Search Results

You are looking at 1 - 2 of 2 items for :

  • "Akkermansia muciniphila" x
Clear All
Free access

Shaoqian Zhao, Wen Liu, Jiqiu Wang, Juan Shi, Yingkai Sun, Weiqing Wang, Guang Ning, Ruixin Liu and Jie Hong

. Table 1 Significantly different plasma metabolites between Akkermansia muciniphila -intervened mice and the control. No. Metabolites a RT (min) m / z VIP value b (OPLS-DA) P value c (Student’s t -test) Fold-change d (log

Restricted access

Mohamed H Noureldein, Sara Bitar, Natalie Youssef, Sami Azar and Assaad A Eid

against 16S rRNA gene levels in each sample and were compared to controls. Table 1 List of primers. Primer Sequence Reference Forward Reverse Akkermansia muciniphila CAGCACGTGAAGGTGGGGAC CCTTGCGGTTGGCTTCAGAT