Search Results

You are looking at 1 - 2 of 2 items for :

  • Akkermansia muciniphila x
  • User-accessible content x
Clear All
Free access

Shaoqian Zhao, Wen Liu, Jiqiu Wang, Juan Shi, Yingkai Sun, Weiqing Wang, Guang Ning, Ruixin Liu, and Jie Hong

report showing that A. muciniphila is increased in type 2 diabetic subjects ( Qin et al . 2012 ). Based on a recent research, anti-diabetic metformin treatment improved glucose homeostasis in association with increased Akkermansia spp. population in

Free access

Mohamed H Noureldein, Sara Bitar, Natalie Youssef, Sami Azar, and Assaad A Eid

against 16S rRNA gene levels in each sample and were compared to controls. Table 1 List of primers. Primer Sequence Reference Forward Reverse Akkermansia muciniphila CAGCACGTGAAGGTGGGGAC CCTTGCGGTTGGCTTCAGAT