Search Results

You are looking at 1 - 10 of 55 items for :

Clear All
Free access

Diana Vargas, Noriaki Shimokawa, Ryosuke Kaneko, Wendy Rosales, Adriana Parra, Ángela Castellanos, Noriyuki Koibuchi and Fernando Lizcano

regulated by many factors, including the bone morphogenetic protein 7/PR domain containing protein 16/peroxisome proliferator-activated receptor gamma (PPARg) coactivator 1 alpha (BMP7/PRDM16/PGC1α) axis ( Seale et al . 2008 , Seale 2015 ). Moreover

Free access

Sadako Suzuki, Shigekazu Sasaki, Hiroshi Morita, Yutaka Oki, Daisuke Turiya, Takeshi Ito, Hiroko Misawa, Keiko Ishizuka and Hirotoshi Nakamura

Introduction Peroxisome proliferator-activated receptor γ-2 (PPARG2) belongs to the nuclear hormone receptor (NHR) superfamily ( Desvergne & Wahli 1999 , Michalik et al . 2006 , Lu & Cheng 2010 ). Through different promoter usage and splicing

Free access

Jacqueline M Wallace, John S Milne, Raymond P Aitken, Dale A Redmer, Lawrence P Reynolds, Justin S Luther, Graham W Horgan and Clare L Adam

, Kleiman et al . 2013 ) and peroxisome proliferator-activated receptor gamma ( PPARG ), a transcriptional regulator that plays a central role in adipocyte differentiation and also co-ordinates the genes involved in lipid deposition and metabolism ( Semple

Free access

Amélie Gormand, Christine Berggreen, Lahouari Amar, Emma Henriksson, Ingrid Lund, Sebastian Albinsson and Olga Göransson

from Qiagen. Primers for Pparg (PPARγ, forward primer: 5′-CTG TTT TAT GCT GTT ATG GGT GAA A-3′ and reverse primer: 5′-GCA CCA TGC TCT GGG TCA A-3′), Cebpa (C/EBPα, forward primer: 5′-ATA GAC ATC AGC GCC TAC ATC GA-3′ and reverse primer: 5′-CTG TCG

Free access

Chen Chen, Yongdong Peng, Yinglin Peng, Jian Peng and Siwen Jiang

-strand cDNA synthesis kit (Fermentas (Waltham, Massachusetts, USA), K1622) according to the manufacturer's protocol. In QPCR analysis, the mRNA levels of Pparg , Cebpa , Ap2 , Fas , Apc , Ccnd1 , and Cmyc were quantified using SYBR Green Supermix

Restricted access

Gabriela Silva Monteiro de Paula, Marianna Wilieman, Karina Ribeiro Silva, Leandra Santos Baptista, Sihem Boudina, Luana Lopes de Souza, Thais Bento-Bernardes, Karina Dutra Asensi, Regina Coeli dos Santos Goldenberg and Carmen Cabanelas Pazos-Moura

CAGCCCACAAAGACCAGAA Plin1 GTGCTTCCAGAAGACCTACAA CTTCAGTTCAGAGGCGATCTT Pparg GAACCTGCATCTCCACCTTATT CGGCAGTTAAGATCACACCTATC Rplp0 GGCCCTGCACTCTCGCTTTC TGCCAGGACGCGCTTGT Srebf1 GTGTCTATGGAGGGCATGAAA GCATCAGAGGGAGTGAGAATG

Free access

Jason F Ohlstein, Amy L Strong, John A McLachlan, Jeffrey M Gimble, Matthew E Burow and Bruce A Bunnell

upregulation of downstream targets, including peroxisome proliferator-activated receptor gamma ( PPAR γ ( PPARG )) and lipoprotein lipase ( LPL ) genes, based on results from in vitro experiments on rodents ( Melzer et al . 2011 ). Results from previous

Free access

Xinxin Xiang, Wenjiao An, Changtao Jiang, Jing Zhao, Xian Wang, Guang Sun, Yin Li and Weizhen Zhang

/enhancer-binding protein α (C/EBP-α; CEBPA)/peroxisome proliferator-activated receptor γ (PPAR-γ; PPARG). Materials and methods Animals and chemicals Sprague–Dawley rats (8 weeks old), 129 mice and db/db mice were housed in standard rodent cages and maintained in a

Free access

Yan-ping Xu, Jia-jun Zhu, Fen Cheng, Ke-wen Jiang, Wei-zhong Gu, Zheng Shen, Yi-dong Wu, Li Liang and Li-zhong Du

.8 Pparg NM_001145366.1 5′-TGTCGGTTTCAGAAGTGCCTTG-3′ 64.7 122 5′-TTCAGCTGGTCGATATCACTGGAG-3′ 64.9 Wnt1 NM_001105714.1 5′-ATA GCCTCCTCCACGAACCT-3′ 61.4 175 5′-GGAATTGCCACTTGCACTCT-3′ 59.8 Actb NM_031144.2 5′-GGAGATTACTGCCCTGGCTCCTA-3′ 64.9 150 5

Free access

Jacqueline M Wallace, John S Milne, Raymond P Aitken and Clare L Adam

. 1996 , Bianda et al . 1997 ). Growth factors, including IGF1, also induce transcription factors such as peroxisome-proliferator-activated receptor gamma ( PPARG ; Scavo et al . 2004 ), which in turn plays a central role in adipocyte differentiation