Search Results

You are looking at 1 - 10 of 58 items for :

  • All content x
Clear All
Free access

Diana Vargas, Noriaki Shimokawa, Ryosuke Kaneko, Wendy Rosales, Adriana Parra, Ángela Castellanos, Noriyuki Koibuchi, and Fernando Lizcano

regulated by many factors, including the bone morphogenetic protein 7/PR domain containing protein 16/peroxisome proliferator-activated receptor gamma (PPARg) coactivator 1 alpha (BMP7/PRDM16/PGC1α) axis ( Seale et al . 2008 , Seale 2015 ). Moreover

Free access

Sadako Suzuki, Shigekazu Sasaki, Hiroshi Morita, Yutaka Oki, Daisuke Turiya, Takeshi Ito, Hiroko Misawa, Keiko Ishizuka, and Hirotoshi Nakamura

Introduction Peroxisome proliferator-activated receptor γ-2 (PPARG2) belongs to the nuclear hormone receptor (NHR) superfamily ( Desvergne & Wahli 1999 , Michalik et al . 2006 , Lu & Cheng 2010 ). Through different promoter usage and splicing

Free access

Jacqueline M Wallace, John S Milne, Raymond P Aitken, Dale A Redmer, Lawrence P Reynolds, Justin S Luther, Graham W Horgan, and Clare L Adam

, Kleiman et al . 2013 ) and peroxisome proliferator-activated receptor gamma ( PPARG ), a transcriptional regulator that plays a central role in adipocyte differentiation and also co-ordinates the genes involved in lipid deposition and metabolism ( Semple

Free access

Amélie Gormand, Christine Berggreen, Lahouari Amar, Emma Henriksson, Ingrid Lund, Sebastian Albinsson, and Olga Göransson

from Qiagen. Primers for Pparg (PPARγ, forward primer: 5′-CTG TTT TAT GCT GTT ATG GGT GAA A-3′ and reverse primer: 5′-GCA CCA TGC TCT GGG TCA A-3′), Cebpa (C/EBPα, forward primer: 5′-ATA GAC ATC AGC GCC TAC ATC GA-3′ and reverse primer: 5′-CTG TCG

Free access

Chen Chen, Yongdong Peng, Yinglin Peng, Jian Peng, and Siwen Jiang

-strand cDNA synthesis kit (Fermentas (Waltham, Massachusetts, USA), K1622) according to the manufacturer's protocol. In QPCR analysis, the mRNA levels of Pparg , Cebpa , Ap2 , Fas , Apc , Ccnd1 , and Cmyc were quantified using SYBR Green Supermix

Restricted access

Jie Wang, Yuchao Zhang, Qi Shen, Jing Wu, and Jian-Xin Li

PPAR signaling pathway directly related to lipid accumulation ( Fig. 5D ). Besides, several key genes were declined in PPAR signaling pathway after HA-20 treatment, including Pparg , Cebpa , Fas , Acc , Fabp4/aP2 , which were further verified using

Free access

Gabriela Silva Monteiro de Paula, Marianna Wilieman, Karina Ribeiro Silva, Leandra Santos Baptista, Sihem Boudina, Luana Lopes de Souza, Thais Bento-Bernardes, Karina Dutra Asensi, Regina Coeli dos Santos Goldenberg, and Carmen Cabanelas Pazos-Moura

CAGCCCACAAAGACCAGAA Plin1 GTGCTTCCAGAAGACCTACAA CTTCAGTTCAGAGGCGATCTT Pparg GAACCTGCATCTCCACCTTATT CGGCAGTTAAGATCACACCTATC Rplp0 GGCCCTGCACTCTCGCTTTC TGCCAGGACGCGCTTGT Srebf1 GTGTCTATGGAGGGCATGAAA GCATCAGAGGGAGTGAGAATG

Free access

Jason F Ohlstein, Amy L Strong, John A McLachlan, Jeffrey M Gimble, Matthew E Burow, and Bruce A Bunnell

upregulation of downstream targets, including peroxisome proliferator-activated receptor gamma ( PPAR γ ( PPARG )) and lipoprotein lipase ( LPL ) genes, based on results from in vitro experiments on rodents ( Melzer et al . 2011 ). Results from previous

Free access

Xinxin Xiang, Wenjiao An, Changtao Jiang, Jing Zhao, Xian Wang, Guang Sun, Yin Li, and Weizhen Zhang

/enhancer-binding protein α (C/EBP-α; CEBPA)/peroxisome proliferator-activated receptor γ (PPAR-γ; PPARG). Materials and methods Animals and chemicals Sprague–Dawley rats (8 weeks old), 129 mice and db/db mice were housed in standard rodent cages and maintained in a

Free access

Yan-ping Xu, Jia-jun Zhu, Fen Cheng, Ke-wen Jiang, Wei-zhong Gu, Zheng Shen, Yi-dong Wu, Li Liang, and Li-zhong Du

.8 Pparg NM_001145366.1 5′-TGTCGGTTTCAGAAGTGCCTTG-3′ 64.7 122 5′-TTCAGCTGGTCGATATCACTGGAG-3′ 64.9 Wnt1 NM_001105714.1 5′-ATA GCCTCCTCCACGAACCT-3′ 61.4 175 5′-GGAATTGCCACTTGCACTCT-3′ 59.8 Actb NM_031144.2 5′-GGAGATTACTGCCCTGGCTCCTA-3′ 64.9 150 5