Search Results

You are looking at 11 - 20 of 55 items for :

Clear All
Free access

Gabriela Capllonch-Amer, Isabel Lladó, Ana M Proenza, Francisco J García-Palmer and Magdalena Gianotti

-activated receptor γ (PPARg), a key transcriptional factor to initiate and maintain the fully differentiated adipocyte phenotype ( Spiegelman et al . 1993 , Fu et al . 2005 ). Mitochondrial function is an important factor in adipocyte differentiation ( Lu et al

Free access

Lingxia Pang, Lianghui You, Chenbo Ji, Chunmei Shi, Ling Chen, Lei Yang, Fangyan Huang, Yahui Zhou, Jun Zhang, Xiaohui Chen and Xirong Guo

a sequential manner ( Farmer 2006 ). Among these, peroxisome proliferator-activated receptor gamma (PPARG), a member of the nuclear hormone receptor family, is both necessary and sufficient for adipogenesis ( Rosen et al . 1999 ). No other factor to

Free access

Inna Astapova

-activators thyroid hormone receptor-associated protein 220 (TRAP220 or MED1) ( Ito & Roeder 2001 ), peroxisome proliferator-activated receptor gamma (PPARG) co-activator-1a (PGC-1a or PPARGC1A) ( Wu et al. 2002 ), and co-repressors receptor interacting protein 140

Free access

Ji Seon Park, Su Jung Bae, Sik-Won Choi, You Hwa Son, Sung Bum Park, Sang Dal Rhee, Hee Youn Kim, Won Hoon Jung, Seung Kyu Kang, Jin Hee Ahn, Seong Hwan Kim and Ki Young Kim

examined the genes expression as described previously ( Park et al . 2011 ). Expression studies were carried out using gene-specific primers for mouse peroxisome proliferator-activated receptor γ ( Pparg2 ), glycerol-3-phosphate dehydrogenase ( Gpd1

Free access

Rui Wang, Jie Hong, Ruixin Liu, Maopei Chen, Min Xu, Wiqiong Gu, Yifei Zhang, Qinyun Ma, Feng Wang, Juan Shi, Jiqiu Wang, Weiqing Wang and Guang Ning

that evoked WNT/β-catenin signalling in white and brown preadipocytes leads to the maintenance of the undifferentiated state and prevents the induction of CCAAT/enhancer-binding protein α (Cebpa) and peroxisome proliferator-activated receptor γ (Pparg

Free access

Tram B Doan, J Dinny Graham and Christine L Clarke

NR1C3 PPARG 5468 Fatty acids Decreased Rev-erbs NR1D1 REV-ERBa 9572 Heme Decreased NR1D2 REV-ERBb 9975 Heme Decreased Liver X receptor-like NR1H2 LXRb 7376 Retinoic acid Decreased

Free access

Tuulikki Seppänen-Laakso and Matej Orešič

synthesis of toxic lipids. In this context, we studied the PPARG(−/−) Lep(ob)/Lep(ob) (POKO mouse), which is characterized by limited AT expandability due to ablation of PPARG and a severe diabetic phenotype ( Medina-Gomez et al . 2007 ). Using UPLC

Open access

Oro Uchenunu, Michael Pollak, Ivan Topisirovic and Laura Hulea

/or translational regulation. MTORC1 stimulates nucleotide synthesis (via ATF4), pentose phosphate pathway and lipid biosynthesis (via SREBP1), adipogenesis (via PPARG), glutamine metabolism (via ATF2 and MYC) and mitochondrial biogenesis (via PPARGC1A and YY1). The

Free access

Cristina Velasco, Sara Comesaña, Marta Conde-Sieira, Jesús M Míguez and José L Soengas

ppara CTGGAGCTGGATGACAGTGA GGCAAGTTTTTGCAGCAGAT 55 GenBank AY494835 pparg GACGGCGGGTCAGTACTTTA ATGCTCTTGGCGAACTCTGT 60 DFCI CA345564 srebp1c GACAAGGTGGTCCAGTTGCT CACACGTTAGTCCGCATCAC 60 GenBank CA048941

Free access

Changxue Lu and Sheue-Yann Cheng

three different genes ( PPARA , PPARD , and PPARG ) located at chromosomes 22, 6, and 3 respectively. Upon ligand binding, PPARs are recruited to peroxisome proliferator response elements (PPREs) in the regulatory region of target genes as heterodimers