromosome X in Caenorhabditis elegans.


Two principal groups of receptors orthologous with human PAC1R and VPAC1R and were identified and characterised at the genomic level in the teleost fish Fugu rubripes. An additional group orthologous with VPAC2R was also identified and partially characterised. In Fugu, gene duplication of each of the PAC1Rs, VPAC1Rs and VPAC2Rs appears to have occurred. The topology of the tree surrounding the Fugu duplications and other isolated piscine sequences indicates that the duplication events for these six genes clearly preceded the speciation event leading to the Cypriniformes and Tetraodontiformes and is probably teleost-specific. Overall, the combined pattern of gene expression for each pair of duplicated genes mirrored the expression in other vertebrates. However, within each pair of duplicates further specialisation had occurred, with each demonstrating differential tissue distribution profiles suggesting they that may be responsible for the divergent action of the ligands, vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating peptide (PACAP). The Fugu VPAC1R gene regions showed conserved synteny with human chromosome 3p21.3 and also C. elegans chromosome X, indicating that the putative ancestral human chromosome 3 region may be equivalent to chromosome X in Caenorhabditis elegans.


Vasoactive intestinal peptide (VIP) and the related peptide, pituitary adenylate cyclase-activating peptide (PACAP) belong to the glucagon hormone superfamily, which in humans includes secretin, growth hormone-releasing hormone (GHRH), glucagon, glucagon like-peptides 1 and 2 (GLP-1 and GLP-2), peptide histidine methionine (PHM) and glucose-dependent insulinotropic polypeptide (GIP) (Sherwood et al. 2000). These peptides have been grouped into a superfamily because the precursor molecules share a strikingly similar structural organisation, similar amino acid sequences and in general the hormones are related in terms of distribution and function (Bell 1986, Sherwood et al. 2000). They function by binding to the N-terminal extracellular domain of a family of specific G-protein-coupled receptors (GPCRs). Members of this hormone gene family are widespread in many phyla and have been identified in species as ancient as tunicates (McRory & Sherwood 1997). This has prompted the development of numerous models for this family’s evolution (Sherwood et al. 2000) from a single ancestral molecule by the processes of gene and exon duplication.

The genomic structures and evolution of the receptors for these small ligands are not so well characterised. The VIP and PACAP receptors belong to a subset of G-protein-coupled receptors (the class II family) that includes the receptors for GHRH, corticotrophin releasing factor (CRF), calcitonin, secretin, parathyroid hormone (PTH) and parathyroid hormone-related peptide (PTHrP) (Segre & Goldring 1993). The members of this family share amino acid sequence similarity in the seven transmembrane domains and a long N-terminal extracellular domain containing a number of cysteines that are important for ligand binding (Segre & Goldring 1993, Laburthe et al. 1996). All the receptors mediate their action by activation of a G-protein that induces an intracellular signal cascade mediated by heteromeric GTP-binding proteins (Gilman 1987, Bockaert 1991, Ulrich et al. 1998). Ligand-binding studies have demonstrated, in humans, the existence of three VIP-interacting receptors: VPAC1R, VPAC2R and PAC1R (the PACAP type 1 receptor). The VPAC receptors bind both PACAP and VIP ligands with similar affinities, whilst the PACAP type 1 receptor preferentially binds PACAP (Vaudry et al. 2000c). The two human VIP receptors, VPAC1R and VPAC2R, share less than 42% amino acid sequence similarity and have a widespread tissue distribution with different expression patterns for each of the receptors, as demonstrated by RT-PCR and in situ hybridisation studies. VPAC1R is found mainly in the cerebral cortex, hippocampus, pineal gland, lungs and intestines and VPAC2R, which is proposed to be the neuroendocrine receptor for VIP, is found in the hypothalamus, pituitary, adrenal glands, pancreatic islets, testes and ovaries (Usdin et al. 1994, Vaudry et al. 2000a,b). In mammals, PAC1R is expressed predominantly in the CNS, however the situation is more complex, with the production of alternative splice variants (hip-hop cassettes) which influence receptor selectivity for the PACAP38 and PACAP27 ligand isoforms (Spengler et al. 1993, Journot et al. 1994, Pantaloni et al. 1996, Chatterjee et al. 1997, Daniel et al. 1998, Dautzenberg et al. 1999). Isolation and functional characterisation of the PAC1R in goldfish indicates that the PACAP ligand acts as a novel GH-releasing factor in this organism (Wong et al. 2000).

The isolation and characterisation of two VIP receptor subtypes (VPAC1R and VPAC2R) has been reported only in humans (Sreedharan et al. 1993, Gagnon et al. 1994), rat (Ishihara et al. 1992, Lutz et al. 1993) and mouse (Inagaki et al. 1994, Hashimoto et al. 1999) which raises interesting questions about when the gene duplication that gave rise to the two forms occurred. Relatively few receptors of this superfamily have been isolated from non-mammalian vertebrates (Peeters et al. 1999, Alexandre et al. 1999, Hu et al. 2000). In teleosts, only goldfish VPAC1R and PAC1R cDNAs have been isolated (Chow et al. 1997, Wong et al. 1998) and no genomic structures for these receptors have been reported. In the present study the compact genome of the Japanese pufferfish (Fugu rubripes) was used to isolate and characterise the PAC1, VPAC1 and VPAC2 receptor genes at the genomic level. The gene sequences obtained in the present study were also used to search for related genes in the invertebrate databases Caenorhabditis elegans, Ciona intestinalis, Drosophila melanogaster and Saccharomyces cerevisae with the aim of identifying a putative ancestral VIP/PACAP receptor.

Materials and methods

Gene identification and isolation

During routine Fugu cosmid library sequence scanning (within the confines of the Fugu Landmark Mapping Project (Elgar et al. 1999)) a cosmid (C139D21) was identified as having a gene fragment with high sequence similarity to goldfish VPAC1R (probability value in excess of 9e−19). PCR primers were designed for a conserved sequence motif of this family identified after a multiple sequence alignment of all the members of this family and the Fugu cosmid C139D21 partial sequence. A homologous PCR product was obtained with Fugu genomic DNA and used to screen the Fugu cosmid library (available from http://www.hgmp.mrc.ac.uk) at low stringency using 50 °C hybridization temperature in Church Gilbert buffer (1984), followed by a one minute wash at room temperature in Church Gilbert wash buffer. Twenty four further cosmids were isolated and characterised by sequence scanning as described in http://fugu.hgmp.mrc.ac.uk/Protocols/Biology/fugu_section2.html#2.1. The cosmids were sorted into different groups based on DNA sequence similarity, secondary screening of SacI restriction enzyme digest Southern blots and analysis of short-range linkage relationships. Gene content was determined by searching the individual sequence fragments using BLAST v2.0 (Altschul et al. 1997) against the SPTR (Bairoch et al. 1997) and Unigene databases (http://www.ncbi.nlm.nih.gov/Unigene/Hs.home.html).

Cosmids were identified for a single PAC1R gene and for each of two distinct VPAC1R-like and two VPAC2R-like genes. Cosmids for each of the genes were subjected to full-depth sequencing. The cosmid containing PAC1RA lacked the first exon, so this gene was completed using RACE PCR (RACEEx4, 5′actctggacagttgacga3′). A further PAC1R gene was identified from Fugu Consortium data (Aparicio et al. 2002) and mapped to two scaffolds: exons 2 and 3 mapped to scaffold S011651 and S004929 contained exon 6 to the 3′ end. The first exon was identified using RACE PCR (PACAPP2 RACE2 5′accagatgggagcacttcggttcag) as a long series of Ns was present in scaffold S011651 5′ to exon 2. Exons 4 and 5 were amplified using primers designed to exons 2 and 6 (PACAP2Ex3F, 5′ctgtggcatccagctcagat3′; PACAP2Ex6R, 5′tatgtatgaagcagtgctcgtt3′). Probing of a Southern blot, revealed the genomic distance of these two exons to cover approximately 1 kb, but the gene was completed by RT-PCR using Fugu brain cDNA. Fugu database mining revealed no further VIP or PACAP receptors.

For gene assembly, all sequences were transferred to a UNIX environment and quality clipped using a modified Pregap script (Bonfield and Staden 1996). Sequences were screened against sequencing and cloning (pBluescript and Lawrist4) vectors and matching regions were masked prior to further analysis. Edited sequences were then assembled using the Pint Assembly Programe (Weston P, HGMP, unpublished data, http://menu.hgmp.mrc.ac.uk/cgi-bin/pint). Contiguation and finishing of the gene was performed using PCR walks and sequencing of SacI cosmid sub-clones. All genes, unless stated in the results, were fully sequenced at the genomic level. Exons were determined by comparison with other vertebrate VPACR/PAC1R sequences and searching for the GT/AG consensus sequences. Anomalous exon/intron boundaries were confirmed by RT-PCR.

The Fugu VPAC1R, VPAC2R and PAC1R, genes have been submitted to the EMBL database with accession numbers AJ296144, AJ296143, AJ408877, AJ40887, AJ490804 and AJ494861 for VPAC1RA, VPAC1RB, VPAC2RA VPAC2RB, PAC1RA and PAC1RB respectively.

Fugu VIPR/PACAPR gene analysis and database mining

Analysis of the finished sequence was carried out using the HGMP Nix interface (G Williams, P Woollard & P Hingamp, unpublished data, http://www.hgmp.mrc.ac.uk/NIX/). Percentage of identities of the different genes was calculated with the Blosum 62 score table using the Genedoc program (Multiple Sequence Alignment Editor and Shading Utility v2.6.001, (www.psc.edu/biomed/genedoc) and also using the needle programme from the EMBOSS suite of programmes (Rice et al. 2000) (http://www.uk.embnet.org/Software/EMBOSS/Apps/) with a Gap opening penalty of 10.0 and a Gap extension penalty of 0.5. Comparative human gene map positions were determined using the Ensembl viewer (v1.0.0) (http://www.ensembl.org/) and gene names assigned using the HUGO nomenclature accessed via the Ensembl link to LocusLink (http://www.ncbi.nlm.nih.gov/LocusLink/).

Each of the Fugu VIP/PACAP receptor genes were used to search for similar genes in the human, zebrafish, Tetraodon, medaka, C. elegans, D. melanogaster, C. intestinalis and S. cerevisae databases: (http://www.ensembl.org/perl/blastview; http://www.ensembl.org/Danio_rerio/; http://www.genoscope.cns.fr/cgi-bin/recherche.cgi; http://shigen.lab.nig.ac.jp/medaka/genome/top.jsp; http://www.sanger.ac.uk/Projects/C_elegans/blast_server.shtml; http://www.fruitfly.org/blast/; aluminium.jgi-psf.org/prod/bin/RunBlast.pl?db=ciona4 and http://genome-www.stanford.edu/Saccharomyces/. To establish if linkage groups had been maintained during the evolution of the VIP/PACAP receptor genes in Fugu, human and C. elegans, orthologous genes for the genes surrounding Fugu VPAC1R, VPAC2R and PAC1R were searched and mapped in the human and C. elegans genomes using the http://www.ncbi.org/LocusLink and http://www.wormbase.org/db/searches/basic#searchagain web sites.

Phylogenetic analyses

Multiple sequence alignments were carried out using Clustal X (Thompson et al. 1997) and in the Genedoc program (Multiple Sequence Alignment Editor and Shading Utility v2.6.001, (www.psc.edu/biomed/genedoc)). Phylogenetic analysis was carried out from the Clustal X multiple alignment output using both the neighbour joining method (Saitou and Nei et al. 1987) via the PHYLO_WIN interface v1.2 (Galtier et al. 1996) and maximum likelihood method (Felsenstein 1985) via Phylip v3.57c. Multiple alignment parameters for PHYLO_WIN: gap opening 15; gap extension 0.05; delay divergent sequences 40%; DNA transition weight 0.50, with 1000 bootstrap replicates. Maximum likelihood analysis was carried out using the dnaml programme with default parameters and global rearrangements. The human GHRH clone (accession number, P43220) was used as the outgroup for the tree construction.

Tissue-specific expression

Tissue-specific expression of each of the genes was carried out by RT-PCR on eight tissues from different sexually immature juvenile fish (brain, gonads, gut, spleen, liver, kidney, heart and gills) generated by first strand synthesis of mRNA using the Promega Reverse Transcriptase kit according to the manufacturer’s instructions. PCR was carried out on 1μg cDNA using specific primer pairs designed for individual genes and spanning an intron as a control check for potential genomic contamination. Primers pairs for each gene: VPAC1RA (V1AE4 – 5′gtaacctctccaagactggca3′, V1AE5 – 5′tgcgatgaaaaccgtgggac3′); VPAC1RB (V1BE2 – 5′ttcttctctgggaatacgcat3′, V1BE8 – 5′tatggtgcccaaaatgggtgt3′); VPAC2RA (V2AE3 – 5′agcgccgcggtcggagaggtcacg3′, V2AE7 – 5′gccatgacaaagtagttgaag3′); VPAC2RB (V2BE4 – 5′atcttcccaaacatcaccagc3′, V2BE7 – 5′gcggttctcagagaagattac3′); PAC1RA (P1AE2F – 5′ gtggcgtcagagttgaatcac3′, P1AE7R – 5′catcaccgctttgcacggc3′) and PAC1RB (P1BE3F – 5′ctgttggcatccagctcagat3′, P1B6R – 5′tatgtatgaagcagtgctcgtt3′). PCR was performed with an initial denaturing step at 96 °C for 2 min, cycled 35 times (96 °C for 1 min, 62 °C for 1 min, 72 °C for 1 min) with a final extension of 72 °C for 5 min. The VPAC1RA PCR was performed at 67 °C with the same conditions described above. All PCR products of the correct size were sequenced to confirm their identity. To ensure that similar quantities of cDNA were used in all RT-PCR reactions, a further PCR with primers designed for ubiquitously expressed β-actin genes was also performed (data not shown).


Screening of the Fugu genomic cosmid library with a probe generated by PCR to a conserved sequence motif of the family resulted in the identification of four different VIP receptors. They were named VPAC1RA, VPAC1RB, VPAC2RA and VPAC2RB, according to their sequence similarity with the other vertebrate orthologous genes. Due to the difficulty in identifying the duplicated VIP receptor genes at the level of sequence scanning, the individual genes were characterised by their cosmid short-range linkage relationships (Table 1), sequence similarity and restriction digestion patterns. The A and B nomenclature was created to facilitate the distinction between the duplicated genes.

Fugu VPAC1RA and VPAC1RB genes

The Fugu VPAC1RA and VPAC1RB genes were completely sequenced at the genomic level and both code for a 419 amino acid protein, sharing 68% sequence identity. Comparison of the deduced amino acid sequence of VPAC1RA and VPAC1RB revealed they shared 51% and 49% sequence similarity with human VPAC1R and 75% and 64% similarity to goldfish VPAC1R, the only teleost in which the sequence is available. Structurally the Fugu VPAC1R genes are composed of 12 exons and are 14.5 kb (VPAC1RA) and 8.5 kb (VPAC1RB) in length. Exon/intron positioning, splice site sequences and exon/intron boundary phases are identical between the two Fugu sequences. The two genes in Fugu, in common with the goldfish VPAC1R gene (Chow et al. 1997), lack the first exon present in mammals that encodes the signal peptide sequence. To date, only two mammalian VPAC1R genomic sequences from mouse (Hashimoto et al. 1999) and human (Sreedharan et al. 1993) have been characterised. These two genes are both composed of 13 exons and are 16 kb and 23 kb in length respectively. In comparative terms, the genes in Fugu are of a similar size (Fig. 1) and do not show the characteristic gene compaction of this organism (Brenner et al. 1993, Elgar et al. 1999). In general, with the exception of the absent first exon in both Fugu VPAC1Rs, the gene organisation between human and Fugu is very similar, sharing the same splice sites, intron/exon boundary phases and location of the transmembrane domains. Sequence alignment of VPAC1Rs from various species (Fig. 1B) indicate that they are very similar and signature motifs such as the RLAK motif between TM5 and TM6 which has been indicated for the functional coupling to Gsα (Okamoto et al. 1991) and the PDI motif typical of VIP binding receptors, were identified. Other motifs such as, the conserved R and L residues localised within TM2 which have been suggested as being responsible for the receptor activation (Solano et al. 2001) and a highly conserved region at TM7 FQGBBVXXBYCFX NXEXQ which has been designated the consensus signature motif for the mammalian class II family members (Lok et al. 1994), where X and B represent any amino acid residue and any hydrophobic amino acid residue respectively, were also found in Fugu. In addition to these motifs, seven conserved cysteines at the 5′ end and two conserved and three additional putative glycosylation sites were also identified in the Fugu genes (Fig. 1B).

Fugu VPAC2RA and VPAC2RB genes

Two different putative VPAC2R genes were identified in Fugu, VPAC2RA and VPAC2RB. Genomic sequencing of each encompassed 7.4 kb and 12.2 kb respectively, to the 5′ end of each cosmid. Neither of the cosmids containing the two VPAC2R-like genes appeared to contain the 5′ end of the genes, using homology searching and exon prediction software. Despite repeated attempts at RACE PCR, screening of the Fugu Consortium database (http://fugu.hgmp.mcc.ac.uk) and heterologous screening of a sea bream lambda cDNA library, it was not possible to identify the 5′ terminal two exons of either VPAC2R gene (12 exons were characterised). A sea bream clone for a VPAC2R gene was isolated from the cDNA library, but this was truncated at the 5′ end. Comparative analysis of the partial Fugu VPAC2R genes with the VPAC2R sequences from mouse, human, and rat revealed, as already observed for the VPAC1Rs, the presence of seven conserved transmembrane domains (Fig. 2). The conserved motif characteristic of the VIP binding receptors, P/A-D-V and the RLAK motif for the functional coupling to Gsα were also identified. As for Fugu VPAC1R, the consensus signature identified for the mammalian class II family members at the TM7 FQGBBVXXBYCFXNXEVXQ was also identified (Fig. 2).

Fugu PAC1RA and PAC1RB genes

Two PAC1R genes have been identified in Fugu. The first gene (PAC1RA) was identified from heterologous probing of the Fugu cosmid filters and a further gene (PAC1RB) was identified from the Fugu Consortium data (Aparicio et al. 2002). To date only one PAC1RA receptor has been found in other vertebrates and previously only the genomic structure of rat and mouse have been characterised. The estimated sizes of each of the genes in Fugu was determined as 11.2 kb (PAC1RA) and 5.7 kb (PAC1RB), compared with 40 kb and 50+kb for rat and mouse respectively (Hashimoto et al. 1993, Aino et al. 1995), representing a varying compaction rate in Fugu (Fig. 3). Comparative analysis of the deduced amino acid sequence of Fugu PAC1RA and PAC1RB revealed that they are the most conserved of the three family duplications, sharing 74% sequence identity with each other and both share 69% sequence identity with human PAC1R. However, such calculations are more complex with this receptor as the length of the PAC1Rs varies between species from 465 amino acids in Xenopus to 523 amino acids in rat, due to the presence of the hip-hop cassettes which have only been sequenced in some species and were not identified in Fugu. The Fugu PAC1Rs are both 444 amino acids in length and share the same genomic organisation. Comparative analysis of the Fugu PAC1R genes with the PAC1R sequences from other vertebrates revealed the presence of seven conserved transmembrane domains (Fig. 4). All potential conserved cysteines were present in the Fugu sequences and two conserved and two non-conserved N-glycosylation sites were also identified. The conserved motif characteristic of the PACAP binding receptors, PDM and the RLARS motif for the functional coupling to Gsα were also identified and a putative signal peptide sequence, albeit shorter than the sequence reported in mammals. As for the Fugu VIP receptors, the consensus signature identified for the mammalian class II family members at the TM7 FQGBBVXXBYCFXNX EVXQ was also identified (Fig. 4).

Gene analysis and short-range linkage of Fugu VPAC/PAC1 receptor genes

The gene environments linked to each of the Fugu VPACRs were different (Table 1) confirming the identification of four different VIP receptor genes in Fugu. Human VPAC1R is located on chromosome region 3p22. Fugu VPAC1RA was linked to four genes, all of which map in humans to chromosome 3p21.3. In humans, as in Fugu, these genes are neighbours with KIAA1173 directly adjacent to LOC131377, one gene is between LOC131377 and NKTR, one gene is present between NKTR and SEC22C, which is directly next to VPAC1R. VPAC1RB also showed conserved synteny to human chromosome 3. Both of the Fugu VIP receptor genes are linked to LOC131377 and KIAA1173, which clearly represents a regional duplication of all three genes. Fugu VPAC2RA also showed linkage to genes which in human are present on chromosome 3, whilst a third linked gene (KIAA0934) maps to human chromosome 10p15.3. VPAC2RB showed conserved linkage with a gene (KIAA1228) on human chromosome 7q, but interestingly was also linked to two genes (BS69 and KIAA0934), which map in humans to 10p. Once again, there is linkage of both VPAC2R genes to an additional gene (KIAA0934), representing another small regional duplication in Fugu. The two PAC1Rs identified from Consortium data were both present on short scaffolds containing only PAC1R and GHRH, which both map to human region 7p14, and the linkage in Fugu clearly represents a duplication of both of these genes.

In order to search for additional members of this family of genes and to determine the conservation of linked genes through evolution, the human, zebrafish, Tetraodon, medaka, D. melanogaster, C. elegans, C. intestinalis and S. cerevisae databases were searched with the Fugu VIP/PACAP receptor coding sequences. The same sequences were also used to search for additional members in the Fugu genome. No additional members were found in the human and Fugu databases. In Tetraodon, duplicated genes were found for all the VPAC1R, VPAC2R and PAC1R genes (in contigs 002569–2, 000637–2, 027090–1, 016424–1, 005290–1 and 004002–2 respectively, phylogenetic analysis not shown). It was possible to partially characterise these but the contigs lengths were too small to enable comprehensive short-range linkage analysis. Although the zebrafish genome data is currently available at 6x coverage, only two small fragments were putatively identified and designated VPAC2A and PAC1A after phylogenetic analysis (contigs ZC186F16 and ZC87 M5 respectively). The medaka genome data is available at 0.8x coverage and the contigs were too short to enable efficient gene identification. No putative members of the secretin/VIP/PACAP receptors were found in the S. cerevisae, C. intestinalis and D. melanogaster databases.

In the C. elegans database three clones with the accession numbers U21309, Z11126 and AL031620 were found which shared high sequence similarity to the Fugu VIP receptor sequences. These genes mapped within 6 Mb of each other. The C. elegans clone AL31620, located on chromosome X, was the only one with the highest identity for all of the Fugu VPAC/PAC1 receptors (probability in excess of e-24) and a multiple sequence alignment (data not shown) of this clone with the other Fugu VPAC/PAC1 receptors revealed that they shared high sequence similarity for the TM domains. This clone also shared conserved linkage for the calsequestrin gene with the Fugu VPAC1RB. Fugu VPAC1RA was also linked to a gene (NKTR), which in C. elegans mapped to the same chromosome (X) as the putative VPAC1R clone and calsequestrin.

Phylogenetic analysis

Phylogenetic analysis was carried out on VIP/PACAP receptor genes using both the Neighbour Joining and Maximum Likelihood methods. Both methods produced the same relationships, of which the results from the Neighbour Joining method are shown in Fig. 5. The analysis clearly indicates that the ‘extra’ genes in Fugu clustered with the other VPAC1R, VPAC2R and PAC1R genes and not with the closest family members (GHRH and secretin) and confirmed the initial identification made by sequence similarity and linkage. Of the genes considered, only a single PAC1R and VPAC1R have been previously identified and entered in the database from a teleost (goldfish). The topology of the tree surrounding the Fugu duplications and the goldfish sequences indicates that these duplication events preceded the speciation event leading to divergence of the Cypriniformes and Tetraodontiformes. Therefore it is expected that duplicate VPAC1R, VPAC2R and PAC1R genes will be found in other teleosts. The relationship between the three duplications is difficult to determine with low bootstrap values and it is not possible to determine which of the receptors arose first.

Tissue distribution

RT-PCR was carried out using specific primers for each receptor in order to characterise the expression of each of the receptors in different Fugu tissues (data not shown). Although most of the receptors were expressed in gonads, brain and gills, there was clearly a difference in the expression patterns between each of the duplicated genes.


Fugu is the first organism in which duplication of PAC1R, VPAC1R and VPAC2R has been identified. Comparison of the deduced amino acid sequences of the VIP/PACAP receptors from Fugu with other family members isolated from vertebrates revealed that they exhibited greatest sequence similarity to VIP/PACAP receptors and contained all the characteristic features and signature motifs of the class II GPCR family members. Structural comparison of Fugu receptors with the orthologous VPAC1R and PAC1R in humans shows that gene organisation has been highly conserved (as indeed was the case for the partial sections of the Fugu VPAC2Rs). The main difference observed is that the first exon, which in mammalian VPAC1R contains the signal peptide, is absent in both VPAC1R receptors in Fugu. This situation is identical to that of goldfish, in which VPAC1R was cloned as a cDNA and this exon is also absent, although the 5′ UTR is present and the receptor is functional. Studies were carried out using goldfish VPAC1R expressed in a mammalian cell line (Chow 1997) which showed that in goldfish the receptor stimulated the production of cAMP in the transfected cells, suggesting that the amino acids encoded by the first exon are not essential for receptor activity. It remains to be established if the fish VPAC1R is integrated into the cell membrane and the existence of an alternative non-consensus signal peptide sequence in fish remains to be explored. Of the three duplicate receptors in Fugu, the PAC1Rs are the most conserved in terms of sequence similarity and identity, they both encode a putative signal peptide, albeit shorter than that identified in other vertebrates so far. It was not possible to determine whether the Fugu VPAC2R genes contained a signal peptide as the 5′ end remains uncharacterised.

It is thought that all three receptors under study originated from a single ancestral gene which duplicated and subsequently diverged during the course of evolution (Ishihara et al. 1992, Lutz et al. 1993, Pisegna & Wank 1993, Inagaki et al. 1994). However, the topology of the initial branching between the PAC1Rs, VPAC1Rs and VPAC2Rs is not clearly defined, with low bootstraps, and it is not possible to determine which gene represents the more ancestral form of these receptors.

One theory about the evolution of the receptors is based on the chromosomal localisation of the receptors in humans and rats. Both VPAC2R and PAC1R map to human chromosome 7 and rat chromosome 4, whereas VPAC1R is located on human chromosome 3 and rat chromosome 8. A first duplication would produce the VPAC1R gene and a common ancestor for VPAC2R/PAC1R. A second duplication event acting on the ancestral VPAC2R/PAC1R gene would produce the two separate genes (Cai et al. 1995, Sreedharan et al. 1995, Brabet et al. 1996, Mackay et al. 1996, Vaudry et al. 2000c).

Short-range linkage of the Fugu VIP receptor genes with human genes shows conserved synteny for some of the genes, especially for VPAC1R-linked genes on human chromosome region 3p. This situation may be an indicator of a specific gene duplication event that occurred in this particular chromosome in the teleost lineage and so far the locus site for these receptors in fish has still to be mapped, so it is not known whether the Fugu VIP receptors linked to human chromosome 3 genes are very close on the same chromosome or on different chromosomes. VPAC1RB shows conserved synteny for three genes LOC131377, E2BE and KIAA1173, the latter two of which in human are on opposite arms of chromosome 3, megabases apart. However, this is not surprising as studies in both zebrafish (Postlethwait et al. 2000) and Fugu (Bouchireb et al. 2001) have demonstrated that whilst fish may share large blocks of conserved synteny with humans, potentially extending over a whole human chromosome, the gene order can be radically altered by numerous inversion events. Fugu VPAC2RA also shows similar linkage data to the Fugu VPAC1R genes since most of the linked genes identified map to human chromosome 3. Whilst Fugu VPAC2RB shares the same locus as the human VPAC2R gene, as regards linkage to the KIAA1228 gene (7q36.3), there is stronger linkage to human chromosome 10p in the form of two genes linked to VPAC2RB (BS69 and KIAA0934) and additionally VPAC2RA is linked to a further duplicated KIAA0934. It is therefore clear that the duplication event that produced VPAC2RA and VPAC2RB also encompassed these KIAA0934 genes. These data support the idea that VPAC1R and VPAC2R arose from a gene duplication event of a common ancestor and suggest that in teleosts this duplication event occurred within the same chromosome followed by translocation of VPAC2RB away from the putative ancestral 3p region. This was then followed by a further duplication to produce two separate genes VPAC2R and PAC1R, within an environment similar to human chromosome 7. This Fugu linkage data further supports the hypothesis of vertebrate VIP/PACAP receptor evolution based on human chromosomal locations described earlier (Cai et al. 1995, Sreedharan et al. 1995, Brabet et al. 1996, Mackay et al. 1996, Vaudry et al. 2000c).

Phylogenetic analysis suggests that VPAC1RA and VPAC1RB; VPAC2RA and VPAC2RB; and PAC1RA and PAC1RB in Fugu are duplicated forms of the VPAC1R, VPAC2R and PAC1R in other vertebrates. Despite the relatively restricted number of species from which VIP receptors have been isolated, the topology of the phylogenetic tree suggests that duplication of the receptors in Fugu occurred prior to the branch that gave rise to mammals and, in line with current theories, is teleost-specific. In the goldfish and salmon, RT-PCR for VPAC1R with degenerate primers amplified two partial cDNAs for VPAC1R in both species. However, the authors only fully characterised one cDNA as the second fragment was assumed to arise because of the tetraploid nature of the genome in Salmoniformes and Cypriniformes (Chow et al. 1997). However, sequence comparison of the two distinct VPAC1R cDNAs isolated from both salmon and goldfish with the Fugu VPAC1Rs using phylogenetic methods clustered one of each of the goldfish and salmon cDNAs with Fugu VPAC1RA and the others with Fugu VPAC1RB (data not shown). Data-mining of other sequenced fish genomes further supports the timing of these teleost-specific duplication events, as orthologues of all the duplicated Fugu VIP receptors were identified in Tetraodon and a further two for VPAC2A and PAC1A were identified in zebrafish.

It is now a well-established fact that there are ‘extra’ genes in fish (Wittbrodt et al. 1998). However, the process by which these arose is still under debate. One proposal suggests that a further round of whole genome duplication has occurred in the fish lineage (Force et al. 1999, Taylor et al. 2001, 2003, Naruse et al. 2004, Vandepoele et al. 2004, Christoffels et al. 2004). Alternatively, these may have arisen due to a whole series of minor duplication events and not the single large-scale duplication originally proposed (Robinson-Rechavi et al. 2001a,b,c, Hughes et al. 2001). This data (together with the data mining and anecdotal evidence in other fish species) clearly shows that there has been a minimum of several large chromosomal segmental duplications in teleosts involving the VIP receptors, producing further support for the hypothesis of an extra whole genome duplication having taken place in the teleost ancestor. Identification and characterisation of duplicated genes, particularly gene family members, provides important data towards the more large-scale, class-level (Teleostei) phylogenetic analyses cited above. Analysis of these large data sets, whilst necessary for a complete understanding of genome evolution, can contain weaknesses, as the history of specific gene families may not be completely understood or investigated, rendering gene loss and local gene duplications difficult to take into consideration. Analysis of a particular gene family (similar to that presented here) can identify these small-scale events. Whilst the issue of an extra whole genome duplication event in fish remains a contentious issue, the preponderance of polyploid genomes in fish certainly complicates genome analysis and a resolution to this issue. It also raises a further issue, as to why these events occurred and the benefits for the organisms involved. It is generally acknowledged that gene duplication has played a significant role in the metazoan radiation. Further duplications in the fish could have fuelled their incredible speciation, as they comprise over half of all vertebrate species and unlike mammals their genomes (and the ploidy levels) are not constrained by a rigid sex chromosome system. The procession of duplicated genes with differential expression patterns may also, to a certain extent, obviate the need for alternative splicing.

The four VPAC and 2 PAC1 receptors identified in Fugu were used to search for receptor homologues in the C. elegans genome (Fig. 6). A single gene localised on chromosome X that shared a high level of sequence similarity with all the Fugu VPAC1Rs was identified and assumed to be an ancestral form of VIP/PACAP receptor (AL31620, probability value higher than e−24 using BLASTX). It was considered that short-range gene linkage analysis might help to substantiate the phylogenetic model of how the VIP receptors evolved from the ancestral form in C. elegans. Fugu VPAC1RA is linked to the gene calsequestrin, which is also present in C. elegans (Z69792) on the same chromosome as the putative ancestral VPAC1R. Additionally, VPAC1RA shows linkage to another gene (NKTR) which maps in C. elegans (U40938) to chromosome X. Taken as a whole, this data potentially indicates that the ancestral VPAC1R gene and immediate gene environment in C. elegans was on chromosome X (Fig. 6) and that this may be equivalent to the putative ancestral human chromosome 3 region.

The widespread tissue distribution of the two VIP receptors in mammals may explain why VIP has such a wide spectrum of activity. In mammals it is an important regulator of the digestive tract (Ulrich et al. 1998), it is also involved in the immune (Pozo et al. 2000), reproductive (Usdin et al. 1994), circulatory (Fahrenkrug 1993) and neuroendocrine systems (Vijayan et al. 1979, Biancani et al. 1985, Sherwood et al. 2000).

In fish, far fewer studies of VIP function exist but it has been proposed to be of importance in osmoregulation (Mainoya and Bern 1984, Chow 1997). The tissue distribution of the receptor in Fugu should provide clues about the potential activities of VIP in fish. In fact, Fugu VIP receptors have a tissue distribution reminiscent of that observed for VPAC1R and VPAC2R in mammals (Hashimoto et al. 1993, Usdin et al. 1994). The Fugu VPAC receptors are all present in gonads with varied expression profiles in the other different tissues (VPAC1RA is additionally present in spleen, brain, kidney and gills; VPAC1RB in brain; VPAC2RA in heart and gut and VPAC2RB present in all tissues tested except gonads). Both VPAC1R and VPAC2R were identified in mammal heart and gut (Ishihara et al. 1992, Gagnon et al. 1994, Usdin et al. 1994) but in Fugu only VPAC2R was present. RT-PCR in Fugu, using primers specific for each receptor form, demonstrated that there is some overlap in tissue distribution of the duplicated VPAC1R genes in brain and gonads and of the duplicated VPAC2R genes in gonads, heart and gut. The only other study in fish is on goldfish VPAC1R (Chow 1997) but it is unclear if the primers used in the study hybridised to other forms of the receptor, making it difficult to directly compare Fugu and goldfish VPAC1R tissue distribution. Surprisingly although VPAC1R has been detected in the gut of human, rat and goldfish (Sreedharan et al. 1993, Usdin et al. 1994, Chow 1997) it was absent in Fugu. This may merely reflect the position of the sample of Fugu gut collected, as VIP receptors have a differential distribution in this tissue (Sayadi et al. 1988, Korman et al. 1989). It should be noted that further overlap of tissue expression may occur between these six receptors, as the RT-PCRs were only carried out on single tissues from juvenile fish and developmental differences may also occur. In view of the fact that Fugu tissue availability is limited, expression and functional studies of these receptors is being further characterised in a more amenable teleost, Sparus aurata (sea bream).

The PACAP ligand is remarkably well conserved in evolution between protochordates and mammals indicating that it is involved in important biological functions (McRory & Sherwood 1997). It shows a wide tissue distribution in mammals, notably in the brain and in peripheral organs such as the pancreas, gonads and respiratory and urogenital tracts (Vaudry et al. 2000c). Similarly, the PACAP type 1 receptor shows a broad spectrum of tissue expression, however it is predominantly expressed in the CNS (D’Agata et al. 1996, Basille et al. 2000) where it is thought to act not only as a hypophysiotropic hormone, but also as a neurotransmitter and/or neuromodulator (Hashimoto et al. 1993, Ogi et al. 1993, Peeters et al. 1999). The correlation between ligand and receptor distribution is more difficult to make in the case of PACAP compared with the VIPs, as the PACAP ligand can also interact with the VIP receptors. The distribution in Fugu is interesting as the two receptors show quite different distribution patterns, although overall the expression patterns of the two receptors combined in Fugu mirror the tissue distribution in mammals. PAC1RB shows a universal tissue distribution on all tissues tested except for the gonads, which is very similar to the situation found in mammals. Whereas PAC1RA is much more restricted in that it only shows expression in the brain, gonads and gills, with predominant expression in the former two tissues. Clearly there has been a redefinition of expression patterns between these two receptors, with PAC1RA developing the more specialised role. The only other study in fish is on goldfish PAC1R (Wong et al. 1998). RT experiments revealed a generalised low level of expression throughout all 11 tissues tested, with predominant expression in the heart, brain and pituitary. However, the identities of the RT products were only confirmed by hybridisation and therefore they could have potentially cross-hybridised with both receptor forms, making it difficult to directly compare the Fugu and goldfish PAC1R tissue distribution. The phylogenetic analysis of the receptors indicates that the goldfish sequence is the orthologue of the Fugu PAC1RA and therefore, based on the results presented here, expression of the goldfish receptor would be expected to have a restricted tissue distribution. Further work will be required on a wider range of teleosts to determine if there is species-specific tissue distribution of the PAC1Rs, which reflects physiological differences between fish.

The reason why VPAC1R, VPAC2R and PAC1R genes have persisted in duplicate in Fugu and have overlapping expression patterns is still unknown. Under the classical model of evolution, duplicate genes survive by altering function, either by one becoming a pseudogene, by amino acid alterations or complementary degenerate mutation of the promotor regions to produce alternate and maybe very different functions (sub-functionalisation) (Force et al. 1999, Lynch & Conery 2000). Promotor analysis of these genes in Fugu has not yet been carried out, due to lack of 5′ genomic data for some of the genes, but considering the tissue distribution, whilst each gene may perform a similar overall function, they may have alternate distinct tissue-specific functions specific to the fish lineage.

Gene evolution is a complex issue, which in fish is further complicated by the plasticity of the genome and capacity to accommodate ‘extra’ genes. However, comparison of genomic regions in humans, fish and more ancient organisms can help to reconstruct ancestral genomic regions. Although fish diverged from the tetrapod lineage approximately 450 Ma, it would be wrong to assume that their development has been static. Genes in fish, which are also present in human, have been adapted throughout that 450 Ma span to accommodate their different lifestyles in aquatic and land environments. Interestingly, despite extensive database searching, heterologous probing and degenerate PCR experiments, it has not been possible to identify either a secretin receptor or ligand in Fugu and therefore we propose that the duplication that gave rise to secretin and its receptor occurred after the divergence of fish from the tetrapod lineage 450 Ma. The exact nature of the function of the four VIP and two PACAP receptor genes in Fugu described here, and their relationship to the mammalian orthologues remains to be determined, but no doubt will produce interesting results about the adaptation to the aquatic environment and osmoregulation.

Table 1

VIP receptor genes in Fugu , humans (VPAC1R and VPAC2R) and C. elegans (AL031620) and their short-range linkage relationships. Fugu genes are listed according to their order in the Fugu genome. Human chromosome positions are indicated in brackets and the putative C. elegans homologous genes are characterised by their probability value obtained by sequence comparison and chromosome position.

Gene descriptionHuman homologue genePutative C. elegans homologue genes
FuguVIPR and linked genes
HypotheticalProtein of unknown functionKIAA1173 (3p24.3-p22.1)Z93395 (0.995) II
LOC131377Kelch-related protein 1 (Sarcosin)LOC131377 (3p21.32)AF067946 (6.1e-32)
NKTRNatural killer tumor recognition proteinNKTR (3p23-p21)U40938 (1.61e-30) X
SEC22CVesicle trafficking proteinSEC22C (3p24.3-p22.1)Not found
VPAC1RAVasoactive intestinal peptide receptor 1AVPAC1R (3p22)AL31620 (7.7e-27) X
CASQCalsequestrin muscle skeletal isoform percursorCASQ (1q21)Z69792 (1.5e-09) X
E2BETranslation intiation factor EIF-2B epsilon subunitE2BE (3q27.1-q24)Z54284 (7.8e-12) II
VPAC1RBVasoactive intestinal peptide receptor 1BVPAC1R (3p22)AL31620 (2.5e-27) X
LOC131377Kelch-related protein 1 (Sarcosin)LOC131377 (3p21.32)AF067946 (6.1e-32)
HypotheticalProtein of unknown functionKIAA1173 (3p24.3-p22.1)Z93395 (0.995) II
HypotheticalHypothetical protein of unknown functionKIAA0934 (10p15.3)Not found
VPAC2RAVasoactive intestinal peptide receptor 2AVPAC2R (7q36.3)AL31620 (1.5e-24) X
KIAA1585Protein fragment of unknown functionKIAA1585 (3p12.3-q24)Not found
TNSF10Tumor necrosis factor ligand superfamily member 10TNSF10 (3q26.31)Not found
BS69Adenovirus 5 E1-A binding proteinBS69 (10p14)AF003389 (2.0e-10)
HypotheticalHypothetical protein of unknown functionKIAA0934 (10p15.3)Not found
KIAA1228Protein Kinase conserved region 2-protein fragmentKIAA1228 (7q36.3)U13019 (3.6e-29) III
VPAC2RBVasoactive intestinal peptide receptor 2BVPAC2R (7q36.3)AL31620 (7.7e-30) X
PAC1RAPituitary adenylate-cyclase activating polypeptide receptor 1PAC1R (7p14)AL31620 (3.8e-30)
GHRHRGrowth Hormone Releasing Factor ReceptorGHRHR (7p14)AL31620 (8.0e-23)
PAC1RBPituitary adenylate-cyclase activating polypeptide receptor 1PAC1R (7p14)AL31620 (3.8e-30)
GHRHRGrowth Hormone Releasing Factor ReceptorGHRHR (7p14)AL31620 (8.0e-23)
Figure 1
Figure 1
Figure 1

(A) Schematic representation of Fugu VPAC1RA and VPAC1RB genes and comparison with the orthologous human VPAC1R. The gene sizes are indicated next to each gene on the right, exons are numbered and are represented by closed boxes and a solid black line indicates introns. Arrows between the Fugu VPAC1R genes and the human VPAC1R gene indicate equivalent exons. The largest intron in both Fugu genes is located between exons 2 and 3 and is 5kb in VPAC1RA and 2.5kb in VPAC1RB. Sizes are indicated next to each gene on the right, exons are numbered and are represented by closed boxes and the introns by a black line. (B) Clustal X alignment of the protein-coding region of Fugu VPAC1R genes with other known VPAC1Rs. The transmembrane domains are annotated above the sequence. Conserved cysteines are annotated with a circle and potential conserved N-glycosylation sites with a triangle. All motifs characteristic of the VPAC1R genes are annotated with open boxes. Transmembrane domains (TM) and signal peptide sequences were identified by sequence comparison and according to GPCR database (www.cmbi.ni/7tm/) using the Swiss-Prot annotation. Accession numbers of the sequences are: mouse, P97751; rat, P97751; human, P32241; pig, Q28992; frog, Q9YHC6 and goldfish, Q90308. The chicken sequence is taken from Kansaku et al. 2001.

Citation: Journal of Molecular Endocrinology 33, 2; 10.1677/jme.1.01575

Figure 2
Figure 2

Transmembrane domains (TM) and signal peptide sequences were identified by sequence comparison and according to the GPCR database (www.cmbi.ni/7tm/) using the Swiss-Prot annotation. Clustal X alignment of the protein-coding region of Fugu VPAC2R genes with other known VPAC2Rs. The transmembrane domains are annotated above the sequence. Conserved cysteines are annotated with a circle and potential conserved N-glycosylation sites with a triangle. All motifs characteristic of the VPAC2R genes are annotated with open boxes. Transmembrane domains (TM) and signal peptide sequences were identified by sequence comparison and according to the GPCR database (www.cmbi.ni/7tm/) using the Swiss-Prot annotation. Accession numbers of the sequences used are: mouse, P41588; rat, P35000; human, P41587.

Citation: Journal of Molecular Endocrinology 33, 2; 10.1677/jme.1.01575

Figure 3
Figure 3

Comparison between rat PAC1R and the two orthologous genes in Fugu (PAC1RA; PAC1RB). The gene sizes are indicated next to each gene on the right, exons are numbered and are represented by closed boxes and the introns by a black line.

Citation: Journal of Molecular Endocrinology 33, 2; 10.1677/jme.1.01575

Figure 4
Figure 4

Clustal X alignment of the Fugu PAC1R protein coding regions with other known PAC1Rs. The transmembrane domains are annotated above the sequence. Conserved cysteines are annotated by a circle and potential conserved N-glycosylation sites are marked with a triangle. The alternatively spliced hop cassette is shown with a dotted box. Transmembrane domains (TM) and signal peptide sequences were identified by sequence comparison and according to the GPCR database (www.cmbi.ni/7tm/) using the Swiss-Prot annotation. Accession numbers of the sequences used are mouse, P70205; rat, P32215; human, P41586; bovine, D17290 and goldfish, AF048820. The chicken gene is taken from Peeters et al. 1999.

Citation: Journal of Molecular Endocrinology 33, 2; 10.1677/jme.1.01575

Figure 5
Figure 5

Phylogenetic analysis of the Fugu VIP/PACAP receptor sequences with other known related receptors of the class II family. Names and abbreviations and accession numbers for all the sequences shown: rat VPAC1, P97751; rat VPAC2 , P35000; rat PAC1, P32215; rat sec, P23811; human V PAC1, P32241; human VPAC2, P41587; human PAC1, P41586; human sec, P47872; human GHRH, P43220 (used as the outgroup); mouse VPAC1, P97751; mouse VPAC2, P41587; mouse PAC1, P70205; frog VPAC1, Q9YHC6; pig VPAC1, Q28992; goldfish VPAC1, Q90308; goldfish PAC1, O73769; cattle PAC1, Q29627; toad PAC1, Q9PTK1; Fugu VPAC1A, AJ296144; Fugu VPAC1B, AJ296143; Fugu VPAC2A, AJ408877; Fugu VPAC2B, AJ408878; Fugu PAC1A, AJ490804; Fugu PAC1B, AJ494861; rabbit sec, O46502. The chicken sequences for VPAC1 and PAC1 were taken from Kansaku et al. 2001 and Peeters et al. 1999 respectively. Sec, secretin receptor.

Citation: Journal of Molecular Endocrinology 33, 2; 10.1677/jme.1.01575

Figure 6
Figure 6

Comparative maps showing conserved linkage between Fugu, human and C. elegans. The chromosome positions of the genes in human and C. elegans are given in Mb and annotated next to the gene name. KIAA1173, LOC131377, NKTR, SEC22C and VPAC1R in human all map to a gene cluster on 3p21.32 which contains only two other genes.

Citation: Journal of Molecular Endocrinology 33, 2; 10.1677/jme.1.01575


These authors contributed equally to this work.

This work was supported by an MRC grant to MSC and GE and an FCT pluriannual grant to CCMAR, Portugal. DMP was in receipt of a sabbatical grant (BLS58, FCT, Portugal). JCRC was funded by FCT, Portugal (grant, BD/19925/99).


  • Aino H, Hashimoto H, Ogawa N, Nishino A, Yamamoto K, Nogi H, Nagata S & Baba A 1995 Structure of the gene encoding the mouse pituitary adenylate cyclase-activating polypeptide receptor. Gene 164 301–304.

    • Search Google Scholar
    • Export Citation
  • Alexandre D, Anouar Y, Jegou S, Fournier A & Vaudry H 1999 A cloned frog vasoactive intestinal polypeptide/pituitary adenylate cyclase-activating polypeptide receptor exhibits pharmacological and tissue distribution characteristics of both VPAC1 and VPAC2 receptors in mammals. Endocrinology 140 1285–1293.

    • Search Google Scholar
    • Export Citation
  • Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25 3389–3402.

    • Search Google Scholar
    • Export Citation
  • Aparicio S, Chapman J, Stupka E, Putnam N, Chia J, Dehal P, Chistoffels A, Rash S, Hoon S, Smit A et al.2002 Whole-genome shortgun assembly and analysis of the genome of Fugu rubripes. Science 297 1301–1310.

    • Search Google Scholar
    • Export Citation
  • Bairoch A, Bucher P & Hofmann K 1997 The PROSITE database, its status in 1997. Nucleic Acids Research 25 217–221.

  • Basille M, Vaudry D, Coulouarn Y, Jegou S, Lihrmann I, Fournier A, Vaudry H & Gonzalez BJ 2000 Distribution of PACAP receptor mRNAs and PACAP binding sites in the rat brain during development. Annals of the New York Academy of Sciences 921 304–307.

    • Search Google Scholar
    • Export Citation
  • Bell GI 1986 The glucagon superfamily: precursor structure and gene organization. Peptides 7 27–36.

  • Biancani P, Walsh J & Behar J 1985 Vasoactive intestinal peptide: a neurotransmitter for relaxation of the rabbit internal anal sphincter. Gastroenterology 89 867–874.

    • Search Google Scholar
    • Export Citation
  • Bockaert J 1991 G proteins and G-protein-coupled receptors: structure, function and interactions. Current Opinion in Neurobiology 1 32–42.

    • Search Google Scholar
    • Export Citation
  • Bonfield JK & Staden R 1996 Experiment files and their application during large-scale sequencing projects. DNA Sequence 6 109–117.

  • Bouchireb N, Grutzner F, Haaf T, Stephens RJ, Elgar G, Green AJ & Clark MS 2001 Comparative mapping of the human 9q34 region in Fugu rubripes. Cytogenetics Cell Genetics 94 173–179.

    • Search Google Scholar
    • Export Citation
  • Brabet P, Diriong S, Journot L, Bockaert J & Taviaux S 1996 Localization of the human pituitary adenylate cyclase-activating polypeptide receptor (PACAP1-R) gene to 7p15-p14 by fluorescence in situ hybridization. Genomics 38 100–102.

    • Search Google Scholar
    • Export Citation
  • Brenner S, Elgar G, Sandford R, Macrae A, Venkatesh B & Aparicio S 1993 Characterization of the pufferfish (Fugu) genome as a compact model vertebrate genome. Nature 366 265–268.

    • Search Google Scholar
    • Export Citation
  • Cai Y, Xin X, Yamada T, Muramatsu Y, Szpirer C & Matsumoto K 1995 Assignments of the genes for rat pituitary adenylate cyclase activating polypeptide (Adcyap1) and its receptor subtypes (Adcyap1r1, Adcyap1r2, and Adcyap1r3). Cytogenetics Cell Genetics 71 193–196.

    • Search Google Scholar
    • Export Citation
  • Chatterjee TK, Liu X, Davisson RL & Fisher RA 1997 Genomic organization of the rat pituitary adenylate cyclase-activating polypeptide receptor gene. Alternative splicing within the 5′-untranslated region. Journal of Biological Chemistry 272 12122–12131.

    • Search Google Scholar
    • Export Citation
  • Chow BK 1997 The goldfish vasoactive intestinal polypeptide receptor: functional studies and tissue expression. Fish Physiology and Biochemistry 17 213–222.

    • Search Google Scholar
    • Export Citation
  • Chow BK, Yuen TT & Chan KW 1996 Molecular evolution of vertebrate VIP receptors and functional characterization of a VIP receptor from goldfish Carassius auratus. General and Comparative Endocrinology 105 176–185.

    • Search Google Scholar
    • Export Citation
  • Church GM & Gilbert W 1984 Genomic sequencing. PNAS USA 81 1991–1995.

  • Christoffels A, Koh EGL, Chia J-M, Brenner S, Aparicio S & Venkatesh B 2004 Fugu genome analysis provides evidence for a whole-genome duplication early during the evolution of ray-finned fishes. Molecular Biology and Evolution 21 1146–1151.

    • Search Google Scholar
    • Export Citation
  • D’Agata V, Cavallaro S, Stivala F & Canonico PL 1996 Tissue-specific and developmental expression of pituitary adenylate cyclase-activating polypeptide (PACAP) receptors in rat brain. European Journal of Neuroscience 8 310–318.

    • Search Google Scholar
    • Export Citation
  • Daniel PB, Kieffer TJ, Leech CA & Habner JF 1998 Novel alternatively spliced exon in the extracellular ligand-binding domain of the pituitary adenylate cyclase activating polypeptide (PACAP) type I receptor PAC1R selectively increases ligand affinity and alters signal transduction coupling during spematogenesis. Journal of Biological Chemistry 276 12938–12944.

    • Search Google Scholar
    • Export Citation
  • Dautzenberg FM, Mevenkamp G, Wille S & Hauger RL 1999 N-terminal splice variants of the type I PACAP receptor: isolation, characterization and ligand binding/selectivity determinants. Journal of Neuroendocrinology 11 941–949.

    • Search Google Scholar
    • Export Citation
  • Elgar G, Clark MS, Meek S, Smith S, Warner S, Edwards YJ, Bouchireb N, Cottage A, Yeo GS, Umrania Y et al.1999 Generation and analysis of 25 Mb of genomic DNA from the pufferfish Fugu rubripes by sequence scanning. Genome Research 9 960–971.

    • Search Google Scholar
    • Export Citation
  • Fahrenkrug J 1993 Transmitter role of vasoactive intestinal peptide. Pharmacology and Toxicology 72 354–363.

  • Felsenstein J 1985 Confidence limits on phylogenies an approach using the bootstrap Evolution 39 783–791.

  • Force A, Lynch M, Pickett FB, Amores A, Yan YL & Postlethwait J 1999 Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151 1531–1545.

    • Search Google Scholar
    • Export Citation
  • Gagnon AW, Aiyar N & Elshourbagy NA 1994 Molecular cloning and functional characterization of a human liver vasoactive intestinal peptide receptor. Cellular Signalling 6 321–333.

    • Search Google Scholar
    • Export Citation
  • Galtier N, Gouy M & Gautier C 1996 SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny. Computer Applied Biosciences 12 543–548.

    • Search Google Scholar
    • Export Citation
  • Gilman AG 1987 G proteins: transducers of receptor-generated signals. Annual Review of Biochemistry 56 615–649.

  • Hashimoto H, Ishihara T, Shigemoto R, Mori K & Nagata S 1993 Molecular cloning and tissue distribution of a receptor for pituitary adenylate cyclase-activating polypeptide. Neuron 11 333–342.

    • Search Google Scholar
    • Export Citation
  • Hashimoto H, Nishino A, Shintani N, Hagihara N, Copeland NG, Jenkins NA, Yamamoto K, Matsuda T, Ishihara T, Nagata S et al.1999 Genomic organization and chromosomal location of the mouse vasoactive intestinal polypeptide 1 (VPAC1) receptor. Genomics 58 90–93.

    • Search Google Scholar
    • Export Citation
  • Hu Z, Lelievre V, Chao A, Zhou X & Waschek JA 2000 Characterization and messenger ribonucleic acid distribution of a cloned pituitary adenylate cyclase-activating polypeptide type I receptor in the frog Xenopus laevis brain. Endocrinology 141 657–665.

    • Search Google Scholar
    • Export Citation
  • Hughes AL, da Silva J & Friedman R 2001 Ancient genome duplications did not structure the human hox-bearing chromosomes. Genome Research 11 771–780.

    • Search Google Scholar
    • Export Citation
  • Inagaki N, Yoshida H, Mizuta M, Mizuno N, Fujii Y, Gonoi T, Miyazaki J & Seino S 1994 Cloning and functional characterization of a third pituitary adenylate cyclase-activating polypeptide receptor subtype expressed in insulin-secreting cells. PNAS 91 2679–2683.

    • Search Google Scholar
    • Export Citation
  • Ishihara T, Shigemoto R, Mori K, Takahashi K & Nagata S 1992 Functional expression and tissue distribution of a novel receptor for vasoactive intestinal polypeptide. Neuron 8 811–819.

    • Search Google Scholar
    • Export Citation
  • Journot L, Spengler D, Pantaloni C, Dumuis A, Sebben M & Bockaert J 1994 The PACAP receptor: generation by alternative splicing of functional diversity among G protein-coupled receptors in nerve cells. Seminars in Cell Biology 5 263–272.

    • Search Google Scholar
    • Export Citation
  • Kansaku N, Shimada K, Ohkubo T, Saito N, Suzuki T, Matsuda Y & Zadworny D 2001 Molecular cloning of chicken vasoactive intestinal polypeptide receptor complementary DNA, tissue distribution and chromosomal localization. Biology of Reproduction 64 1575–1581.

    • Search Google Scholar
    • Export Citation
  • Korman LY, Sayadi H, Bass B, Moody TW & Harmon JW 1989 Distribution of vasoactive intestinal polypeptide and substance P receptors in human colon and small intestine. Digestive Diseases and Sciences 34 1100–1108.

    • Search Google Scholar
    • Export Citation
  • Laburthe M, Couvineau A, Gaudin P, Maoret JJ, Rouyer-Fessard C & Nicole P 1996 Receptors for VIP, PACAP, secretin, GRF, glucagon, GLP-1, and other members of their new family of G protein-linked receptors: structure-function relationship with special reference to the human VIP-1 receptor. Annals of the New York Academy of Sciences 805 94–109.

    • Search Google Scholar
    • Export Citation
  • Lok S, Kuijper JL, Jelinek LJ, Kramer JM, Whitmore TE, Sprecher CA, Mathewes S, Grant FJ, Biggs SH, Rosenberg GB, et al. 1994 The human glucagon receptor encoding gene: structure, cDNA sequence and chromosomal localization. Gene 140 203–209.

    • Search Google Scholar
    • Export Citation
  • Lutz EM, Sheward WJ, West KM, Morrow JA, Fink G & Harmar AJ 1993 The VIP2 receptor: molecular characterisation of a cDNA encoding a novel receptor for vasoactive intestinal peptide. FEBS Letters 334 3–8.

    • Search Google Scholar
    • Export Citation
  • Lynch M & Conery JS 2000 The evolutionary fate and consequences of duplicate genes. Science 290 1151–1155.

  • Mackay M, Fantes J, Scherer S, Boyle S, West K, Tsui LC, Belloni E, Lutz E, Van Heyningen V & Harmar AJ 1996 Chromosomal localization in mouse and human of the vasoactive intestinal peptide receptor type 2 gene: a possible contributor to the holoprosencephaly 3 phenotype. Genomics 37 345–353.

    • Search Google Scholar
    • Export Citation
  • Mainoya JR & Bern HA 1984 Influence of vasoactive intestinal polypeptide urotensin II on the absorption of water and NaCl by the anterior intestine of the tilapia, Sarotherodon mossambicus. Zoological Science 1 100–105.

    • Search Google Scholar
    • Export Citation
  • McRory J & Sherwood NM 1997 Two protochordate genes encode pituitary adenylate cyclase-activating polypeptide and related family members. Endocrinology 138 2380–2390.

    • Search Google Scholar
    • Export Citation
  • Naruse K, Tanaka M, Mita K, Shima A, Postlethwait J & Mitani H 2004 A medaka gene map: the trace of ancestral vertebrate proto-chromosomes revealed by comparative gene mapping. Genome Research 14 820–828.

    • Search Google Scholar
    • Export Citation
  • Ogi K, Miyamoto Y, Masuda Y, Habata Y, Hosoya M, Ohtaki T, Masuo Y, Onda H & Fujino M 1993 Molecular cloning and functional expression of a cDNA encoding a human pituitary adenylate cyclase activating polypeptide receptor. Biochemistry and Biophysical Research Communications 196 1511–1521.

    • Search Google Scholar
    • Export Citation
  • Okamoto T, Murayama Y, Hayashi Y, Inagaki M, Ogata E & Nishimoto I 1991 Identification of a Gs activator region of the beta 2-adrenergic receptor that is autoregulated via protein kinase A–dependent phosphorylation. Cell 67 723–730.

    • Search Google Scholar
    • Export Citation
  • Pantaloni C, Brabet P, Bilanges B, Dumuis A, Houssami S, Spengler D, Bockaert J & Journot L 1996 Alternative splicing in the N-terminal extracellular domain of the pituitary adenylate cyclase-activating polypeptide (PACAP) receptor modulates receptor selectivity and relative potencies of PACAP-27 and PACAP-38 in phospholipase C activation. Journal of Biological Chemistry 271 22146–22151.

    • Search Google Scholar
    • Export Citation
  • Peeters K, Gerets HH, Princen K & Vandesande F 1999 Molecular cloning and expression of a chicken pituitary adenylate cyclase-activating polypeptide receptor. Molecular Brain Research 71 244–255.

    • Search Google Scholar
    • Export Citation
  • Pisegna JR & Wank SA 1993 Molecular cloning and functional expression of the pituitary adenylate cyclase-activating polypeptide type I receptor. PNAS 90 6345–6349.

    • Search Google Scholar
    • Export Citation
  • Postlethwait JH, Woods IG, Ngo-Hazelett P, Yan YL, Kelly PD, Chu F, Huang H, Hill-Force A & Talbot WS 2000 Zebrafish comparative genomics and the origins of vertebrate chromosomes. Genome Research 10 1890–1902.

    • Search Google Scholar
    • Export Citation
  • Pozo D, Guerrero JM & Calvo JR 2000 Functional and molecular characterization of VIP receptor–effector system in rat developing immunocompetent cells: G protein involvement. Journal of Neuroimmunology 103 41–50.

    • Search Google Scholar
    • Export Citation
  • Rice R, Longden I & Bleasby A 2000 EMBOSS: The European Molecular Biology Open Software Suite. Trends in Genetics 16 276–277.

  • Robberecht P, Waelbroeck M, Camus JC, De Neef P & Chrisptophe J 1984 Importance of disulphide bonds in receptors for vasoactive intestinal peptide and secretin in rat pancreatic plasma membranes. Biochimica et Biophysica Acta 773 271–278.

    • Search Google Scholar
    • Export Citation
  • Robinson-Rechavi M & Laudet V 2001a Evolutionary rates of duplicate genes in fish and mammals. Molecular Biology and Evolution 18 681–683.

    • Search Google Scholar
    • Export Citation
  • Robinson-Rechavi M, Marchand O, Escriva H, Bardet PL, Zelus D, Hughes S & Laudet V 2001b Euteleost fish genomes are characterized by expansion of gene families. Genome Research 11 781–788.

    • Search Google Scholar
    • Export Citation
  • Robinson-Rechavi M, Marchand O, Escriva H & Laudet V 2001c An ancestral whole-genome duplication may not have been responsible for the abundance of duplicated fish genes. Current Biology 11 458–459.

    • Search Google Scholar
    • Export Citation
  • Saitou N & Nei M 1987 The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4 406–425.

    • Search Google Scholar
    • Export Citation
  • Sayadi H, Harmon JW, Moody TW & Korman LY 1988 Autoradiographic distribution of vasoactive intestinal polypeptide receptors in rabbit and rat small intestine. Peptides 9 23–30.

    • Search Google Scholar
    • Export Citation
  • Segre GV & Goldring GS 1993 Receptors for secretin, calcitonin, parathyroid hormone (PTH/PTH-related peptide), glucagon-like peptide 1, growth hormone-releasing homone, and glucagon belong to a newly discovered G-protein-linked receptor family. Trends in Endocrinology and Metabolism 4 309–314

    • Search Google Scholar
    • Export Citation
  • Sherwood NM, Krueckl SL & McRory JE 2000 The origin and function of the pituitary adenylate cyclase-activating polypeptide (PACAP)/glucagon superfamily. Endocrine Reviews 21 619–670.

    • Search Google Scholar
    • Export Citation
  • Solano RM, Langer I, Perret J, Vertongen P, Juarranz MG, Robberecht P & Waelbroeck M 2001 Two basic residues of the h-VPAC1 receptor second transmembrane helix are essential for ligand binding and signal transduction. Journal of Biological Chemistry 276 1084–1088.

    • Search Google Scholar
    • Export Citation
  • Spengler D, Waeber C, Pantaloni C, Holsboer F, Bockaert J, Seeburg PH & Journot L 1993 Differential signal transduction by five splice variants of the PACAP receptor. Nature 365 170–175.

    • Search Google Scholar
    • Export Citation
  • Sreedharan SP, Patel DR, Huang JX & Goetzl EJ 1993 Cloning and functional expression of a human neuroendocrine vasoactive intestinal peptide receptor. Biochemical and Biophysical Research Communications 193 546–553.

    • Search Google Scholar
    • Export Citation
  • Sreedharan SP, Huang JX, Cheung MC & Goetzl EJ 1995 Structure, expression, and chromosomal localization of the type I human vasoactive intestinal peptide receptor gene. PNAS 92 2939–2943.

    • Search Google Scholar
    • Export Citation
  • Taylor JS, Van de Peer Y, Braasch I & Meyer A 2001 Comparative genomics provides evidence for an ancient genome duplication event in fish. Philosophical Transactions of the Royal Society of London B 356 1661–1679.

    • Search Google Scholar
    • Export Citation
  • Taylor JS, Braasch I, Frickey T, Meyer A & Van de Peer Y 2003 Genome duplication, a trait shared by 22,000 species of ray-finned fish. Genome Research 13 382–390.

    • Search Google Scholar
    • Export Citation
  • Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F & Higgins DG 1997 The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24 4876–4882.

    • Search Google Scholar
    • Export Citation
  • Ulrich CD, Holtmann M & Miller LJ 1998 Secretin and vasoactive intestinal peptide receptors: members of a unique family of G protein-coupled receptors. Gastroenterology 114 382–397.

    • Search Google Scholar
    • Export Citation
  • Usdin TB, Bonner TI & Mezey E 1994 Two receptors for vasoactive intestinal polypeptide with similar specificity and complementary distributions. Endocrinology 135 2662–2680.

    • Search Google Scholar
    • Export Citation
  • Vandepoele K, De Vos W, Taylor JS, Meyer A & Van de Peer Y 2004 Major events in the genome evolution of vertebrates: Paranome age and size differ considerably between ray-finned fishes and land vertebrates. PNAS 101 1638–1643.

    • Search Google Scholar
    • Export Citation
  • Vaudry D, Gonzalez BJ, Basille M, Pamantung TF, Fontaine M, Fournier A & Vaudry H 2000a The neuroprotective effect of pituitary adenylate cyclase-activating polypeptide on cerebellar granule cells is mediated through inhibition of the CED3-related cysteine protease caspase-3/CPP32. PNAS 97 13390–13395.

    • Search Google Scholar
    • Export Citation
  • Vaudry D, Gonzalez BJ, Basille M, Pamantung TF, Fournier A & Vaudry H 2000b PACAP acts as a neurotrophic factor during histogenesis of the rat cerebellar cortex. Annals of the New York Academy of Sciences 921 293–299.

    • Search Google Scholar
    • Export Citation
  • Vaudry D, Gonzalez BJ, Basille M, Yon L, Fournier A & Vaudry H 2000c Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharmacological Reviews 52 269–324.

    • Search Google Scholar
    • Export Citation
  • Vijayan E, Samson WK, Said SI & McCann SM 1979 Vasoactive intestinal peptide: evidence for a hypothalamic site of action to release growth hormone, luteinizing hormone, and prolactin in conscious ovariectomized rats. Endocrinology 104 53–57.

    • Search Google Scholar
    • Export Citation
  • Wittbrodt J, Meyer A & Schartl M 1998 More genes in fish. BioEssays 20 511–515.

  • Wong AO, Leung MY, Shea WL, Tse LY, Chang JP & Chow BK 1998 Hypophysiotropic action of pituitary adenylate cyclase-activating polypeptide (PACAP) in the goldfish: immunohistochemical demonstration of PACAP in the pituitary, PACAP stimulation of growth hormone release from pituitary cells, and molecular cloning of pituitary type I PACAP receptor. Endocrinology 139 3465–3479.

    • Search Google Scholar
    • Export Citation
  • Wong AO, Li WS, Lee EK, Leung MY, Tse LY, Chow BK, Lin HR & Chang JP 2000 Pituitary adenylate cyclase activating polypeptide as a novel hypophysiotropic factor in fish. Biochemistry and Cell Biology 78 329–343.

    • Search Google Scholar
    • Export Citation


Society for Endocrinology logo

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 983 99 10
PDF Downloads 336 102 14
  • View in gallery View in gallery

    (A) Schematic representation of Fugu VPAC1RA and VPAC1RB genes and comparison with the orthologous human VPAC1R. The gene sizes are indicated next to each gene on the right, exons are numbered and are represented by closed boxes and a solid black line indicates introns. Arrows between the Fugu VPAC1R genes and the human VPAC1R gene indicate equivalent exons. The largest intron in both Fugu genes is located between exons 2 and 3 and is 5kb in VPAC1RA and 2.5kb in VPAC1RB. Sizes are indicated next to each gene on the right, exons are numbered and are represented by closed boxes and the introns by a black line. (B) Clustal X alignment of the protein-coding region of Fugu VPAC1R genes with other known VPAC1Rs. The transmembrane domains are annotated above the sequence. Conserved cysteines are annotated with a circle and potential conserved N-glycosylation sites with a triangle. All motifs characteristic of the VPAC1R genes are annotated with open boxes. Transmembrane domains (TM) and signal peptide sequences were identified by sequence comparison and according to GPCR database (www.cmbi.ni/7tm/) using the Swiss-Prot annotation. Accession numbers of the sequences are: mouse, P97751; rat, P97751; human, P32241; pig, Q28992; frog, Q9YHC6 and goldfish, Q90308. The chicken sequence is taken from Kansaku et al. 2001.

  • View in gallery

    Transmembrane domains (TM) and signal peptide sequences were identified by sequence comparison and according to the GPCR database (www.cmbi.ni/7tm/) using the Swiss-Prot annotation. Clustal X alignment of the protein-coding region of Fugu VPAC2R genes with other known VPAC2Rs. The transmembrane domains are annotated above the sequence. Conserved cysteines are annotated with a circle and potential conserved N-glycosylation sites with a triangle. All motifs characteristic of the VPAC2R genes are annotated with open boxes. Transmembrane domains (TM) and signal peptide sequences were identified by sequence comparison and according to the GPCR database (www.cmbi.ni/7tm/) using the Swiss-Prot annotation. Accession numbers of the sequences used are: mouse, P41588; rat, P35000; human, P41587.

  • View in gallery

    Comparison between rat PAC1R and the two orthologous genes in Fugu (PAC1RA; PAC1RB). The gene sizes are indicated next to each gene on the right, exons are numbered and are represented by closed boxes and the introns by a black line.

  • View in gallery

    Clustal X alignment of the Fugu PAC1R protein coding regions with other known PAC1Rs. The transmembrane domains are annotated above the sequence. Conserved cysteines are annotated by a circle and potential conserved N-glycosylation sites are marked with a triangle. The alternatively spliced hop cassette is shown with a dotted box. Transmembrane domains (TM) and signal peptide sequences were identified by sequence comparison and according to the GPCR database (www.cmbi.ni/7tm/) using the Swiss-Prot annotation. Accession numbers of the sequences used are mouse, P70205; rat, P32215; human, P41586; bovine, D17290 and goldfish, AF048820. The chicken gene is taken from Peeters et al. 1999.

  • View in gallery

    Phylogenetic analysis of the Fugu VIP/PACAP receptor sequences with other known related receptors of the class II family. Names and abbreviations and accession numbers for all the sequences shown: rat VPAC1, P97751; rat VPAC2 , P35000; rat PAC1, P32215; rat sec, P23811; human V PAC1, P32241; human VPAC2, P41587; human PAC1, P41586; human sec, P47872; human GHRH, P43220 (used as the outgroup); mouse VPAC1, P97751; mouse VPAC2, P41587; mouse PAC1, P70205; frog VPAC1, Q9YHC6; pig VPAC1, Q28992; goldfish VPAC1, Q90308; goldfish PAC1, O73769; cattle PAC1, Q29627; toad PAC1, Q9PTK1; Fugu VPAC1A, AJ296144; Fugu VPAC1B, AJ296143; Fugu VPAC2A, AJ408877; Fugu VPAC2B, AJ408878; Fugu PAC1A, AJ490804; Fugu PAC1B, AJ494861; rabbit sec, O46502. The chicken sequences for VPAC1 and PAC1 were taken from Kansaku et al. 2001 and Peeters et al. 1999 respectively. Sec, secretin receptor.

  • View in gallery

    Comparative maps showing conserved linkage between Fugu, human and C. elegans. The chromosome positions of the genes in human and C. elegans are given in Mb and annotated next to the gene name. KIAA1173, LOC131377, NKTR, SEC22C and VPAC1R in human all map to a gene cluster on 3p21.32 which contains only two other genes.

  • Aino H, Hashimoto H, Ogawa N, Nishino A, Yamamoto K, Nogi H, Nagata S & Baba A 1995 Structure of the gene encoding the mouse pituitary adenylate cyclase-activating polypeptide receptor. Gene 164 301–304.

    • Search Google Scholar
    • Export Citation
  • Alexandre D, Anouar Y, Jegou S, Fournier A & Vaudry H 1999 A cloned frog vasoactive intestinal polypeptide/pituitary adenylate cyclase-activating polypeptide receptor exhibits pharmacological and tissue distribution characteristics of both VPAC1 and VPAC2 receptors in mammals. Endocrinology 140 1285–1293.

    • Search Google Scholar
    • Export Citation
  • Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25 3389–3402.

    • Search Google Scholar
    • Export Citation
  • Aparicio S, Chapman J, Stupka E, Putnam N, Chia J, Dehal P, Chistoffels A, Rash S, Hoon S, Smit A et al.2002 Whole-genome shortgun assembly and analysis of the genome of Fugu rubripes. Science 297 1301–1310.

    • Search Google Scholar
    • Export Citation
  • Bairoch A, Bucher P & Hofmann K 1997 The PROSITE database, its status in 1997. Nucleic Acids Research 25 217–221.

  • Basille M, Vaudry D, Coulouarn Y, Jegou S, Lihrmann I, Fournier A, Vaudry H & Gonzalez BJ 2000 Distribution of PACAP receptor mRNAs and PACAP binding sites in the rat brain during development. Annals of the New York Academy of Sciences 921 304–307.

    • Search Google Scholar
    • Export Citation
  • Bell GI 1986 The glucagon superfamily: precursor structure and gene organization. Peptides 7 27–36.

  • Biancani P, Walsh J & Behar J 1985 Vasoactive intestinal peptide: a neurotransmitter for relaxation of the rabbit internal anal sphincter. Gastroenterology 89 867–874.

    • Search Google Scholar
    • Export Citation
  • Bockaert J 1991 G proteins and G-protein-coupled receptors: structure, function and interactions. Current Opinion in Neurobiology 1 32–42.

    • Search Google Scholar
    • Export Citation
  • Bonfield JK & Staden R 1996 Experiment files and their application during large-scale sequencing projects. DNA Sequence 6 109–117.

  • Bouchireb N, Grutzner F, Haaf T, Stephens RJ, Elgar G, Green AJ & Clark MS 2001 Comparative mapping of the human 9q34 region in Fugu rubripes. Cytogenetics Cell Genetics 94 173–179.

    • Search Google Scholar
    • Export Citation
  • Brabet P, Diriong S, Journot L, Bockaert J & Taviaux S 1996 Localization of the human pituitary adenylate cyclase-activating polypeptide receptor (PACAP1-R) gene to 7p15-p14 by fluorescence in situ hybridization. Genomics 38 100–102.

    • Search Google Scholar
    • Export Citation
  • Brenner S, Elgar G, Sandford R, Macrae A, Venkatesh B & Aparicio S 1993 Characterization of the pufferfish (Fugu) genome as a compact model vertebrate genome. Nature 366 265–268.

    • Search Google Scholar
    • Export Citation
  • Cai Y, Xin X, Yamada T, Muramatsu Y, Szpirer C & Matsumoto K 1995 Assignments of the genes for rat pituitary adenylate cyclase activating polypeptide (Adcyap1) and its receptor subtypes (Adcyap1r1, Adcyap1r2, and Adcyap1r3). Cytogenetics Cell Genetics 71 193–196.

    • Search Google Scholar
    • Export Citation
  • Chatterjee TK, Liu X, Davisson RL & Fisher RA 1997 Genomic organization of the rat pituitary adenylate cyclase-activating polypeptide receptor gene. Alternative splicing within the 5′-untranslated region. Journal of Biological Chemistry 272 12122–12131.

    • Search Google Scholar
    • Export Citation
  • Chow BK 1997 The goldfish vasoactive intestinal polypeptide receptor: functional studies and tissue expression. Fish Physiology and Biochemistry 17 213–222.

    • Search Google Scholar
    • Export Citation
  • Chow BK, Yuen TT & Chan KW 1996 Molecular evolution of vertebrate VIP receptors and functional characterization of a VIP receptor from goldfish Carassius auratus. General and Comparative Endocrinology 105 176–185.

    • Search Google Scholar
    • Export Citation
  • Church GM & Gilbert W 1984 Genomic sequencing. PNAS USA 81 1991–1995.

  • Christoffels A, Koh EGL, Chia J-M, Brenner S, Aparicio S & Venkatesh B 2004 Fugu genome analysis provides evidence for a whole-genome duplication early during the evolution of ray-finned fishes. Molecular Biology and Evolution 21 1146–1151.

    • Search Google Scholar
    • Export Citation
  • D’Agata V, Cavallaro S, Stivala F & Canonico PL 1996 Tissue-specific and developmental expression of pituitary adenylate cyclase-activating polypeptide (PACAP) receptors in rat brain. European Journal of Neuroscience 8 310–318.

    • Search Google Scholar
    • Export Citation
  • Daniel PB, Kieffer TJ, Leech CA & Habner JF 1998 Novel alternatively spliced exon in the extracellular ligand-binding domain of the pituitary adenylate cyclase activating polypeptide (PACAP) type I receptor PAC1R selectively increases ligand affinity and alters signal transduction coupling during spematogenesis. Journal of Biological Chemistry 276 12938–12944.

    • Search Google Scholar
    • Export Citation
  • Dautzenberg FM, Mevenkamp G, Wille S & Hauger RL 1999 N-terminal splice variants of the type I PACAP receptor: isolation, characterization and ligand binding/selectivity determinants. Journal of Neuroendocrinology 11 941–949.

    • Search Google Scholar
    • Export Citation
  • Elgar G, Clark MS, Meek S, Smith S, Warner S, Edwards YJ, Bouchireb N, Cottage A, Yeo GS, Umrania Y et al.1999 Generation and analysis of 25 Mb of genomic DNA from the pufferfish Fugu rubripes by sequence scanning. Genome Research 9 960–971.

    • Search Google Scholar
    • Export Citation
  • Fahrenkrug J 1993 Transmitter role of vasoactive intestinal peptide. Pharmacology and Toxicology 72 354–363.

  • Felsenstein J 1985 Confidence limits on phylogenies an approach using the bootstrap Evolution 39 783–791.

  • Force A, Lynch M, Pickett FB, Amores A, Yan YL & Postlethwait J 1999 Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151 1531–1545.

    • Search Google Scholar
    • Export Citation
  • Gagnon AW, Aiyar N & Elshourbagy NA 1994 Molecular cloning and functional characterization of a human liver vasoactive intestinal peptide receptor. Cellular Signalling 6 321–333.

    • Search Google Scholar
    • Export Citation
  • Galtier N, Gouy M & Gautier C 1996 SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny. Computer Applied Biosciences 12 543–548.

    • Search Google Scholar
    • Export Citation
  • Gilman AG 1987 G proteins: transducers of receptor-generated signals. Annual Review of Biochemistry 56 615–649.

  • Hashimoto H, Ishihara T, Shigemoto R, Mori K & Nagata S 1993 Molecular cloning and tissue distribution of a receptor for pituitary adenylate cyclase-activating polypeptide. Neuron 11 333–342.

    • Search Google Scholar
    • Export Citation
  • Hashimoto H, Nishino A, Shintani N, Hagihara N, Copeland NG, Jenkins NA, Yamamoto K, Matsuda T, Ishihara T, Nagata S et al.1999 Genomic organization and chromosomal location of the mouse vasoactive intestinal polypeptide 1 (VPAC1) receptor. Genomics 58 90–93.

    • Search Google Scholar
    • Export Citation
  • Hu Z, Lelievre V, Chao A, Zhou X & Waschek JA 2000 Characterization and messenger ribonucleic acid distribution of a cloned pituitary adenylate cyclase-activating polypeptide type I receptor in the frog Xenopus laevis brain. Endocrinology 141 657–665.

    • Search Google Scholar
    • Export Citation
  • Hughes AL, da Silva J & Friedman R 2001 Ancient genome duplications did not structure the human hox-bearing chromosomes. Genome Research 11 771–780.

    • Search Google Scholar
    • Export Citation
  • Inagaki N, Yoshida H, Mizuta M, Mizuno N, Fujii Y, Gonoi T, Miyazaki J & Seino S 1994 Cloning and functional characterization of a third pituitary adenylate cyclase-activating polypeptide receptor subtype expressed in insulin-secreting cells. PNAS 91 2679–2683.

    • Search Google Scholar
    • Export Citation
  • Ishihara T, Shigemoto R, Mori K, Takahashi K & Nagata S 1992 Functional expression and tissue distribution of a novel receptor for vasoactive intestinal polypeptide. Neuron 8 811–819.

    • Search Google Scholar
    • Export Citation
  • Journot L, Spengler D, Pantaloni C, Dumuis A, Sebben M & Bockaert J 1994 The PACAP receptor: generation by alternative splicing of functional diversity among G protein-coupled receptors in nerve cells. Seminars in Cell Biology 5 263–272.

    • Search Google Scholar
    • Export Citation
  • Kansaku N, Shimada K, Ohkubo T, Saito N, Suzuki T, Matsuda Y & Zadworny D 2001 Molecular cloning of chicken vasoactive intestinal polypeptide receptor complementary DNA, tissue distribution and chromosomal localization. Biology of Reproduction 64 1575–1581.

    • Search Google Scholar
    • Export Citation
  • Korman LY, Sayadi H, Bass B, Moody TW & Harmon JW 1989 Distribution of vasoactive intestinal polypeptide and substance P receptors in human colon and small intestine. Digestive Diseases and Sciences 34 1100–1108.

    • Search Google Scholar
    • Export Citation
  • Laburthe M, Couvineau A, Gaudin P, Maoret JJ, Rouyer-Fessard C & Nicole P 1996 Receptors for VIP, PACAP, secretin, GRF, glucagon, GLP-1, and other members of their new family of G protein-linked receptors: structure-function relationship with special reference to the human VIP-1 receptor. Annals of the New York Academy of Sciences 805 94–109.

    • Search Google Scholar
    • Export Citation
  • Lok S, Kuijper JL, Jelinek LJ, Kramer JM, Whitmore TE, Sprecher CA, Mathewes S, Grant FJ, Biggs SH, Rosenberg GB, et al. 1994 The human glucagon receptor encoding gene: structure, cDNA sequence and chromosomal localization. Gene 140 203–209.

    • Search Google Scholar
    • Export Citation
  • Lutz EM, Sheward WJ, West KM, Morrow JA, Fink G & Harmar AJ 1993 The VIP2 receptor: molecular characterisation of a cDNA encoding a novel receptor for vasoactive intestinal peptide. FEBS Letters 334 3–8.

    • Search Google Scholar
    • Export Citation
  • Lynch M & Conery JS 2000 The evolutionary fate and consequences of duplicate genes. Science 290 1151–1155.

  • Mackay M, Fantes J, Scherer S, Boyle S, West K, Tsui LC, Belloni E, Lutz E, Van Heyningen V & Harmar AJ 1996 Chromosomal localization in mouse and human of the vasoactive intestinal peptide receptor type 2 gene: a possible contributor to the holoprosencephaly 3 phenotype. Genomics 37 345–353.

    • Search Google Scholar
    • Export Citation
  • Mainoya JR & Bern HA 1984 Influence of vasoactive intestinal polypeptide urotensin II on the absorption of water and NaCl by the anterior intestine of the tilapia, Sarotherodon mossambicus. Zoological Science 1 100–105.

    • Search Google Scholar
    • Export Citation
  • McRory J & Sherwood NM 1997 Two protochordate genes encode pituitary adenylate cyclase-activating polypeptide and related family members. Endocrinology 138 2380–2390.

    • Search Google Scholar
    • Export Citation
  • Naruse K, Tanaka M, Mita K, Shima A, Postlethwait J & Mitani H 2004 A medaka gene map: the trace of ancestral vertebrate proto-chromosomes revealed by comparative gene mapping. Genome Research 14 820–828.

    • Search Google Scholar
    • Export Citation
  • Ogi K, Miyamoto Y, Masuda Y, Habata Y, Hosoya M, Ohtaki T, Masuo Y, Onda H & Fujino M 1993 Molecular cloning and functional expression of a cDNA encoding a human pituitary adenylate cyclase activating polypeptide receptor. Biochemistry and Biophysical Research Communications 196 1511–1521.

    • Search Google Scholar
    • Export Citation
  • Okamoto T, Murayama Y, Hayashi Y, Inagaki M, Ogata E & Nishimoto I 1991 Identification of a Gs activator region of the beta 2-adrenergic receptor that is autoregulated via protein kinase A–dependent phosphorylation. Cell 67 723–730.

    • Search Google Scholar
    • Export Citation
  • Pantaloni C, Brabet P, Bilanges B, Dumuis A, Houssami S, Spengler D, Bockaert J & Journot L 1996 Alternative splicing in the N-terminal extracellular domain of the pituitary adenylate cyclase-activating polypeptide (PACAP) receptor modulates receptor selectivity and relative potencies of PACAP-27 and PACAP-38 in phospholipase C activation. Journal of Biological Chemistry 271 22146–22151.

    • Search Google Scholar
    • Export Citation
  • Peeters K, Gerets HH, Princen K & Vandesande F 1999 Molecular cloning and expression of a chicken pituitary adenylate cyclase-activating polypeptide receptor. Molecular Brain Research 71 244–255.

    • Search Google Scholar
    • Export Citation
  • Pisegna JR & Wank SA 1993 Molecular cloning and functional expression of the pituitary adenylate cyclase-activating polypeptide type I receptor. PNAS 90 6345–6349.

    • Search Google Scholar
    • Export Citation
  • Postlethwait JH, Woods IG, Ngo-Hazelett P, Yan YL, Kelly PD, Chu F, Huang H, Hill-Force A & Talbot WS 2000 Zebrafish comparative genomics and the origins of vertebrate chromosomes. Genome Research 10 1890–1902.

    • Search Google Scholar
    • Export Citation
  • Pozo D, Guerrero JM & Calvo JR 2000 Functional and molecular characterization of VIP receptor–effector system in rat developing immunocompetent cells: G protein involvement. Journal of Neuroimmunology 103 41–50.

    • Search Google Scholar
    • Export Citation
  • Rice R, Longden I & Bleasby A 2000 EMBOSS: The European Molecular Biology Open Software Suite. Trends in Genetics 16 276–277.

  • Robberecht P, Waelbroeck M, Camus JC, De Neef P & Chrisptophe J 1984 Importance of disulphide bonds in receptors for vasoactive intestinal peptide and secretin in rat pancreatic plasma membranes. Biochimica et Biophysica Acta 773 271–278.

    • Search Google Scholar
    • Export Citation
  • Robinson-Rechavi M & Laudet V 2001a Evolutionary rates of duplicate genes in fish and mammals. Molecular Biology and Evolution 18 681–683.

    • Search Google Scholar
    • Export Citation
  • Robinson-Rechavi M, Marchand O, Escriva H, Bardet PL, Zelus D, Hughes S & Laudet V 2001b Euteleost fish genomes are characterized by expansion of gene families. Genome Research 11 781–788.

    • Search Google Scholar
    • Export Citation
  • Robinson-Rechavi M, Marchand O, Escriva H & Laudet V 2001c An ancestral whole-genome duplication may not have been responsible for the abundance of duplicated fish genes. Current Biology 11 458–459.

    • Search Google Scholar
    • Export Citation
  • Saitou N & Nei M 1987 The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4 406–425.

    • Search Google Scholar
    • Export Citation
  • Sayadi H, Harmon JW, Moody TW & Korman LY 1988 Autoradiographic distribution of vasoactive intestinal polypeptide receptors in rabbit and rat small intestine. Peptides 9 23–30.

    • Search Google Scholar
    • Export Citation
  • Segre GV & Goldring GS 1993 Receptors for secretin, calcitonin, parathyroid hormone (PTH/PTH-related peptide), glucagon-like peptide 1, growth hormone-releasing homone, and glucagon belong to a newly discovered G-protein-linked receptor family. Trends in Endocrinology and Metabolism 4 309–314

    • Search Google Scholar
    • Export Citation
  • Sherwood NM, Krueckl SL & McRory JE 2000 The origin and function of the pituitary adenylate cyclase-activating polypeptide (PACAP)/glucagon superfamily. Endocrine Reviews 21 619–670.

    • Search Google Scholar
    • Export Citation
  • Solano RM, Langer I, Perret J, Vertongen P, Juarranz MG, Robberecht P & Waelbroeck M 2001 Two basic residues of the h-VPAC1 receptor second transmembrane helix are essential for ligand binding and signal transduction. Journal of Biological Chemistry 276 1084–1088.

    • Search Google Scholar
    • Export Citation
  • Spengler D, Waeber C, Pantaloni C, Holsboer F, Bockaert J, Seeburg PH & Journot L 1993 Differential signal transduction by five splice variants of the PACAP receptor. Nature 365 170–175.

    • Search Google Scholar
    • Export Citation
  • Sreedharan SP, Patel DR, Huang JX & Goetzl EJ 1993 Cloning and functional expression of a human neuroendocrine vasoactive intestinal peptide receptor. Biochemical and Biophysical Research Communications 193 546–553.

    • Search Google Scholar
    • Export Citation
  • Sreedharan SP, Huang JX, Cheung MC & Goetzl EJ 1995 Structure, expression, and chromosomal localization of the type I human vasoactive intestinal peptide receptor gene. PNAS 92 2939–2943.

    • Search Google Scholar
    • Export Citation
  • Taylor JS, Van de Peer Y, Braasch I & Meyer A 2001 Comparative genomics provides evidence for an ancient genome duplication event in fish. Philosophical Transactions of the Royal Society of London B 356 1661–1679.

    • Search Google Scholar
    • Export Citation
  • Taylor JS, Braasch I, Frickey T, Meyer A & Van de Peer Y 2003 Genome duplication, a trait shared by 22,000 species of ray-finned fish. Genome Research 13 382–390.

    • Search Google Scholar
    • Export Citation
  • Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F & Higgins DG 1997 The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24 4876–4882.

    • Search Google Scholar
    • Export Citation
  • Ulrich CD, Holtmann M & Miller LJ 1998 Secretin and vasoactive intestinal peptide receptors: members of a unique family of G protein-coupled receptors. Gastroenterology 114 382–397.

    • Search Google Scholar
    • Export Citation
  • Usdin TB, Bonner TI & Mezey E 1994 Two receptors for vasoactive intestinal polypeptide with similar specificity and complementary distributions. Endocrinology 135 2662–2680.

    • Search Google Scholar
    • Export Citation
  • Vandepoele K, De Vos W, Taylor JS, Meyer A & Van de Peer Y 2004 Major events in the genome evolution of vertebrates: Paranome age and size differ considerably between ray-finned fishes and land vertebrates. PNAS 101 1638–1643.

    • Search Google Scholar
    • Export Citation
  • Vaudry D, Gonzalez BJ, Basille M, Pamantung TF, Fontaine M, Fournier A & Vaudry H 2000a The neuroprotective effect of pituitary adenylate cyclase-activating polypeptide on cerebellar granule cells is mediated through inhibition of the CED3-related cysteine protease caspase-3/CPP32. PNAS 97 13390–13395.

    • Search Google Scholar
    • Export Citation
  • Vaudry D, Gonzalez BJ, Basille M, Pamantung TF, Fournier A & Vaudry H 2000b PACAP acts as a neurotrophic factor during histogenesis of the rat cerebellar cortex. Annals of the New York Academy of Sciences 921 293–299.

    • Search Google Scholar
    • Export Citation
  • Vaudry D, Gonzalez BJ, Basille M, Yon L, Fournier A & Vaudry H 2000c Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharmacological Reviews 52 269–324.

    • Search Google Scholar
    • Export Citation
  • Vijayan E, Samson WK, Said SI & McCann SM 1979 Vasoactive intestinal peptide: evidence for a hypothalamic site of action to release growth hormone, luteinizing hormone, and prolactin in conscious ovariectomized rats. Endocrinology 104 53–57.

    • Search Google Scholar
    • Export Citation
  • Wittbrodt J, Meyer A & Schartl M 1998 More genes in fish. BioEssays 20 511–515.

  • Wong AO, Leung MY, Shea WL, Tse LY, Chang JP & Chow BK 1998 Hypophysiotropic action of pituitary adenylate cyclase-activating polypeptide (PACAP) in the goldfish: immunohistochemical demonstration of PACAP in the pituitary, PACAP stimulation of growth hormone release from pituitary cells, and molecular cloning of pituitary type I PACAP receptor. Endocrinology 139 3465–3479.

    • Search Google Scholar
    • Export Citation
  • Wong AO, Li WS, Lee EK, Leung MY, Tse LY, Chow BK, Lin HR & Chang JP 2000 Pituitary adenylate cyclase activating polypeptide as a novel hypophysiotropic factor in fish. Biochemistry and Cell Biology 78 329–343.

    • Search Google Scholar
    • Export Citation