miRNA-155 silencing reduces sciatic nerve injury in diabetic peripheral neuropathy

in Journal of Molecular Endocrinology
View More View Less
  • 1 Department of Endocrinology, The First Affiliated Hospital of University of South China, Hengyang, People’s Republic of China
  • 2 Department of Anesthesiology, The First Affiliated Hospital of University of South China, Hengyang, People’s Republic of China

Correspondence should be addressed to F Yang: dryang_fengruiyang@163.com

*(J Chen and C Li contributed equally to this work)

Neuropathic pain represents one of the most common complications associated with diabetes mellitus (DM) that impacts quality of life. Accumulating studies have highlighted the involvement of miRNAs in DM. Thus, the current study aimed to investigate the roles of miR-155 in diabetic peripheral neuropathy (DPN). In vitro DPN models were established using rat Schwann cells (SCs) by treatment with 5.5 mM glucose. Gain- or loss-of-function studies were conducted to determine the effect of miR-155 on Nrf2, cellular function, reactive oxygen species and inflammation. Rat DNP models were established by streptozotocin injection and damage of sciatic nerve. Next, miR-155 antagomir or agomir was employed to investigate the effects associated with miR-155 on motor and sciatic nerve conduction velocity (MNCV, SNCV), angiogenesis and inflammatory response in vivo. Nrf2 was identified to be a target of miR-155 by dual-luciferase reporter gene assay. Silencing of miR-155 or restoration of Nrf2 promoted cell proliferation, inhibited apoptosis and alleviated inflammation in vitro. miR-155 antagomir-induced inhibition increased MNCV and SNCV, strengthened angiogenesis and alleviated inflammation in DPN rats. Additionally, the effects exerted by miR-155 were reversed when Nrf2 was restored both in vitro and in vivo. Taken together, the key findings of our study provide evidence indicating that miR-155 targeted and suppressed Nrf2 in DPN. miR-155 silencing was found to alleviate sciatic nerve injury in DPN, highlighting its potential as a therapeutic target for DPN.

Abstract

Neuropathic pain represents one of the most common complications associated with diabetes mellitus (DM) that impacts quality of life. Accumulating studies have highlighted the involvement of miRNAs in DM. Thus, the current study aimed to investigate the roles of miR-155 in diabetic peripheral neuropathy (DPN). In vitro DPN models were established using rat Schwann cells (SCs) by treatment with 5.5 mM glucose. Gain- or loss-of-function studies were conducted to determine the effect of miR-155 on Nrf2, cellular function, reactive oxygen species and inflammation. Rat DNP models were established by streptozotocin injection and damage of sciatic nerve. Next, miR-155 antagomir or agomir was employed to investigate the effects associated with miR-155 on motor and sciatic nerve conduction velocity (MNCV, SNCV), angiogenesis and inflammatory response in vivo. Nrf2 was identified to be a target of miR-155 by dual-luciferase reporter gene assay. Silencing of miR-155 or restoration of Nrf2 promoted cell proliferation, inhibited apoptosis and alleviated inflammation in vitro. miR-155 antagomir-induced inhibition increased MNCV and SNCV, strengthened angiogenesis and alleviated inflammation in DPN rats. Additionally, the effects exerted by miR-155 were reversed when Nrf2 was restored both in vitro and in vivo. Taken together, the key findings of our study provide evidence indicating that miR-155 targeted and suppressed Nrf2 in DPN. miR-155 silencing was found to alleviate sciatic nerve injury in DPN, highlighting its potential as a therapeutic target for DPN.

Introduction

As one of the most common chronic illnesses in most countries, diabetes mellitus (DM) affects increasingly more patients and is believed to be related to declined physical exercises and obesity (Whiting et al. 2011). Diabetic peripheral neuropathy (DPN) is a common complication of DM, characterized by neuropathic pain and foot ulceration, leading to lower limb amputation and therefore disability and reduced quality of life (Lee et al. 2015, Gok Metin et al. 2017). At present, the available treatment modalities employed for DPN are based on three principles: aggressive glycemic control, treatment for causes and therapies for symptoms (Javed et al. 2015). Despite commendable advancements made in recent years, chronic diabetic complications remain a major clinical stumbling block for patients with poorly controlled DM, leading to increased morbidity and mortality and a severe burden to individuals, families, societies and health care systems worldwide (Zimmet et al. 2014). All of the aforementioned highlight the urgent need for more effective therapeutic strategies for DPN and DM.

miRNAs are widely understood to be a series of small non-coding RNA molecules 18–25 nucleotides in length, capable of negatively regulating gene expressions (Jung & Suh 2014). miRNAs are associated with multiple diseases, markers for clinical diagnoses and treatment targets (Hammond 2015). A previous study revealed the potential involvement of miR-155 in the pathogenesis of diabetic complications (Khamaneh et al. 2015). More specifically, miR-155 is upregulated in DPN rats while miR-155 suppression may be prophylactically beneficial to DM (El-Lithy et al. 2016). Additionally, miR-155 has been shown to target a transcription nuclear factor, erythroid 2-like 2 (Nrf2) (Yang et al. 2018b). Nrf2 has been reported to modulate the expression of a considerable number of genes, including those that control antioxidant enzymes, immune and inflammatory responses (Hybertson et al. 2011). More importantly, Nrf2 is a candidate for treating neurodegeneration and therefore complications of DM due to its ability to regulate genes related to antioxidative enzymes (Xiong et al. 2015). Moreover, Nrf2 has been implicated in various inflammatory and apoptotic pathways that promote the development of diabetic neuropathy (Kumar & Mittal 2017). Hence, we hypothesized that miR-155 might target Nrf2 in the progression of DPN. The central objective of the study was to determine the involvement and interaction of miR-155 and Nrf2 in the context of sciatic nerve injury in DPN.

Materials and methods

Ethical statement

All experimental procedures involved animals were conducted with the approval of the Experimental Animal Ethics Committee of The First Affiliated Hospital of University of South China.

RNA isolation and quantitation

Total RNA was extracted using TRIzol (15596026, Invitrogen). RNA concentration and purity were determined using a Nano-Drop ND-1000 spectrophotometer. RNA was subsequently reversely transcribed into cDNA by PrimeScript RT reagent Kit (RR047A, TaKaRa) and TaqMan microRNA Reverse Transcription Kit (Applied Biosystems). The primers for miR-155, Nrf2, B-cell lymphoma (Bcl-2), Bcl-2-associated X protein (Bax), cleaved-caspase-3, U6 and glyceraldehyde 3-phosphate dehydrogenase (GADPH) were designed and synthesized by Shanghai Sangon Biotech Co., Ltd. (Shanghai, China) (Table 1). Fluorescent RT-qPCR (SYBR®Premix Ex TaqTM II, TaKaRa) was performed using the ABI 7500 system. The relative gene expression was calculated based on the 2−ΔΔCt method (Arocho et al. 2006).

Table 1

Primer sequences for RT-qPCR.

Target genesForward primer (5′–3′)Reverse primer (5′–3′)
miR-155CTCTAATGGTGGCACAAATGATAAAAACAAACATGGGCTTGA
Nrf2CGGTATGCAACAGGACATTGACTGGTTGGGGTCTTCTGTG
BaxGGATGCGTCCACCAAGAAGGCCTTGAGCACCAGTTTGC
Bcl-2CACGCTGGGAGAACACTGGGAGGAGAAGATG
U6CTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT
GadphCCCTCAAGATTGTCAGCAATGCGTCCTCAGTGTAGCCCAGGAT

RT-qPCR, reverse transcription quantitative polymerase chain reaction.

Western blot analysis

Tissue or cell total protein was collected by adding radioimmunoprecipitation assay (RIPA) lysis (P0013B, Beyotime Biotechnology Co.), phenylmethane sulfonyl fluoride (PMSF) and phosphatase inhibitor. Protein concentration was determined using a bicinchoninic acid (BCA) protein quantitative kit (Beyotime Biotechnology Co., Ltd.). A total of 30 µg cell total protein was utilized for SDS-PAGE. Protein was then transferred onto a nitrocellulose filter membrane. The membrane was then sealed for 1.5 h with 5% skimmed milk, and then incubated with rabbit anti-human primary antibodies NRF2 (ab62352, 1:1000, Abcam Inc.), BAX (ab32503, 1:1000), BCL-2 (ab32124, 1:1000), Cleaved-caspase-3 (ab2302, 1:1000) and GAPDH (ab9485, 1:2500) at 4°C overnight. On the following day, the samples were rinsed with Tris-buffered saline and Tween 20. Secondary antibody to horseradish peroxidase (HRP)-labeled anti-rabbit immunoglobulin G (IgG, ab205718, 1:2000–50,000) was added to the membrane and incubated for 2 h. Enhanced chemiluminescence (ECL) was added for color development after which images were obtained using the SmartView Pro 2000 (UVCI-2100, Major Science, Saratoga, CA, USA). The protein bands were analyzed by Quantity One software (BioRad).

Dual-luciferase reporter gene assay in HEK293T cells

Nrf2 WT 3′-untranslated region (3′-UTR) and mutant (MUT) were synthesized, amplified and sub-cloned into the pmiR-RB-REPORTTM vector (RiboBio Company, Guangzhou, Guangdong, China). The empty plasmid was transfected as the control. Vectors containing Nrf2 MUT or WT were co-transfected into HEK293T cells with negative control (NC) mimic or miR-155 mimic. The cells were collected after 48 h of transfection. Luciferase activity was determined using a luciferase detection kit (RG005, Beyotime Biotechnology Co.). Relative light unit (RLU) was measured using the following equation: RLU = RLURenilla luciferase/RLUfirefly luciferase using firefly luciferase as internal reference (Tan et al. 2015).

Transfection in RSC96 cells

Rat Schwann cell line RSC96 was cultured in a T75 flask containing Dulbecco’s modified Eagles medium (DMEM, 4 mM 1-glutamine, 1.5 g/L sodium bicarbonate and 5.5 mM glucose; Gibco). The culture medium was supplemented with 100 U/mL penicillin, 100 mg/mL streptomycin and 10% fetal bovine serum and replaced every 2 days. RSC96 cells were seeded into a six-well plate at 3 × 105 cells/well and transfected with miR-155 mimic, miR-155 inhibitor, Nrf2 overexpression plasmid and their negative controls (miR-155 mimic NC, miR-155 inhibitor NC and Nrf2 NC) using lipofectamine 2000 kit (Invitrogen). A total of 250 μL serum-free Opti-Multi Experiment Matrix (MEM) (Gibco) was applied to dilute 4 μg target plasmid and 10 μL Lipofectamine 2000. After mixing for 5 min and subsequent standing for 20 min, the mixture was incubated at 37°C with 5% CO2. After 6 h, the mixture was replaced by a complete culture medium. The cells were collected for further experiments after an additional 48-h period of culture.

Cell proliferation determined by 5-ethynyl-2′-deoxyuridine (EdU) assay

The cells in each group were seeded into a 96-well plate at 1.6 × 105 cells/well for 48 h EdU (50 mM, Cell-Light™ EdU Apollo®488 In Vitro Imaging Kit, RiboBio Inc., Guangzhou, China) was added to each well for 4-h incubation at 37°C. The cells were fixed with 4% formaldehyde for 15 min, followed by permeabilization with 0.5% Triton X-100 for 20 min. Apollo® mixture (100 mL) was then added to the cells and incubated for 30 min. The cells were stained with 100 mL Hoechst33342 dye for 30 min, after which the images of the cells were captured under a fluorescence microscope (Olympus). The number of EdU-positive cells (red) was calculated by Image-Pro Plus (IPP) 6.0 software (Media Cybernetics, Bethesda, MD, USA). The EdU incorporation rate was expressed as a ratio between the number of EdU-positive cells and total cells (blue).

Cell apoptosis determined by TUNEL

Cell apoptosis was detected using a TUNEL kit (Boster Biological Technology, Ltd., Wuhan, China). Briefly, following dewaxing and dehydration, the cells on the coverslip were treated with protease K (Boston Biological Technology, Ltd., Wuhan, China) for 20 min. After rinsing, the cells were placed into the TUNEL reaction mixture and incubated at 37°C for 60 min. After washing with PBS, the cells were analyzed under a fluorescence microscope (BX-60, Olympus) with excitation filter at 450–500 nm and emission filter at 515–565 nm. The cells in NC group were incubated with a labeling solution (without terminal transferase) instead of the TUNEL reaction mixture. The positive control slides were incubated with bovine pancreatic DNase I (0.01 mg/mL, Boster Biological Technology, Ltd., Wuhan, China). The number of apoptotic cells was determined using Image-Pro Plus 6.0 software (Media Cybernetics).

Reactive oxygen species (ROS) activity assay in RSC96 cells

The RSC96 cells were seeded into a six-well plate at 2 × 105 cells/well overnight. The cells were then treated with 150 mM glucose and phenolic resin (1, 10 and 100 μM) for 48 h. The cells were collected and then incubated with 1 mL serum-free DMEM containing 100 μL ROS assay stain solution (dichlorofluorescein (DCF)) under conditions void of light 37°C for 30 min. The fluorescence intensity of DCF was detected using a BD LSRFortessa™ flow cytometer (BD Biosciences) (Yang et al. 2016).

Determination of antioxidative enzymes and inflammatory mediators by ELISA

Cell culture supernatant or serum was collected in order to determine the levels of NAD(P)H quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), glutathione peroxidase (GPX), TGF-β, IL-10, VEGF, interferon (IFN)-γ and IL-4 by commercially available ELISA kits (RapidBio Systems, West Hills, CA, USA). The antigen was diluted at a ratio of 1:20 using coating diluent and added to each well. One hundred μicroliter standard diluent was also added to each well and permitted to stand overnight at 4°C. Liquid was removed from each well followed by three washes (1 min each time) using washing buffer. The diluted samples (100 μL) were then added to each well. The samples were evaluated in duplicates. After removal of the liquid from each well and three rounds of washing, enzyme conjugate (100 μL) was added to each well and incubated at 37°C for 30 min. Horseradish peroxidase substrate (100 μL) was subsequently added to each well and incubated at 37°C for 10–20 min under conditions void of light. In the event of a color change in the positive control or a slight color change in the negative control, 50 μL of stop solution was added to each well to terminate the reaction. The absorbance (presented in optical density (OD)) value was determined at a wavelength of 450 nm using a microplate reader (SpectraMax M5; Molecular Devices, LLC.) within 20 min.

STZ-induced diabetic rat model

Forty-eight adult male-specific pathogen-free rats (weighting 200 ± 20 g, Institute of Laboratory Animal Sciences of the Chinese Academy of Medical Sciences, Beijing, China) were housed in either separate micro-isolators or cages and provided with free access to sterile acidified water and food in a pathogen-free facility. At the age of 7–8 weeks, the rats were intraperitoneally injected with streptozotocin (STZ, 55 mg/kg) in 0.1 mM of sodium citrate buffer (pH 4.5). Daily citrate buffer was injected in control rats. One week after the final injection, the blood glucose from the tail vein was measured using a Brio Blood Glucose Meter (Bayer, Leverkusen, German). Rats with blood glucose concentration of 250 mg/dL were enrolled as the STZ-induced DM group. All rats were raised under controlled temperature and humidity conditions as well as a 12-h light/darkness cycle.

Peripheral nephropathy surgery and treatment in rats

The rats were anesthetized with 3% pentobarbital sodium (30 mg/kg, i.p.). The skin on the upper left leg was removed and disinfected using 10% betadine solution. The middle thigh muscle of the hind left leg was cut in order to expose the sciatic nerve. The sciatic nerve was lifted and clipped for 30 s with a no. 5 Jeweler’s forceps. This procedure was repeated one more time after a 10-s break. Sciatic nerve was exposed but not clipped for sham rats. Muscle and skin incisions were closed using a 5-0 vinyl suture. The sciatic nerve on the right leg was used as the control.

One week after the surgery, rats were injected at the gastrocnemius with RSC96 cell suspension (1 × 106) modified with miR-155 agomir NC, miR-155 antagomir, miR-155 agomir NC, miR-155 agomir, NRF2 NC, NRF2 or both miR-155 agomir and NRF2.

Determination of nerve conduction velocity (NCV) in sciatic nerve

Rats were anesthetized by 1% pentobarbital sodium (30 mg/kg) (No. P3761, Sigma-Aldrich). The sciatic nerve on the right leg was exposed and stimulation and recording electrodes were placed. The functional experiment system (BL-420s; Taimeng, Sichuan, China) was used to stimulate the sciatic nerve at 1.2 V in intensity for 1 ms. The distance between the two stimulation sites was set at 6 mm. The distance (D) between the stimulation and recording electrodes and the action potential latency (L) of the sciatic nerve were measured in order to calculate the motor nerve conduction velocity (MNCV) using the following formula: MNCV (m/s) = D/L. In regard to sciatic NCV (SNCV), the recording position was at the notch of the sciatic nerve. SNCV was calculated using the same method as MNCV.

Morphological changes in sciatic nerve observed under transmission electron microscope

The rats were perfused with 4% polyoxymethylene after which the sciatic nerve was dissected. The nerve tissues were fixed with 2.5% glutaraldehyde at 4°C for 2 h, and then immersed in 2% osmium tetroxide. After dehydration and Epon embedding, 60 nm of ultrathin sections were stained with 2% lead citrate and 0.4% uranyl acetate. Images were captured using H-7650 electron microscope (20000×, Hitachi) by investigators blinded to the experimental groups.

Tube formation assay of sciatic nerve cells

Tube formation was performed in a double chamber co-culture system separated by a membrane (pore diameter: 0.4 μm, 12-well inserter, BD Biosciences), which was employed to separate the cells in the apical and the basolateral chamber. Sciatic nerve cells (1 × 105 cells/well) from each group were cultured in the apical chamber, and endothelial progenitor cells (EPCs) (1 × 105 cells/well) isolated from the sciatic nerve from each group were cultured in the basolateral chamber. The cells were exposed to high glucose (HG) conditions for a period of 48 h. The supernatant was subsequently collected in order to determine the VEGF expression. EPCs in the basolateral chamber were collected in order to measure the expression of vascular endothelial growth factor receptor type 2 (VEGFR2).

Immunofluorescence in sciatic nerve tissue

Sciatic nerve tissues were fixed in 10% formalin for 48 h and embedded in paraffin. Serial thick (4 μm) sections from each sample were prepared on a silanized coverslip. The sections were then blocked with Protein Block Serum-Free solution. A suspension of LX2 cells (1 × 106 cells/mL) was added in a dropwise manner onto a polylysine-pretreated coverslip and incubated for 10 min. The cells were then fixed on ice with cold acetone for 15 min and blocked with 5% (w/v) bovine serum albumin. Primary rabbit antibodies to NeuN (ab177487, 1:300), CD31 (ab64543, 1:100) and γH2AX (ab26350, 1:200) were added and incubated at 4°C overnight. Fluorescent-labeled secondary antibody goat anti-rabbit IgG (ab150079) or goat-anti-mouse IgG (ab150113) was added for 1-h incubation at room temperature. All antibodies were obtained from Abcam Inc.. The cells were then washed and stained with propidium iodide (eBioscience) for 10 min. A coverslip was fixed with anti-fade fluorescence glycerol buffer. The cells were then visualized using a fluorescence microscope (Olympus IX51).

Statistical analysis

All data were analyzed by SPSS 21.0 (IBM). Data were expressed as mean ± standard deviation. Data comparison between two groups of data that conformed to normal distribution and had equal variance was performed using an unpaired or paired t test. One-way ANOVA was applied for comparison among multiple groups, followed by Tukey’s post hoc test. Difference was considered to be statistically significant when P < 0.05.

Results

miR-155 targets Nrf2

miRNAs represent small non-coding RNAs with regulatory functions that regulate the expression of target genes primarily by pairing with the 3′UTR mRNA of the target gene, either completely or incompletely (Ha & Kim 2014). The pmiR-RB-Report™ vector is a detection tool that is specifically designed to detect the action of miRNA. The 3′UTR region of Nrf2 was cloned into the downstream site of the Renilla luciferase (hRluc) reporter vector. The firefly luciferase gene (hLuc) was employed as the internal reference gene. Whether the miR-155 has a regulatory effect on Nrf2 was determined by the relative changes in the activity of Renilla luciferase. A binding site was identified between miR-155 and Nrf2 through an online prediction website (Fig. 1A). Luciferase activity in the cells transfected with miR-155 exhibited a significant decrease in Nrf2-WT but not in Nrf2-MUT, which further suggested that miR-155 targeted Nrf2 (Fig. 1B). Next, miR-155 inhibitor, miR-155 mimic and Nrf2 overexpression plasmid along with the corresponding NC were delivered into the cells and quantification of miR-155 and Nrf2 expression using RT-qPCR and Western blot analysis. There was no significant difference between the cells without any treatment in relation to the mRNA and protein expression in cells transfected with miR-155 inhibitor NC, miR-155 mimic NC, NRF2 NC and miR-155 mimic + NRF2 (Fig. 1C, D and E). Transfection with miR-155 inhibitor resulted in lower miR-155 expression and higher NRF2 expression (P < 0.05), while this change was reversed by transfection with miR-155 mimic (P < 0.05). Transfection with Nrf2 overexpression plasmid, as expected, increased the expression of Nrf2 (P < 0.05), but not miR-155. The aforementioned results suggested that Nrf2 was a target gene of miR-155, which negatively regulated Nrf2 expression.

Figure 1
Figure 1

Interactions between miR-155 and Nrf2 in DPN. (A) Binding sites between miR-155 and Nrf2 are predicted by online software. (B) Luciferase activity of Nrf2-WT and Nrf2-MUT after transfection with miR-155, detected by dual-luciferase reporter gene assay. *P < 0.05 vs cells co-transfected with NC and Nrf2-WT. (C) mRNA expression of miR-155 and (D and E) Protein expression of NRF2 normalized to GAPDH in the normal rats and rats from the STZ-induced DPN model determined by Western blot analysis. *P < 0.05 vs normal group. (F) mRNA expression of miR-155 and Nrf2 determined by RT-qPCR after delivery of miR-155 inhibitor, miR-155 mimic or Nrf2. *P < 0.05 vs blank group. (G and H) protein expression of NRF2 normalized to GAPDH determined by Western blot analysis after delivery of miR-155 inhibitor, miR-155 mimic or NRF2; *P < 0.05 vs blank group. Cell experiments were repeated three times. DPN, diabetic peripheral neuropathy; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MUT, mutant; Nrf2, nuclear factor, erythroid 2-like 2; WT, wild type.

Citation: Journal of Molecular Endocrinology 63, 3; 10.1530/JME-19-0067

Silencing miR-155 or restoring Nrf2 promotes SC proliferation and inhibits apoptosis, ROS and inflammatory reaction in vitro

Next, the cellular functions of miR-155 and Nrf2 in DPN were then determined. In comparison to the untransfected cells, no significant difference was detected in regard to cell proliferation (Fig. 2A and B), apoptosis (Fig. 2C and D), expression of Bax, Bcl-2 and cleaved-caspase-3 (Fig. 2E, F and G), ROS activity (Fig. 2H) and levels of VEGF, IL-1β, IL-6 and TNF-α (Fig. 2I) in cells transfected with miR-155 inhibitor NC, miR-155 mimic NC, Nrf2 NC or miR-155 mimic and Nrf2. Notably, transfection with either miR-155 inhibitor or Nrf2 led to enhanced cell proliferation, reduced apoptosis, suppressed ROS activity, higher Bcl-2 level and reduced expression of Bax, cleaved-caspase-3, VEGF, IL-1β, IL-6 and TNF-α (P < 0.05). However, contrasting results were obtained following transfection with miR-155 mimic (P < 0.05). Thus, based on the results obtained, we concluded that silencing miR-155 or restoring Nrf2 promoted RSC96 cell proliferation, suppressed apoptosis, ROS activity and inflammatory response in vitro.

Figure 2
Figure 2

Effects of silencing miR-155 or restoring Nrf2 on Schwann cells. (A) Representative micrographs showing RSC96 cell proliferation after EdU assay in different groups (×200). (B) The number of EdU-positive cells. (C) Representative micrographs showing cell apoptosis in TUNEL assay (×200). (D) The number of TUNEL-positive cells. (E) mRNA expression of apoptosis-related genes determined by RT-qPCR. (F and G) Levels of apoptosis-related proteins determined by Western blot. (H) ROS activity in RSC96 cells. (I) VEGF, IL-1β, IL-6 and TNF-α levels in RSC96 cells detected by ELISA. *P < 0.05 vs blank group. Cell experiments were repeated three times. Nrf2, nuclear factor, erythroid 2-like 2; ROS, reactive oxygen species; TUNEL, TdT mediated dUTP nick end labeling; Bcl-2, B-cell lymphoma-2; Bax, Bcl-2 associated protein X; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; VEGF, vascular endothelial growth factor; IL, interleukin; TNF, tumor necrosis factor. A full colour version of this figure is available at https://doi.org/10.1530/JME-19-0067.

Citation: Journal of Molecular Endocrinology 63, 3; 10.1530/JME-19-0067

Silencing miR-155 or restoring Nrf2 relieves nerve injury caused by DPN in vivo

The effect of miR-155 and Nrf2 was further evaluated on nerve injury in DM rats in vivo. No notable difference was identified in relation to MNCV (Fig. 3A) and SNCV (Fig. 3B) in rats injected with RSC96 cells that had been transfected with miR-155 antagomir NC, miR-155 agomir NC, Nrf2 NC or miR-155 agomir and Nrf2 when compared to control (citrate buffer injection). The injection of miR-155 antagomir-transfected RSC96 cells resulted in higher MNCV and SNCV values (P < 0.05), while the opposite result was identified in rats injected with miR-155 agomir-transfected RSC96 cells (P < 0.05).

Figure 3
Figure 3

Effects of silencing miR-155 or restoring Nrf2 on DPN rats. (A) Motor nerve conduction velocity in sciatic nerves. (B) Sensory nerve conduction velocity in sciatic nerves. (C) Representative micrographs illustrating the morphological changes in sciatic nerve observed under a transmission electron microscope (10,000×). (D) Number of blood vessels in sciatic nerve from each group. (E) Number of nerve fibers in each group. (F) Axon diameter in myelinated nerve fibers in each group. (G) Myelin sheath thickness of sciatic nerves in each group. (H) Number of tube formation in each group. (I) mRNA expression of Vegfr2 in rat EPCs from each group. (J) Activities of NQO1, GST and GPX in each group determined by ELISA. (K) Representative micrographs showing cell apoptosis in TUNEL assay (×400). (L) Number of TUNEL positive cells in each group. (M) Representative micrographs showing immunofluorescence staining of NeuN and CD31 in sciatic nerve from different groups (×400). (N) γH2AX expression in sciatic nerve from each group detected by immunofluorescence (×400). (O) VEGF, IL-1β, IL-6 and TNF-α levels in each group determined by ELISA. *P < 0.05 vs blank group. n = 6/group. Nrf2, nuclear factor, erythroid 2-like 2; DPN, diabetic peripheral neuropathy; EPC, endothelial progenitor cell; Vegfr2, vascular endothelial growth factor receptor 2; NQO1, NAD (P) H quinone oxidoreductase 1; GST, glutathione S-transferase; GPX, glutathione peroxidase; TUNEL, TdT mediated dUTP nick end labeling; VEGF, vascular endothelial growth factor; IL, interleukin; TNF, tumor necrosis factor. A full colour version of this figure is available at https://doi.org/10.1530/JME-19-0067.

Citation: Journal of Molecular Endocrinology 63, 3; 10.1530/JME-19-0067

The morphological changes in sciatic nerve were analyzed under a transmission electron microscope (Fig. 3C). There were no significant changes in the number of neurointimal blood vessels (Fig. 3D), sciatic nerve fibers (Fig. 3E), the diameter of myelinated axon (Fig. 3F), the thickness of myelin sheath (Fig. 3G) and tube formation (Fig. 3H), in rats injected with RSC96 cells that had been transfected with miR-155 antagomir NC, miR-155 agomir NC, Nrf2 or miR-155 agomir and Nrf2 when compared to control. Moreover, similar results were obtained regarding VEGFR2 expression (Fig. 3I), NQO1, GST and GPX enzyme activity (Fig. 3J) and nerve cell apoptosis (Fig. 3K and L). Injection of miR-155 antagomir-transfected RSC96 cells or Nrf2-transfected RSC96 cells led to an increase in the neurointimal blood vessels and sciatic nerve fibers, longer axon diameter and thicker myelin sheath along with stimulated tube formation, increased VEGFR2 expression, enhanced activities of NQO1, GST and GPX and reduced sciatic cell apoptosis area (P < 0.05). Opposite changes in those values were induced by miR-155 agomir-induced overexpression of miR-155 (P < 0.05).

The effect of miR-155 and Nrf2 on the angiogenesis and inflammatory responses was further evaluated on nerve injury in DM rats in vivo. NeuN antigens are widely used as markers for post-mitotic neurons with highest expression in the central nervous system (Mullen et al. 1992). CD31, a member of the Ig superfamily of cell adhesion molecules, is mainly used to identify the presence of endothelial cells and to evaluate angiogenesis (Ilan & Madri 2003). Hence, the expression of NeuN and CD31 was measured for angiogenesis assessment. The expression of NeuN, CD31 and γH2AX (Fig. 3M and N) in the sciatic nerve as well as the levels of VEGF, IL-1β, IL-6 and TNF-α (Fig. 3O) was similar in the rats received injection of citrate buffer, and those injection of RSC96 cells transfected with miR-155 antagomir NC, miR-155 agomir NC, Nrf2 NC or miR-155 agomir and Nrf2. Importantly, NeuN and CD31 protein expression in sciatic nerve was elevated in rats by inhibition of miR-155 or upregulation of Nrf2, while γH2AX, VEGF, IL-1β, IL-6 and TNF-α levels were diminished when compared to control (P < 0.05). However, overexpression of miR-155 resulted in a contrasting trend whereby NeuN and CD31 expression was reduced while γH2AX, VEGF, IL-1β, IL-6 and TNF-α levels were increased (P < 0.05). Taken together, silencing miR-155 or restoring Nrf2 alleviated nerve injury possibly through promoting angiogenesis and suppressing inflammatory reaction in vivo.

Discussion

DPN is known as one of the most common condition that complicates DM, a common metabolic disease worldwide (Wang et al. 2017). It has been proposed that the prevalence of DPN can be reduced by progressive improvements in the arena of clinical examination and diagnostic techniques (Tabatabaei-Malazy et al. 2011). Recent published data have implicated certain miRNAs in the development and progression of DPN (Sankrityayan et al. 2019). Hence, the current study aimed to investigate the mechanism by which miR-155 could influence DPN. Our results revealed that repressed miR-155 could alleviate nerve injury in DPN by up-regulating Nrf2, providing evidence suggesting the potential of miR-155/Nrf2 as a therapeutic target for patients with DPN.

A key finding of the current study revealed that miR-155 targeted and suppressed the expression of Nrf2. The regulation of miR-155 in cell malignant transformation by targeting Nrf2 was reported previously in human bronchial epithelial cells (Chen et al. 2017). It has been demonstrated that the expression of Nrf2 is elevated during vascular development and genetic ablation of Nrf2 that resulted in increased expression of ligand D114 and Notch activity in ECs, reduces vascular density and endothelial cell sprouting (Wei et al. 2013). However, this process has been speculated to be triggered through the inhibition of Vegf expression by Nrf2 gene deletion, as the interplay between Nrf2 and Vegf has been shown to contribute to venous hypertension-induced angiogenesis (Li et al. 2016). Nrf2 inducers have been shown to prevent the development of DPN (Uruno et al. 2015). The aforementioned literature led us to further investigate the expression profiles and functional roles of miR-155 and Nrf2 in DPN.

TUNEL-positive cells exhibited a dramatic increase following miR-155 mimic transfection in the current study, highlighting the stimulatory role of miR-115 on the apoptosis of SCs. The increase of miR-182 inhibited the proliferation and migration of the SCs in the event of sciatic nerve injury (Yu et al. 2012). Consistent with our findings, inhibition of miR-1 suppresses the apoptosis of SCs RSC96 and promotes nerve regeneration (Liu et al. 2018). Silencing miR-155 induced RSC96 cell proliferation and inhibited apoptosis by upregulation of Nrf2, possibly related to enhanced activities of NQO1, GST and GPX and decreased γH2AX. During the current study, the downregulation of miR-155 was also found to confer protection against ROS-induced DNA damage, which were shown by the results that enhanced activities of NQO1, GST and GPX as well as decreased γH2AX were caused by miR-155 antagomir via upregulation of Nrf2. NQO1 a phase II antioxidant enzyme in the obligate two-electron reductase family (Ross & Siegel 2017) has been reported to be induced by Nrf2 (Yamato et al. 2018). Furthermore, GST was previously shown to be activated by Nrf2 in response to oxidative stresses caused by xenobiotics (Chen et al. 2018). Moreover, Nrf2 has been previously shown to elevate the transcriptional activity of the target genes encoding antioxidant enzymes like GPX4 (Vnukov et al. 2015). Phosphorylated H2AX induced by ATM (called γH2AX) has been implicated in the damage repair processes responding to DNA double-strand breaks, indicating the potential of γH2AX as a promising molecular marker of DNA damage (Siddiqui et al. 2015). These results appeared to suggest that lower expression of Nrf2 would lead to reduced antioxidative function. This is particularly important from a DM perspective whereby ROS can be generated from the auto oxidation of glucose, activation of protein kinase C, methylglyoxal formation and glycosylation, hexosamine metabolism and the formation of sorbitol (Buraczynska et al. 2017). A previous study has revealed that ROS accumulation is induced by Nrf2 inhibition (Yang et al. 2018a). Therefore, excessive accumulation of ROS may be responsible for increased cell injury and death in DPN (Premkumar & Pabbidi 2013).

The inflammatory response has been shown to be affected by ROS (Mo et al. 2014). Attenuated inflammation triggered by miR-155 antagomir was identified during the current study, which was evidenced by a reduction in the levels of inflammatory factors. This result was in line other previous studies. For example, miR-155 antagomir has also been reported to reduce levels of pro-inflammatory cytokines, such as TNF-α and IL-6 (Yang et al. 2018b). In peripheral blood macrophages, miR-155 suppression has been shown to downregulate the expression levels of TNF-α and IL-1 (Li et al. 2013). Moreover, miR-155 inhibitor has been observed to contribute to a reduction in the protein levels of IL-1β, IL-6 and TNF-α to reduce inflammatory response (Tan et al. 2015). Inflammatory cytokines including IL-1β and IL-6 have been highlighted as candidates for assessing risk of the incident type 2 diabetes mellitus (T2DM) (Liu et al. 2016). Collectively, elevated miR-155 appeared to have a suppressive role in inflammation responses, whereby it may prevent progression while alleviating the degree of DPN severity.

Additionally, angiogenesis has been identified to be stimulated along with an increase in tube formation and higher expression level of VEGFR2 as well as NeuN and CD31 protein expression in the sciatic nerve in the presence of miR-155 antagomir. In diabetic neuropathy, a reduction of peripheral nerve microcirculation was induced by the destruction of blood vessels in nerve (Han et al. 2016). Diminished tube formation capacity has been documented as a feature of endothelial progenitor cell dysfunction induced by exposure to HG, which can be further rescued by anti-miR-155 (Gao et al. 2018). VEGFR2 has been identified as a tyrosine kinase receptor in association with angiogenesis (Simons et al. 2016). As a key regulator of the VEGF-mediated angiogenic signaling, VEGFR2 has been emphasized as a potential novel target for angiogenesis suppression in cancer when the expression of VEGFR2 is blocked (Fontanella et al. 2014). A notable correlation has been elucidated between miR-155 and angiogenesis in non-small-cell lung cancer (Donnem et al. 2012). Likewise, lower expression level of miR-155 has been indicated to be paralleled by angiogenesis repression in pancreatic cancer (Lin et al. 2015), which was in line with the observations of our study.

Conclusion

In conclusion, the key results of our study illustrate that the inhibition of miR-155 downregulates the expression of Nrf2, which ultimately alleviates DPN by suppressing angiogenesis and inflammation in a mouse model of DM. The study reveals that miR-155 inhibits Nrf2, which induces the neurological damage caused by induction of ROS. The proposed mechanism identified is summarized in Fig. 4. Our data provide strong evidence highlighting the promise of miR-155 as a potential therapeutic target for DPN. Targeted inhibition of miR-155-Nrf2 treatment could potentially help reduce hyperglycemia-induced oxidative stress and apoptosis and prevent diabetic nephropathy. Further investigations are required in order to determine the mechanism and effects of miR-155 and Nrf2 from a DPN perspective.

Figure 4
Figure 4

Schematic diagram showing potential mechanism of miR-155 and Nrf2 on the development of DPN. DPN, diabetic peripheral neuropathy; Nrf2, nuclear factor, erythroid 2-like 2; RISC, miRNA-induced silencing complex. A full colour version of this figure is available at https://doi.org/10.1530/JME-19-0067.

Citation: Journal of Molecular Endocrinology 63, 3; 10.1530/JME-19-0067

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by National Natural Science Foundation of China (No. 81870884).

Author contribution statement

J Chen and C Li designed the study. W Liu and B Yan collated the data, carried out data analyses and produced the initial draft of the manuscript. X Hu and F Yang contributed to drafting the manuscript. All authors have read and approved the final submitted manuscript.

Acknowledgments

The authors would like to acknowledge the helpful comments on this paper received from our reviewers.

References

  • Arocho A, Chen B, Ladanyi M & Pan Q 2006 Validation of the 2-DeltaDeltaCt calculation as an alternate method of data analysis for quantitative PCR of bcr-abl P210 transcripts. Diagnostic Molecular Pathology 5661. (https://doi.org/10.1097/00019606-200603000-00009)

    • Search Google Scholar
    • Export Citation
  • Buraczynska M, Buraczynska K, Dragan M & Ksiazek A 2017 Pro198Leu polymorphism in the glutathione peroxidase 1 gene contributes to diabetic peripheral neuropathy in Type 2 diabetes patients. NeuroMolecular Medicine 147153. (https://doi.org/10.1007/s12017-016-8438-2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen C, Jiang X, Gu S & Zhang Z 2017 MicroRNA-155 regulates arsenite-induced malignant transformation by targeting Nrf2-mediated oxidative damage in human bronchial epithelial cells. Toxicology Letters 3847. (https://doi.org/10.1016/j.toxlet.2017.07.215)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen S, Lu M, Zhang N, Zou X, Mo M & Zheng S 2018 Nuclear factor erythroid-derived 2-related factor 2 activates glutathione S-transferase expression in the midgut of Spodoptera litura (Lepidoptera: Noctuidae) in response to phytochemicals and insecticides. Insect Molecular Biology 522532. (https://doi.org/10.1111/imb.12391)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Donnem T, Fenton CG, Lonvik K, Berg T, Eklo K, Andersen S, Stenvold H, Al-Shibli K, Al-Saad S, Bremnes RM, et al. 2012 MicroRNA signatures in tumor tissue related to angiogenesis in non-small cell lung cancer. PLoS ONE e29671. (https://doi.org/10.1371/journal.pone.0029671)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • El-Lithy GM, El-Bakly WM, Matboli M, Abd-Alkhalek HA, Masoud SI & Hamza M 2016 Prophylactic L-arginine and ibuprofen delay the development of tactile allodynia and suppress spinal miR-155 in a rat model of diabetic neuropathy. Translational Research 85.e197.e1. (https://doi.org/10.1016/j.trsl.2016.06.005)

    • Search Google Scholar
    • Export Citation
  • Fontanella C, Ongaro E, Bolzonello S, Guardascione M, Fasola G & Aprile G 2014 Clinical advances in the development of novel VEGFR2 inhibitors. Annals of Translational Medicine 123. (https://doi.org/10.3978/j.issn.2305-5839.2014.08.14)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gao J, Zhao G, Li W, Zhang J, Che Y, Song M, Gao S, Zeng B & Wang Y 2018 MiR-155 targets PTCH1 to mediate endothelial progenitor cell dysfunction caused by high glucose. Experimental Cell Research 5562. (https://doi.org/10.1016/j.yexcr.2018.03.012)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gok Metin Z, Arikan Donmez A, Izgu N, Ozdemir L & Arslan IE 2017 Aromatherapy massage for neuropathic pain and quality of life in diabetic patients. Journal of Nursing Scholarship 379388. (https://doi.org/10.1111/jnu.12300)

    • Search Google Scholar
    • Export Citation
  • Ha M & Kim VN 2014 Regulation of microRNA biogenesis. Nature Reviews: Molecular Cell Biology 509524. (https://doi.org/10.1038/nrm3838)

  • Hammond SM 2015 An overview of microRNAs. Advanced Drug Delivery Reviews 314. (https://doi.org/10.1016/j.addr.2015.05.001)

  • Han JW, Choi D, Lee MY, Huh YH & Yoon YS 2016 Bone marrow-derived mesenchymal stem cells improve diabetic neuropathy by direct modulation of both angiogenesis and myelination in peripheral nerves. Cell Transplantation 313326. (https://doi.org/10.3727/096368915X688209)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hybertson BM, Gao B, Bose SK & McCord JM 2011 Oxidative stress in health and disease: the therapeutic potential of Nrf2 activation. Molecular Aspects of Medicine 234246. (https://doi.org/10.1016/j.mam.2011.10.006)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ilan N & Madri JA 2003 PECAM-1: old friend, new partners. Current Opinion in Cell Biology 515524. (https://doi.org/10.1016/S0955-0674(03)00100-5)

  • Javed S, Alam U & Malik RA 2015 Burning through the pain: treatments for diabetic neuropathy. Diabetes, Obesity and Metabolism 11151125. (https://doi.org/10.1111/dom.12535)

    • Search Google Scholar
    • Export Citation
  • Jung HJ & Suh Y 2014 Circulating miRNAs in ageing and ageing-related diseases. Journal of Genetics and Genomics 465472. (https://doi.org/10.1016/j.jgg.2014.07.003)

    • Search Google Scholar
    • Export Citation
  • Khamaneh AM, Alipour MR, Sheikhzadeh Hesari F & Ghadiri Soufi F 2015 A signature of microRNA-155 in the pathogenesis of diabetic complications. Journal of Physiology and Biochemistry 301309. (https://doi.org/10.1007/s13105-015-0413-0)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kumar A & Mittal R 2017 Nrf2: a potential therapeutic target for diabetic neuropathy. Inflammopharmacology 393402. (https://doi.org/10.1007/s10787-017-0339-y)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lee CC, Perkins BA, Kayaniyil S, Harris SB, Retnakaran R, Gerstein HC, Zinman B & Hanley AJ 2015 Peripheral neuropathy and nerve dysfunction in individuals at high risk for Type 2 diabetes: the PROMISE cohort. Diabetes Care 793800. (https://doi.org/10.2337/dc14-2585)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Li X, Tian F & Wang F 2013 Rheumatoid arthritis-associated microRNA-155 targets SOCS1 and upregulates TNF-alpha and IL-1beta in PBMCs. International Journal of Molecular Sciences 2391023921. (https://doi.org/10.3390/ijms141223910)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Li L, Pan H, Wang H, Li X, Bu X, Wang Q, Gao Y, Wen G, Zhou Y, Cong Z, et al. 2016 Interplay between VEGF and Nrf2 regulates angiogenesis due to intracranial venous hypertension. Scientific Reports 37338. (https://doi.org/10.1038/srep37338)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lin SZ, Xu JB, Ji X, Chen H, Xu HT, Hu P, Chen L, Guo JQ, Chen MY, Lu D, et al. 2015 Emodin inhibits angiogenesis in pancreatic cancer by regulating the transforming growth factor-beta/drosophila mothers against decapentaplegic pathway and angiogenesis-associated microRNAs. Molecular Medicine Reports 58655871. (https://doi.org/10.3892/mmr.2015.4158)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu C, Feng X, Li Q, Wang Y, Li Q & Hua M 2016 Adiponectin, TNF-alpha and inflammatory cytokines and risk of type 2 diabetes: a systematic review and meta-analysis. Cytokine 100109. (https://doi.org/10.1016/j.cyto.2016.06.028)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu YP, Xu P, Guo CX, Luo ZR, Zhu J, Mou FF, Cai H, Wang C, Ye XC, Shao SJ, et al. 2018 miR-1b overexpression suppressed proliferation and migration of RSC96 and increased cell apoptosis. Neuroscience Letters 137145. (https://doi.org/10.1016/j.neulet.2018.09.041)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mo C, Wang L, Zhang J, Numazawa S, Tang H, Tang X, Han X, Li J, Yang M, Wang Z, et al. 2014 The crosstalk between Nrf2 and AMPK signal pathways is important for the anti-inflammatory effect of berberine in LPS-stimulated macrophages and endotoxin-shocked mice. Antioxidants and Redox Signaling 574588. (https://doi.org/10.1089/ars.2012.5116)

    • Search Google Scholar
    • Export Citation
  • Mullen RJ, Buck CR & Smith AM 1992 NeuN, a neuronal specific nuclear protein in vertebrates. Development 201211.

  • Premkumar LS & Pabbidi RM 2013 Diabetic peripheral neuropathy: role of reactive oxygen and nitrogen species. Cell Biochemistry and Biophysics 373383. (https://doi.org/10.1007/s12013-013-9609-5)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ross D & Siegel D 2017 Functions of NQO1 in cellular protection and CoQ10 metabolism and its potential role as a redox sensitive molecular switch. Frontiers in Physiology 595. (https://doi.org/10.3389/fphys.2017.00595)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sankrityayan H, Kulkarni YA & Gaikwad AB 2019 Diabetic nephropathy: the regulatory interplay between epigenetics and microRNAs. Pharmacological Research 574585. (https://doi.org/10.1016/j.phrs.2019.01.043)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Siddiqui MS, Francois M, Fenech MF & Leifert WR 2015 Persistent gammaH2AX: a promising molecular marker of DNA damage and aging. Mutation Research: Reviews in Mutation Research 119. (https://doi.org/10.1016/j.mrrev.2015.07.001)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Simons M, Gordon E & Claesson-Welsh L 2016 Mechanisms and regulation of endothelial VEGF receptor signalling. Nature Reviews: Molecular Cell Biology 611625. (https://doi.org/10.1038/nrm.2016.87)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tabatabaei-Malazy O, Mohajeri-Tehrani M, Madani S, Heshmat R & Larijani B 2011 The prevalence of diabetic peripheral neuropathy and related factors. Iranian Journal of Public Health 5562.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tan Y, Yang J, Xiang K, Tan Q & Guo Q 2015 Suppression of microRNA-155 attenuates neuropathic pain by regulating SOCS1 signalling pathway. Neurochemical Research 550560. (https://doi.org/10.1007/s11064-014-1500-2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Uruno A, Yagishita Y & Yamamoto M 2015 The Keap1-Nrf2 system and diabetes mellitus. Archives of Biochemistry and Biophysics 7684. (https://doi.org/10.1016/j.abb.2014.12.012)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vnukov VV, Gutsenko OI, Milutina NP, Kornienko IV, Ananyan AA, Danilenko AO, Panina SB, Plotnikov AA & Makarenko MS 2015 Influence of SkQ1 on expression of Nrf2 gene, ARE-controlled genes of antioxidant enzymes and their activity in rat blood leukocytes under oxidative stress. Biochemistry 15981605. (https://doi.org/10.1134/S0006297915120081)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang F, Zhang J, Yu J, Liu S, Zhang R, Ma X, Yang Y & Wang P 2017 Diagnostic accuracy of monofilament tests for detecting diabetic peripheral neuropathy: a systematic review and meta-analysis. Journal of Diabetes Research 8787261. (https://doi.org/10.1155/2017/8787261)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wei Y, Gong J, Thimmulappa RK, Kosmider B, Biswal S & Duh EJ 2013 Nrf2 acts cell-autonomously in endothelium to regulate tip cell formation and vascular branching. PNAS E3910E3918. (https://doi.org/10.1073/pnas.1309276110)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Whiting DR, Guariguata L, Weil C & Shaw J 2011 IDF diabetes atlas: global estimates of the prevalence of diabetes for 2011 and 2030. Diabetes Research and Clinical Practice 311321. (https://doi.org/10.1016/j.diabres.2011.10.029)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Xiong W, MacColl Garfinkel AE, Li Y, Benowitz LI & Cepko CL 2015 NRF2 promotes neuronal survival in neurodegeneration and acute nerve damage. Journal of Clinical Investigation 14331445. (https://doi.org/10.1172/JCI79735)

    • Search Google Scholar
    • Export Citation
  • Yamato O, Tsuneyoshi T, Ushijima M, Jikihara H & Yabuki A 2018 Safety and efficacy of aged garlic extract in dogs: upregulation of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway and Nrf2-regulated phase II antioxidant enzymes. BMC Veterinary Research 373. (https://doi.org/10.1186/s12917-018-1699-2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yang X, Yao W, Shi H, Liu H, Li Y, Gao Y, Liu R & Xu L 2016 Paeoniflorin protects Schwann cells against high glucose induced oxidative injury by activating Nrf2/ARE pathway and inhibiting apoptosis. Journal of Ethnopharmacology 361369. (https://doi.org/10.1016/j.jep.2016.03.031)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yang Y, Tian Z, Ding Y, Li X, Zhang Z, Yang L, Zhao F, Ren F & Guo R 2018a EGFR-targeted immunotoxin exerts antitumor effects on esophageal cancers by increasing ROS Accumulation and inducing apoptosis via inhibition of the Nrf2-Keap1 pathway. Journal of Immunology Research 1090287. (https://doi.org/10.1155/2018/1090287)

    • Search Google Scholar
    • Export Citation
  • Yang ZB, Chen WW, Chen HP, Cai SX, Lin JD & Qiu LZ 2018b MiR-155 aggravated septic liver injury by oxidative stress-mediated ER stress and mitochondrial dysfunction via targeting Nrf-2. Experimental and Molecular Pathology 387394. (https://doi.org/10.1016/j.yexmp.2018.09.003)

    • Search Google Scholar
    • Export Citation
  • Yu B, Qian T, Wang Y, Zhou S, Ding G, Ding F & Gu X 2012 miR-182 inhibits Schwann cell proliferation and migration by targeting FGF9 and NTM, respectively at an early stage following sciatic nerve injury. Nucleic Acids Research 1035610365. (https://doi.org/10.1093/nar/gks750)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zimmet PZ, Magliano DJ, Herman WH & Shaw JE 2014 Diabetes: a 21st century challenge. Lancet: Diabetes and Endocrinology 5664. (https://doi.org/10.1016/S2213-8587(13)70112-8)

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 1526 1145 0
Full Text Views 179 114 72
PDF Downloads 84 60 37
  • View in gallery

    Interactions between miR-155 and Nrf2 in DPN. (A) Binding sites between miR-155 and Nrf2 are predicted by online software. (B) Luciferase activity of Nrf2-WT and Nrf2-MUT after transfection with miR-155, detected by dual-luciferase reporter gene assay. *P < 0.05 vs cells co-transfected with NC and Nrf2-WT. (C) mRNA expression of miR-155 and (D and E) Protein expression of NRF2 normalized to GAPDH in the normal rats and rats from the STZ-induced DPN model determined by Western blot analysis. *P < 0.05 vs normal group. (F) mRNA expression of miR-155 and Nrf2 determined by RT-qPCR after delivery of miR-155 inhibitor, miR-155 mimic or Nrf2. *P < 0.05 vs blank group. (G and H) protein expression of NRF2 normalized to GAPDH determined by Western blot analysis after delivery of miR-155 inhibitor, miR-155 mimic or NRF2; *P < 0.05 vs blank group. Cell experiments were repeated three times. DPN, diabetic peripheral neuropathy; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MUT, mutant; Nrf2, nuclear factor, erythroid 2-like 2; WT, wild type.

  • View in gallery

    Effects of silencing miR-155 or restoring Nrf2 on Schwann cells. (A) Representative micrographs showing RSC96 cell proliferation after EdU assay in different groups (×200). (B) The number of EdU-positive cells. (C) Representative micrographs showing cell apoptosis in TUNEL assay (×200). (D) The number of TUNEL-positive cells. (E) mRNA expression of apoptosis-related genes determined by RT-qPCR. (F and G) Levels of apoptosis-related proteins determined by Western blot. (H) ROS activity in RSC96 cells. (I) VEGF, IL-1β, IL-6 and TNF-α levels in RSC96 cells detected by ELISA. *P < 0.05 vs blank group. Cell experiments were repeated three times. Nrf2, nuclear factor, erythroid 2-like 2; ROS, reactive oxygen species; TUNEL, TdT mediated dUTP nick end labeling; Bcl-2, B-cell lymphoma-2; Bax, Bcl-2 associated protein X; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; VEGF, vascular endothelial growth factor; IL, interleukin; TNF, tumor necrosis factor. A full colour version of this figure is available at https://doi.org/10.1530/JME-19-0067.

  • View in gallery

    Effects of silencing miR-155 or restoring Nrf2 on DPN rats. (A) Motor nerve conduction velocity in sciatic nerves. (B) Sensory nerve conduction velocity in sciatic nerves. (C) Representative micrographs illustrating the morphological changes in sciatic nerve observed under a transmission electron microscope (10,000×). (D) Number of blood vessels in sciatic nerve from each group. (E) Number of nerve fibers in each group. (F) Axon diameter in myelinated nerve fibers in each group. (G) Myelin sheath thickness of sciatic nerves in each group. (H) Number of tube formation in each group. (I) mRNA expression of Vegfr2 in rat EPCs from each group. (J) Activities of NQO1, GST and GPX in each group determined by ELISA. (K) Representative micrographs showing cell apoptosis in TUNEL assay (×400). (L) Number of TUNEL positive cells in each group. (M) Representative micrographs showing immunofluorescence staining of NeuN and CD31 in sciatic nerve from different groups (×400). (N) γH2AX expression in sciatic nerve from each group detected by immunofluorescence (×400). (O) VEGF, IL-1β, IL-6 and TNF-α levels in each group determined by ELISA. *P < 0.05 vs blank group. n = 6/group. Nrf2, nuclear factor, erythroid 2-like 2; DPN, diabetic peripheral neuropathy; EPC, endothelial progenitor cell; Vegfr2, vascular endothelial growth factor receptor 2; NQO1, NAD (P) H quinone oxidoreductase 1; GST, glutathione S-transferase; GPX, glutathione peroxidase; TUNEL, TdT mediated dUTP nick end labeling; VEGF, vascular endothelial growth factor; IL, interleukin; TNF, tumor necrosis factor. A full colour version of this figure is available at https://doi.org/10.1530/JME-19-0067.

  • View in gallery

    Schematic diagram showing potential mechanism of miR-155 and Nrf2 on the development of DPN. DPN, diabetic peripheral neuropathy; Nrf2, nuclear factor, erythroid 2-like 2; RISC, miRNA-induced silencing complex. A full colour version of this figure is available at https://doi.org/10.1530/JME-19-0067.

  • Arocho A, Chen B, Ladanyi M & Pan Q 2006 Validation of the 2-DeltaDeltaCt calculation as an alternate method of data analysis for quantitative PCR of bcr-abl P210 transcripts. Diagnostic Molecular Pathology 5661. (https://doi.org/10.1097/00019606-200603000-00009)

    • Search Google Scholar
    • Export Citation
  • Buraczynska M, Buraczynska K, Dragan M & Ksiazek A 2017 Pro198Leu polymorphism in the glutathione peroxidase 1 gene contributes to diabetic peripheral neuropathy in Type 2 diabetes patients. NeuroMolecular Medicine 147153. (https://doi.org/10.1007/s12017-016-8438-2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen C, Jiang X, Gu S & Zhang Z 2017 MicroRNA-155 regulates arsenite-induced malignant transformation by targeting Nrf2-mediated oxidative damage in human bronchial epithelial cells. Toxicology Letters 3847. (https://doi.org/10.1016/j.toxlet.2017.07.215)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen S, Lu M, Zhang N, Zou X, Mo M & Zheng S 2018 Nuclear factor erythroid-derived 2-related factor 2 activates glutathione S-transferase expression in the midgut of Spodoptera litura (Lepidoptera: Noctuidae) in response to phytochemicals and insecticides. Insect Molecular Biology 522532. (https://doi.org/10.1111/imb.12391)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Donnem T, Fenton CG, Lonvik K, Berg T, Eklo K, Andersen S, Stenvold H, Al-Shibli K, Al-Saad S, Bremnes RM, et al. 2012 MicroRNA signatures in tumor tissue related to angiogenesis in non-small cell lung cancer. PLoS ONE e29671. (https://doi.org/10.1371/journal.pone.0029671)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • El-Lithy GM, El-Bakly WM, Matboli M, Abd-Alkhalek HA, Masoud SI & Hamza M 2016 Prophylactic L-arginine and ibuprofen delay the development of tactile allodynia and suppress spinal miR-155 in a rat model of diabetic neuropathy. Translational Research 85.e197.e1. (https://doi.org/10.1016/j.trsl.2016.06.005)

    • Search Google Scholar
    • Export Citation
  • Fontanella C, Ongaro E, Bolzonello S, Guardascione M, Fasola G & Aprile G 2014 Clinical advances in the development of novel VEGFR2 inhibitors. Annals of Translational Medicine 123. (https://doi.org/10.3978/j.issn.2305-5839.2014.08.14)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gao J, Zhao G, Li W, Zhang J, Che Y, Song M, Gao S, Zeng B & Wang Y 2018 MiR-155 targets PTCH1 to mediate endothelial progenitor cell dysfunction caused by high glucose. Experimental Cell Research 5562. (https://doi.org/10.1016/j.yexcr.2018.03.012)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gok Metin Z, Arikan Donmez A, Izgu N, Ozdemir L & Arslan IE 2017 Aromatherapy massage for neuropathic pain and quality of life in diabetic patients. Journal of Nursing Scholarship 379388. (https://doi.org/10.1111/jnu.12300)

    • Search Google Scholar
    • Export Citation
  • Ha M & Kim VN 2014 Regulation of microRNA biogenesis. Nature Reviews: Molecular Cell Biology 509524. (https://doi.org/10.1038/nrm3838)

  • Hammond SM 2015 An overview of microRNAs. Advanced Drug Delivery Reviews 314. (https://doi.org/10.1016/j.addr.2015.05.001)

  • Han JW, Choi D, Lee MY, Huh YH & Yoon YS 2016 Bone marrow-derived mesenchymal stem cells improve diabetic neuropathy by direct modulation of both angiogenesis and myelination in peripheral nerves. Cell Transplantation 313326. (https://doi.org/10.3727/096368915X688209)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hybertson BM, Gao B, Bose SK & McCord JM 2011 Oxidative stress in health and disease: the therapeutic potential of Nrf2 activation. Molecular Aspects of Medicine 234246. (https://doi.org/10.1016/j.mam.2011.10.006)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ilan N & Madri JA 2003 PECAM-1: old friend, new partners. Current Opinion in Cell Biology 515524. (https://doi.org/10.1016/S0955-0674(03)00100-5)

  • Javed S, Alam U & Malik RA 2015 Burning through the pain: treatments for diabetic neuropathy. Diabetes, Obesity and Metabolism 11151125. (https://doi.org/10.1111/dom.12535)

    • Search Google Scholar
    • Export Citation
  • Jung HJ & Suh Y 2014 Circulating miRNAs in ageing and ageing-related diseases. Journal of Genetics and Genomics 465472. (https://doi.org/10.1016/j.jgg.2014.07.003)

    • Search Google Scholar
    • Export Citation
  • Khamaneh AM, Alipour MR, Sheikhzadeh Hesari F & Ghadiri Soufi F 2015 A signature of microRNA-155 in the pathogenesis of diabetic complications. Journal of Physiology and Biochemistry 301309. (https://doi.org/10.1007/s13105-015-0413-0)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kumar A & Mittal R 2017 Nrf2: a potential therapeutic target for diabetic neuropathy. Inflammopharmacology 393402. (https://doi.org/10.1007/s10787-017-0339-y)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lee CC, Perkins BA, Kayaniyil S, Harris SB, Retnakaran R, Gerstein HC, Zinman B & Hanley AJ 2015 Peripheral neuropathy and nerve dysfunction in individuals at high risk for Type 2 diabetes: the PROMISE cohort. Diabetes Care 793800. (https://doi.org/10.2337/dc14-2585)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Li X, Tian F & Wang F 2013 Rheumatoid arthritis-associated microRNA-155 targets SOCS1 and upregulates TNF-alpha and IL-1beta in PBMCs. International Journal of Molecular Sciences 2391023921. (https://doi.org/10.3390/ijms141223910)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Li L, Pan H, Wang H, Li X, Bu X, Wang Q, Gao Y, Wen G, Zhou Y, Cong Z, et al. 2016 Interplay between VEGF and Nrf2 regulates angiogenesis due to intracranial venous hypertension. Scientific Reports 37338. (https://doi.org/10.1038/srep37338)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lin SZ, Xu JB, Ji X, Chen H, Xu HT, Hu P, Chen L, Guo JQ, Chen MY, Lu D, et al. 2015 Emodin inhibits angiogenesis in pancreatic cancer by regulating the transforming growth factor-beta/drosophila mothers against decapentaplegic pathway and angiogenesis-associated microRNAs. Molecular Medicine Reports 58655871. (https://doi.org/10.3892/mmr.2015.4158)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu C, Feng X, Li Q, Wang Y, Li Q & Hua M 2016 Adiponectin, TNF-alpha and inflammatory cytokines and risk of type 2 diabetes: a systematic review and meta-analysis. Cytokine 100109. (https://doi.org/10.1016/j.cyto.2016.06.028)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liu YP, Xu P, Guo CX, Luo ZR, Zhu J, Mou FF, Cai H, Wang C, Ye XC, Shao SJ, et al. 2018 miR-1b overexpression suppressed proliferation and migration of RSC96 and increased cell apoptosis. Neuroscience Letters 137145. (https://doi.org/10.1016/j.neulet.2018.09.041)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Mo C, Wang L, Zhang J, Numazawa S, Tang H, Tang X, Han X, Li J, Yang M, Wang Z, et al. 2014 The crosstalk between Nrf2 and AMPK signal pathways is important for the anti-inflammatory effect of berberine in LPS-stimulated macrophages and endotoxin-shocked mice. Antioxidants and Redox Signaling 574588. (https://doi.org/10.1089/ars.2012.5116)

    • Search Google Scholar
    • Export Citation
  • Mullen RJ, Buck CR & Smith AM 1992 NeuN, a neuronal specific nuclear protein in vertebrates. Development 201211.

  • Premkumar LS & Pabbidi RM 2013 Diabetic peripheral neuropathy: role of reactive oxygen and nitrogen species. Cell Biochemistry and Biophysics 373383. (https://doi.org/10.1007/s12013-013-9609-5)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ross D & Siegel D 2017 Functions of NQO1 in cellular protection and CoQ10 metabolism and its potential role as a redox sensitive molecular switch. Frontiers in Physiology 595. (https://doi.org/10.3389/fphys.2017.00595)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sankrityayan H, Kulkarni YA & Gaikwad AB 2019 Diabetic nephropathy: the regulatory interplay between epigenetics and microRNAs. Pharmacological Research 574585. (https://doi.org/10.1016/j.phrs.2019.01.043)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Siddiqui MS, Francois M, Fenech MF & Leifert WR 2015 Persistent gammaH2AX: a promising molecular marker of DNA damage and aging. Mutation Research: Reviews in Mutation Research 119. (https://doi.org/10.1016/j.mrrev.2015.07.001)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Simons M, Gordon E & Claesson-Welsh L 2016 Mechanisms and regulation of endothelial VEGF receptor signalling. Nature Reviews: Molecular Cell Biology 611625. (https://doi.org/10.1038/nrm.2016.87)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tabatabaei-Malazy O, Mohajeri-Tehrani M, Madani S, Heshmat R & Larijani B 2011 The prevalence of diabetic peripheral neuropathy and related factors. Iranian Journal of Public Health 5562.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tan Y, Yang J, Xiang K, Tan Q & Guo Q 2015 Suppression of microRNA-155 attenuates neuropathic pain by regulating SOCS1 signalling pathway. Neurochemical Research 550560. (https://doi.org/10.1007/s11064-014-1500-2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Uruno A, Yagishita Y & Yamamoto M 2015 The Keap1-Nrf2 system and diabetes mellitus. Archives of Biochemistry and Biophysics 7684. (https://doi.org/10.1016/j.abb.2014.12.012)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vnukov VV, Gutsenko OI, Milutina NP, Kornienko IV, Ananyan AA, Danilenko AO, Panina SB, Plotnikov AA & Makarenko MS 2015 Influence of SkQ1 on expression of Nrf2 gene, ARE-controlled genes of antioxidant enzymes and their activity in rat blood leukocytes under oxidative stress. Biochemistry 15981605. (https://doi.org/10.1134/S0006297915120081)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang F, Zhang J, Yu J, Liu S, Zhang R, Ma X, Yang Y & Wang P 2017 Diagnostic accuracy of monofilament tests for detecting diabetic peripheral neuropathy: a systematic review and meta-analysis. Journal of Diabetes Research 8787261. (https://doi.org/10.1155/2017/8787261)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wei Y, Gong J, Thimmulappa RK, Kosmider B, Biswal S & Duh EJ 2013 Nrf2 acts cell-autonomously in endothelium to regulate tip cell formation and vascular branching. PNAS E3910E3918. (https://doi.org/10.1073/pnas.1309276110)

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Whiting DR, Guariguata L, Weil C & Shaw J 2011 IDF diabetes atlas: global estimates of the prevalence of diabetes for 2011 and 2030. Diabetes Research and Clinical Practice 311321. (https://doi.org/10.1016/j.diabres.2011.10.029)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Xiong W, MacColl Garfinkel AE, Li Y, Benowitz LI & Cepko CL 2015 NRF2 promotes neuronal survival in neurodegeneration and acute nerve damage. Journal of Clinical Investigation 14331445. (https://doi.org/10.1172/JCI79735)

    • Search Google Scholar
    • Export Citation
  • Yamato O, Tsuneyoshi T, Ushijima M, Jikihara H & Yabuki A 2018 Safety and efficacy of aged garlic extract in dogs: upregulation of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway and Nrf2-regulated phase II antioxidant enzymes. BMC Veterinary Research 373. (https://doi.org/10.1186/s12917-018-1699-2)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yang X, Yao W, Shi H, Liu H, Li Y, Gao Y, Liu R & Xu L 2016 Paeoniflorin protects Schwann cells against high glucose induced oxidative injury by activating Nrf2/ARE pathway and inhibiting apoptosis. Journal of Ethnopharmacology 361369. (https://doi.org/10.1016/j.jep.2016.03.031)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yang Y, Tian Z, Ding Y, Li X, Zhang Z, Yang L, Zhao F, Ren F & Guo R 2018a EGFR-targeted immunotoxin exerts antitumor effects on esophageal cancers by increasing ROS Accumulation and inducing apoptosis via inhibition of the Nrf2-Keap1 pathway. Journal of Immunology Research 1090287. (https://doi.org/10.1155/2018/1090287)

    • Search Google Scholar
    • Export Citation
  • Yang ZB, Chen WW, Chen HP, Cai SX, Lin JD & Qiu LZ 2018b MiR-155 aggravated septic liver injury by oxidative stress-mediated ER stress and mitochondrial dysfunction via targeting Nrf-2. Experimental and Molecular Pathology 387394. (https://doi.org/10.1016/j.yexmp.2018.09.003)

    • Search Google Scholar
    • Export Citation
  • Yu B, Qian T, Wang Y, Zhou S, Ding G, Ding F & Gu X 2012 miR-182 inhibits Schwann cell proliferation and migration by targeting FGF9 and NTM, respectively at an early stage following sciatic nerve injury. Nucleic Acids Research 1035610365. (https://doi.org/10.1093/nar/gks750)

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zimmet PZ, Magliano DJ, Herman WH & Shaw JE 2014 Diabetes: a 21st century challenge. Lancet: Diabetes and Endocrinology 5664. (https://doi.org/10.1016/S2213-8587(13)70112-8)

    • Search Google Scholar
    • Export Citation