Search Results

-expression of C/EBPα downregulated ACOX1 luciferase activity. (B) The schematic diagram of site-directed mutagenesis in the predicted C/EBPα binding sites in the ACOX1 promoter. (C and D) A series of mutants of three C/EBPα binding sites were constructed and

, The Netherlands) was used. All constructs were confirmed by sequencing. Site-directed mutagenesis Mutant constructs of TF-binding sites were generated using the QuikChange Site-Directed Mutagenesis (Stratagene

.3) buffer and visualized by autoradiography by exposure to Kodak XAR film at −80 °C with intensifying screens. Site-directed mutagenesis The rat APJR 5′-flanking region 1 kb construct, bp −966 to −7 subcloned into the pGL3

://www.cbrc.jp/research/db/TFSEARCH.html ) ( Fig. 2 A). Further analysis of a putative C/EBPβ binding site suggested that it is highly conserved in human, mouse and pig ( Fig. 2 B). Site-directed mutagenesis was performed using a WT pGL3-P5 construct as a template, aiming to functionally

-activators and utilizes an alternative LBD region for transcriptional activation. In this study, we have used structural modeling to identify an alternative co-activator interaction surface in the Nurr1 LBD. Combined with site-directed mutagenesis, these studies

(Guthrie cDNA Resource Center) was subjected to site-directed mutagenesis using the Stratagene QuickChange II XL site-directed mutagenesis kit. Mutagenic primers introduced or eliminated unique restriction sites (silent mutations) into the cDNA encoding

). After the D1 cDNA cloning ( Berry et al. 1991 a ), site-directed mutagenesis and deletion analysis have identified several functional regions of the D1 protein ( Berry et al. 1991 b , 1992 , Toyoda et al. 1995 a , b , 1997 , Leonard et al

promoter constructs (deletions, mutagenesis) and for electromobility shift assays Nur77 promoter constructs (added cloning sites are italicized: Kpn 1 in reverse primer and Bam HI in forward primers)  Common reverse primer CT GGTACC GCGTGCGCTCTGCAATCCTTC

with 1:1000 diluted monoclonal TXNIP antiserum (JY2; MBL International Corp., Woburn, MA, USA) or 1:1000 diluted anti β-actin antiserum (C11, Santa Cruz Biotechnology, Santa Cruz, CA, USA). Reporter vector constructs and site-directed mutagenesis The

2001 ). For site-directed mutagenesis of putative transcription factor-binding sites, the QuikChange II XL Kit (Stratagene, La Jolla, CA, USA) was used according to the manufacturer's recommendations. The sequences of all the constructs were verified by