Filter

Refine by collections

Refine by access

Refine by date

—
  • Print
  • Save

Search Results

You are looking at 11 - 20 of 204 items for :

  • Refine by access: All content x
Clear All
Noboru Uchida Department of Pediatrics, Keio University School of Medicine, Tokyo, Japan

Search for other papers by Noboru Uchida in
Google Scholar
PubMed Close
,
Tomohiro Ishii Department of Pediatrics, Keio University School of Medicine, Tokyo, Japan

Search for other papers by Tomohiro Ishii in
Google Scholar
PubMed Close
,
Naoko Amano Department of Pediatrics, Keio University School of Medicine, Tokyo, Japan
Department of Pediatrics, Saitama City Hospital, Saitama, Japan

Search for other papers by Naoko Amano in
Google Scholar
PubMed Close
,
Shuji Takada Department of Systems BioMedicine, National Research Institute for Child Health and Development, Tokyo, Japan

Search for other papers by Shuji Takada in
Google Scholar
PubMed Close
,
Kyoko Kobayashi Laboratory of Veterinary Toxicology, Tokyo University of Agriculture and Technology, Tokyo, Japan

Search for other papers by Kyoko Kobayashi in
Google Scholar
PubMed Close
,
Tomoaki Murakami Laboratory of Veterinary Toxicology, Tokyo University of Agriculture and Technology, Tokyo, Japan

Search for other papers by Tomoaki Murakami in
Google Scholar
PubMed Close
,
Satoshi Narumi Department of Pediatrics, Keio University School of Medicine, Tokyo, Japan
Department of Molecular Endocrinology, National Research Institute for Child Health and Development, Tokyo, Japan

Search for other papers by Satoshi Narumi in
Google Scholar
PubMed Close
, and
Tomonobu Hasegawa Department of Pediatrics, Keio University School of Medicine, Tokyo, Japan

Search for other papers by Tomonobu Hasegawa in
Google Scholar
PubMed Close

Introduction Wnt/β-catenin signaling is critical for embryonic development and the differentiation of various tissues, including the adrenal cortex ( Wood & Hammer 2011 ). It is regulated or modified by various molecules. Zinc and ring finger

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JME-24-0015
Volume/Issue:
Volume 73: Issue 4
Restricted access
Jianqiu Gu Department of Endocrinology and Metabolism and the Institute of Endocrinology, The First Hospital of China Medical University, Shenyang, People’s Republic of China
Division of Advanced Diagnostics, Toronto General Hospital Research Institute, University Health Network, Toronto, Canada

Search for other papers by Jianqiu Gu in
Google Scholar
PubMed Close
,
Weijuan Shao Division of Advanced Diagnostics, Toronto General Hospital Research Institute, University Health Network, Toronto, Canada

Search for other papers by Weijuan Shao in
Google Scholar
PubMed Close
,
Dinghui Liu Division of Advanced Diagnostics, Toronto General Hospital Research Institute, University Health Network, Toronto, Canada
Department of Cardiology, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, People’s Republic of China

Search for other papers by Dinghui Liu in
Google Scholar
PubMed Close
,
Jia Nuo Feng Division of Advanced Diagnostics, Toronto General Hospital Research Institute, University Health Network, Toronto, Canada
Department of Physiology, Temerty Faculty of Medicine, University of Toronto, Toronto, Canada

Search for other papers by Jia Nuo Feng in
Google Scholar
PubMed Close
,
Juan Pang Division of Advanced Diagnostics, Toronto General Hospital Research Institute, University Health Network, Toronto, Canada
Department of Nutrition, School of Public Health, Sun Yat-sen University, Guangzhou, People’s Republic of China

Search for other papers by Juan Pang in
Google Scholar
PubMed Close
, and
Tianru Jin Division of Advanced Diagnostics, Toronto General Hospital Research Institute, University Health Network, Toronto, Canada
Department of Physiology, Temerty Faculty of Medicine, University of Toronto, Toronto, Canada
Banting and Best Diabetes Centre, Temerty Faculty of Medicine, University of Toronto, Toronto, Canada

Search for other papers by Tianru Jin in
Google Scholar
PubMed Close

Introduction Twenty-two years ago, Ross and colleagues have demonstrated that the activation of canonical Wnt signaling pathway (defined as Wnt pathway hereafter) via the Wnt ligand Wnt10b maintains pre-adipocytes in an undifferentiated state

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JME-22-0026
Volume/Issue:
Volume 69: Issue 2
Restricted access
Gill Holdsworth Bone Therapeutic Area, UCB Pharma, Slough, United Kingdom

Search for other papers by Gill Holdsworth in
Google Scholar
PubMed Close
,
Scott J Roberts Bone Therapeutic Area, UCB Pharma, Slough, United Kingdom

Search for other papers by Scott J Roberts in
Google Scholar
PubMed Close
, and
Hua Zhu Ke Bone Therapeutic Area, UCB Pharma, Slough, United Kingdom

Search for other papers by Hua Zhu Ke in
Google Scholar
PubMed Close

amount of research into its biology. Sclerostin is now understood to act as an antagonist of the canonical WNT signalling pathway in osteoblast lineage cells, thereby negatively regulating bone formation. Inhibition of sclerostin has been proposed as a

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JME-18-0176
Volume/Issue:
Volume 62: Issue 2
Free access
Tadeusz Niedźwiedzki
Search for other papers by Tadeusz Niedźwiedzki in
Google Scholar
PubMed Close
and
Joanna Filipowska Department of Orthopedics and Physiotherapy, Department of Cell Biology and Imaging, Collegium Medicum, Jagiellonian University, Cracow, Poland

Search for other papers by Joanna Filipowska in
Google Scholar
PubMed Close

-receptor involved in the Wnt/β-catenin pathway. The latter pathway is particularly involved in bone formation, and thus its disruption leads to high bone mass disease ( Boyden et al . 2002 ). Enhanced bone resorption, associated with the overactivity of osteoclasts

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JME-15-0067
Volume/Issue:
Volume 55: Issue 2
Free access
Hiroshi Ishikawa Department of Reproductive Medicine, Graduate School of Medicine, Chiba University, Chiba, Japan

Search for other papers by Hiroshi Ishikawa in
Google Scholar
PubMed Close
,
Tatsuya Kobayashi Department of Reproductive Medicine, Graduate School of Medicine, Chiba University, Chiba, Japan
Evolution and Reproductive Medicine, Medical Mycology Research Center, Chiba University, Chiba, Japan
Fujita Medical Innovation Center Tokyo, Reproduction Center, Tokyo, Japan

Search for other papers by Tatsuya Kobayashi in
Google Scholar
PubMed Close
,
Meika Kaneko Department of Reproductive Medicine, Graduate School of Medicine, Chiba University, Chiba, Japan

Search for other papers by Meika Kaneko in
Google Scholar
PubMed Close
,
Yoshiko Saito Department of Reproductive Medicine, Graduate School of Medicine, Chiba University, Chiba, Japan

Search for other papers by Yoshiko Saito in
Google Scholar
PubMed Close
,
Makio Shozu Evolution and Reproductive Medicine, Medical Mycology Research Center, Chiba University, Chiba, Japan

Search for other papers by Makio Shozu in
Google Scholar
PubMed Close
, and
Kaori Koga Department of Reproductive Medicine, Graduate School of Medicine, Chiba University, Chiba, Japan

Search for other papers by Kaori Koga in
Google Scholar
PubMed Close

al. 2023 ). Moreover, MED12-UFs have increased ECM organization, cell adhesion, integrin-mediated signaling pathway, Wnt/β-catenin signaling pathway, and response to estrogen, whereas wt-UFs have increased angiogenic activities and smooth muscle cell

Article Type:
Review Article
Collections:
Rising Stars special collection
DOI:
https://doi.org/10.1530/JME-23-0039
Volume/Issue:
Volume 71: Issue 4
Free access
Anuradha Mishra National Institute for Research in Reproductive and Child Health, ICMR, Parel, Mumbai, India

Search for other papers by Anuradha Mishra in
Google Scholar
PubMed Close
,
Nirmalya Ganguli National Institute of Immunology, New Delhi, India
National Institute of Animal Biotechnology (NIAB), Hyderabad, Telangana, India

Search for other papers by Nirmalya Ganguli in
Google Scholar
PubMed Close
,
Subeer S Majumdar National Institute of Immunology, New Delhi, India
National Institute of Animal Biotechnology (NIAB), Hyderabad, Telangana, India

Search for other papers by Subeer S Majumdar in
Google Scholar
PubMed Close
, and
Deepak Modi National Institute for Research in Reproductive and Child Health, ICMR, Parel, Mumbai, India

Search for other papers by Deepak Modi in
Google Scholar
PubMed Close

3’ 65 170 Wnt4 F-5’ TGGACTCCCTCCCTGTCTTTGGGA 3’ R-5’ TCCTGACCACTGGAAGCCCTGTG 3’ 64 188 Ctnnb1 F-5’ GCGGCCGCGAGGTACCTGAA 3’ R-5’ GAAGGAGCTGTGGTGGTGGCA 3’ 60 192 Real-Time PCR (qPCR) Total RNA was extracted

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JME-22-0051
Volume/Issue:
Volume 69: Issue 3
Restricted access
Huixia Li Department of Physiology and Pathophysiology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi, China

Search for other papers by Huixia Li in
Google Scholar
PubMed Close
,
Hui Meng Department of Physiology and Pathophysiology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi, China

Search for other papers by Hui Meng in
Google Scholar
PubMed Close
,
Min Xu Department of Physiology and Pathophysiology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi, China

Search for other papers by Min Xu in
Google Scholar
PubMed Close
,
Xin Gao Department of Physiology and Pathophysiology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi, China

Search for other papers by Xin Gao in
Google Scholar
PubMed Close
,
Xulei Sun Department of Physiology and Pathophysiology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi, China

Search for other papers by Xulei Sun in
Google Scholar
PubMed Close
,
Xinxin Jin Department of Physiology and Pathophysiology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi, China

Search for other papers by Xinxin Jin in
Google Scholar
PubMed Close
, and
Hongzhi Sun Department of Physiology and Pathophysiology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi, China

Search for other papers by Hongzhi Sun in
Google Scholar
PubMed Close

air. For osteogenic differentiation, MC3T3-E1 cells were cultured in an osteogenic induction medium with 10 mM β-glycerophosphate and 50 µg/mL l -ascorbic acid. Rapamycin (100 nM), Wnt3a (50 ng/ml), SKL2001 (20 nM), and TDZD-8 (9 μM) were added to the

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JME-22-0181
Volume/Issue:
Volume 70: Issue 4
Restricted access
Cathrin Brisken ISREC - Swiss Institute for Experimental Cancer Research, School of Life Sciences, Ecole Polytechnique Fédérale de Lausanne (EPFL), Station 19, Lausanne, Switzerland
Breast Cancer Now Research Centre, Institute of Cancer Research, London, UK

Search for other papers by Cathrin Brisken in
Google Scholar
PubMed Close
and
Valentina Scabia ISREC - Swiss Institute for Experimental Cancer Research, School of Life Sciences, Ecole Polytechnique Fédérale de Lausanne (EPFL), Station 19, Lausanne, Switzerland

Search for other papers by Valentina Scabia in
Google Scholar
PubMed Close

formation of a bi-layered epithelium and cellular differentiation ( Aggeler et al. , 1991 ), however, steroid hormone receptor expression is down modulated and progesterone target genes like WNT4 and RANKL are not induced ( Graham et al. , 2009

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JME-20-0091
Volume/Issue:
Volume 65: Issue 1
Free access
Patricia K Russell Department of Medicine, Austin Health, University of Melbourne, Studley Road, Heidelberg, Victoria 3084, Australia

Search for other papers by Patricia K Russell in
Google Scholar
PubMed Close
,
Michele V Clarke Department of Medicine, Austin Health, University of Melbourne, Studley Road, Heidelberg, Victoria 3084, Australia

Search for other papers by Michele V Clarke in
Google Scholar
PubMed Close
,
Jarrod P Skinner Department of Medicine, Austin Health, University of Melbourne, Studley Road, Heidelberg, Victoria 3084, Australia

Search for other papers by Jarrod P Skinner in
Google Scholar
PubMed Close
,
Tammy P S Pang Department of Medicine, Austin Health, University of Melbourne, Studley Road, Heidelberg, Victoria 3084, Australia

Search for other papers by Tammy P S Pang in
Google Scholar
PubMed Close
,
Jeffrey D Zajac Department of Medicine, Austin Health, University of Melbourne, Studley Road, Heidelberg, Victoria 3084, Australia

Search for other papers by Jeffrey D Zajac in
Google Scholar
PubMed Close
, and
Rachel A Davey Department of Medicine, Austin Health, University of Melbourne, Studley Road, Heidelberg, Victoria 3084, Australia

Search for other papers by Rachel A Davey in
Google Scholar
PubMed Close

genes associated with bone growth and development was upregulated; Gh mRNA expression was increased 3.6-fold ( P <0.005), Wnt4 increased by 2.3-fold ( P <0.05), Irf4 increased by 2.6-fold ( P <0.001), and Tgfb2 increased by twofold ( P <0

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JME-12-0014
Volume/Issue:
Volume 49: Issue 1
Free access
Tilman D Rachner Department of Medicine III, Technische Universität Dresden Medical Center, Dresden, Germany
Center for Healthy Aging, Technische Universität Dresden Medical Center, Dresden, Germany
German Cancer Consortium (DKTK), partner site Dresden and German Cancer Research Center (DKFZ), Dresden, Germany

Search for other papers by Tilman D Rachner in
Google Scholar
PubMed Close
,
Lorenz C Hofbauer Department of Medicine III, Technische Universität Dresden Medical Center, Dresden, Germany
Center for Healthy Aging, Technische Universität Dresden Medical Center, Dresden, Germany
German Cancer Consortium (DKTK), partner site Dresden and German Cancer Research Center (DKFZ), Dresden, Germany
Center for Regenerative Therapies Dresden, Technische Universität Dresden, Dresden, Germany

Search for other papers by Lorenz C Hofbauer in
Google Scholar
PubMed Close
,
Andy Göbel Department of Medicine III, Technische Universität Dresden Medical Center, Dresden, Germany
German Cancer Consortium (DKTK), partner site Dresden and German Cancer Research Center (DKFZ), Dresden, Germany

Search for other papers by Andy Göbel in
Google Scholar
PubMed Close
, and
Elena Tsourdi Department of Medicine III, Technische Universität Dresden Medical Center, Dresden, Germany
Center for Healthy Aging, Technische Universität Dresden Medical Center, Dresden, Germany
German Cancer Consortium (DKTK), partner site Dresden and German Cancer Research Center (DKFZ), Dresden, Germany

Search for other papers by Elena Tsourdi in
Google Scholar
PubMed Close

mass through the Wnt canonical signaling pathway, which was subsequently established as the major regulator of osteoblast function ( Gaur et al. 2005 ) ( Fig. 2 ). Wnt signaling also induces osteoprotegerin (OPG), an osteoblast secreted factor that

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JME-18-0173
Volume/Issue:
Volume 62: Issue 2
Free access